MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-184E20
Chromosome	X (Build37)
Map Location	30,779,566 - 30,982,443
singlet/doublet	doublet
Overlap gene	LOC665014, EG546205, LOC100040533
Upstream gene	LOC100039212, EG664989, LOC664996, LOC100039467, LOC100039481, LOC100039224, LOC100039500, LOC100040448, LOC100040458, LOC100040467, EG546176, LOC100040482, LOC629997, 1700017G21Rik
Downstream gene	LOC100039328, LOC100040552, LOC100040575, LOC100040585, LOC100039362, LOC100040606, LOC100040612, LOC673784, LOC100040650, LOC100040662, LOC100039419, LOC100039429, LOC100040698, LOC630028, LOC100040722, LOC100040732, LOC100040743
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039212 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG664989 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 5 Proteins

name	LOC100039481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs

name	LOC100039224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100039500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	LOC100040448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040458 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins

name	EG546176 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546176 MGI:3645924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100040482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC629997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	1700017G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71847 MGI:1919097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG546205 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546205 MGI:3647272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 24 Proteins

name	LOC100040533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100039328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100040552 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	LOC100040575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins pseudo : _no_value

name	LOC100040585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 26 Proteins

name	LOC100039362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	LOC673784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100040650 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 26 Proteins

name	LOC100040662 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100039419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 656 ESTs, 8 Proteins

name	LOC100039429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC630028 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100040722 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC100040732 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC100040743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100039212 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271417 GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472463.1

name	LOC664996 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271422 GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC664996 transcript_id : XM_973930.2

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271425 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001473144.1

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271423 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001473126.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271429 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039481, transcript variant 1 transcript_id : XM_001473156.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271427 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100039481, transcript variant 2 transcript_id : XM_001473178.1

name	LOC100039224 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271419 GeneID:100039224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472484.1

name	LOC100040448 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271435 GeneID:100040448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474927.1

name	LOC100040458 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271437 GeneID:100040458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474942.1

name	LOC100040467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271439 GeneID:100040467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001474959.1

name	EG546176 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407266 GeneID:546176 MGI:3645924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : predicted gene, EG546176 transcript_id : XM_620811.3

name	LOC100040482 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271441 GeneID:100040482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474981.1

name	1700017G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803050 GeneID:71847 MGI:1919097
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700017G21 gene transcript_id : NM_027955.2

name	EG546205 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271443 GeneID:546205 MGI:3647272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 24 Proteins product : predicted gene, EG546205 transcript_id : XM_620848.4

name	LOC100040533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271444 GeneID:100040533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001475026.1

name	LOC100040552 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271446 GeneID:100040552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : similar to 4930408F14Rik protein transcript_id : XM_001475040.1

name	LOC100040585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271451 GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001475099.1

name	LOC100040585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271449 GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001475074.1

name	LOC100040606 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271453 GeneID:100040606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001475118.1

name	LOC100040612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271455 GeneID:100040612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : similar to 4930408F14Rik protein transcript_id : XM_001475133.1

name	LOC100040650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271457 GeneID:100040650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001475157.1

name	LOC100040650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271459 GeneID:100040650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001475170.1

name	LOC100040662 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271461 GeneID:100040662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001475195.1

name	LOC100039419 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271433 GeneID:100039419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 656 ESTs, 8 Proteins product : similar to translation initiation factor eIF-2 gamma subunit transcript_id : XM_001472848.1

name	LOC100040698 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271463 GeneID:100040698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to mgclh transcript_id : XM_001475217.1

name	LOC100040722 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271465 GeneID:100040722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to mgclh transcript_id : XM_001475235.1

name	LOC100040732 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271467 GeneID:100040732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to RIKEN cDNA 1700017G21 gene transcript_id : XM_001475255.1

name	LOC100040743 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271469 GeneID:100040743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001475272.1

name	LOC100039212 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271418 GeneID:100039212
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472513.1

name	LOC664996 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407262 GeneID:664996
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979024.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271424 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473176.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271426 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473194.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271428 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473228.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271430 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473206.1

name	LOC100039224 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271420 GeneID:100039224
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472534.1

name	LOC100040448 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271436 GeneID:100040448
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474977.1

name	LOC100040458 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271438 GeneID:100040458
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474992.1

name	LOC100040467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271440 GeneID:100040467
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475009.1

name	EG546176 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63830935 GeneID:546176 MGI:3645924
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_620811.1

name	LOC100040482 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271442 GeneID:100040482
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475031.1

name	1700017G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313693 GeneID:71847 MGI:1919097
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC71847 protein_id : NP_082231.1

name	EG546205 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63831219 GeneID:546205 MGI:3647272
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_620848.1

name	LOC100040533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271445 GeneID:100040533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475076.1

name	LOC100040552 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271447 GeneID:100040552
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475090.1

name	LOC100040585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271450 GeneID:100040585
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 1 protein_id : XP_001475124.1

name	LOC100040585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271452 GeneID:100040585
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 2 protein_id : XP_001475149.1

name	LOC100040606 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271454 GeneID:100040606
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475168.1

name	LOC100040612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271456 GeneID:100040612
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475183.1

name	LOC100040650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271458 GeneID:100040650
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 1 protein_id : XP_001475207.1

name	LOC100040650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271460 GeneID:100040650
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 2 protein_id : XP_001475220.1

name	LOC100040662 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271462 GeneID:100040662
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475245.1

name	LOC100039419 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271434 GeneID:100039419
definition	codon_start : 1 product : similar to translation initiation factor eIF-2 gamma subunit protein_id : XP_001472898.1

name	LOC100040698 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271464 GeneID:100040698
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475267.1

name	LOC100040722 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271466 GeneID:100040722
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475285.1

name	LOC100040732 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271468 GeneID:100040732
definition	codon_start : 1 product : similar to RIKEN cDNA 1700017G21 gene protein_id : XP_001475305.1

name	LOC100040743 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271470 GeneID:100040743
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475322.1

name	LOC629997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629997
definition	number : 1 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 3 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 2 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 1 pseudo : _no_value

name	LOC100039328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039328
definition	number : 2 pseudo : _no_value

name	LOC100039328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039328
definition	number : 1 pseudo : _no_value

name	LOC100039362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039362
definition	number : 1 pseudo : _no_value

name	LOC673784 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673784
definition	number : 3 pseudo : _no_value

name	LOC673784 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673784
definition	number : 2 pseudo : _no_value

name	LOC673784 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673784
definition	number : 1 pseudo : _no_value

name	LOC100039429 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039429
definition	number : 1 pseudo : _no_value

name	LOC100039429 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039429
definition	number : 2 pseudo : _no_value

name	LOC630028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630028
definition	number : 1 pseudo : _no_value

name	LOC630028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630028
definition	number : 2 pseudo : _no_value

name	EG664989 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271421 GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664989 pseudo : _no_value transcript_id : XR_035658.1

name	LOC100039500 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271431 GeneID:100039500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated pseudo : _no_value transcript_id : XR_031082.1

name	LOC100040575 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271448 GeneID:100040575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins product : similar to mgclh pseudo : _no_value transcript_id : XR_032063.1

clone name	MSMg01-280I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-547A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-261I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-371B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-383M18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-414F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-131B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539N22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313J05
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-334H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071O01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-184E20.b	B6Ng01-184E20.g
ACC	GA009713	GA009714
length	1,144	1,068
definition	B6Ng01-184E20.b	B6Ng01-184E20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(30,779,566 - 30,780,536)	(30,981,373 - 30,982,443)
sequence	gaattctcagctttactggctttattgtgcaaaccttattccttgattta aaattacaggttaaatacaattagctacaaacatttactggaagattaaa ggtttggagtgacctgaatgcaagagagacagagaagaggagaggaagaa caggagagaagaggaagccaccatgggggagaggaaccatgaacacttgg ccataagaaacaacaagtatctgggatcctttgctagggaagtagctagg ccagcaattagtagattaggggtgatcccccagtaattaccaatgccaaa ttaaataaccatagtctgagtctcatttatgtgtaaactcataggggata gcttaaattggttgtattctagactttatatgggtgtagtagctcctgac attactagaagacaccatctcataaaagtccctgcttctctgactattat aatctttctgcaagaggaaaattatgactagtactggaaacctagtcatc tgctcaaagctagtgatgtcatggatcttggaggaaaacctacaactgtc attttactaaaccagcataatccctaactacattgcaagtatttgtcctt atctccacagataagtgtaacccttactcctcattaaggtcatagaagcc tctctgaattagagaccattagattaaaaaaaagcaaattataacaacaa ctagtcaaatgtggaacacacttttaatctcagcactaggaagctagaag caggcaatgagttcgaggtctgattggtctacatggtgtgttccaggaca gcgtgagctacgtagtgagaccctgtctcaaaacaaaattgcaaacaaac aaaaaactaaatataaaacagaacaacaaaaacctaatgtattgcaaaat gtttataatggccagttctactcagtaggaaattttgtatattttccatt acaactgaactcaaaatcattgccatctacttcctatagggaactttaaa aggaaacaaccttagttttttcttgtttgtttgctttacttgttttgttt gagacagagactcactgtgtagctactaggctggcctcagattcacagag tccacctgcctctgctgtctgaatgcctggattaaggtgtgtac	gaattcttgagtatcctggcagcaattggaaggcctagggaccatgggaa ttctagaaccatagaaacgcctggaaatattggaagaacaaataaggatg tgaggtctggataaacatatgctgctgagcataagatgtggggggaagca tgagagacctggcaaacatcagagtcctacttggcctgttaggccaggtg tacatgggaatgctgggtaatatgagtatctcagtacacatggaaggtct caataatgatcagagtcttataaagcacagaagccaaatgaagtctaata taaatgtgaggtctggtacacaaatgaggtctagtaacttagggaggcct agacaatatggaaggccttgtgaccaagcaggttattgctccctggaata cctgttaaatttgagtgacctgggatgcatgggctttctgagaaaaactt gcggcttgctaagccctggagcctggaaagcttaggaggtgtgataagca ttagaagcatggtgaataaggacagggttactaagcctggggatgctaga atccaaaaatgatggggaaagccctggaggtctagaaggattgggaggtg tgaaaatacatcagaggagtgttaagcctgtgagggctggaaaaggactg ccaaggatgagatggatccaagcatggggaagcctagtaagcaggagagt cctagaacctagagaagacctggaaacataggagacctagtacaaatagg gtatctgatggacacaaaaggtctggttagcctgagattcttgaaaaagt taggaggctcagtgagcaagagaagctttagtcagaatttaggaggccta gtaaacacagaatgctagaactcatggaagatagggaaagcatgggaggc ctagaactatttggcaaatttgaatgccacggaggcctgggagcttagga ggcatgacagcatgattagctgagcaagaacgggatgtactacttacctt ggaagacctattaaccaaagaagaccttgaaatcttggaaggactagtaa gggatgtgagttatgtca
quality values	Open. Hide. 58 36 24 25 58 58 58 31 23 58 62 62 62 47 52 54 62 62 62 62 62 62 47 56 49 62 49 49 49 54 62 62 62 50 50 32 28 32 51 62 49 38 38 38 43 46 46 62 59 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 59 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 42 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 58 54 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 41 58 49 54 58 58 58 58 58 58 58 58 54 58 58 58 54 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 54 58 45 32 58 53 58 58 51 51 58 51 58 58 53 58 58 51 58 58 58 51 50 49 58 58 58 54 58 50 58 46 43 46 39 58 40 50 41 51 58 52 58 58 46 44 58 58 53 58 51 58 51 58 51 50 58 50 53 58 40 41 40 58 46 58 58 49 58 41 38 29 25 58 58 41 49 58 58 58 58 58 49 58 51 53 41 51 49 30 58 46 51 51 19 8 9 10 9 17 42 58 49 45 58 51 50 51 39 53 52 38 54 37 52 54 54 51 54 49 49 42 42 52 53 53 54 53 53 39 50 49 47 53 45 29 54 49 47 23 40 38 31 40 54 51 29 53 53 18 32 23 33 35 39 47 51 37 54 37 34 23 53 37 54 32 39 47 42 45 37 41 41 28 31 43 43 43 39 32 42 45 54 41 51 32 46 32 34 29 36 31 41 41 39 31 31 31 40 32 52 47 41 25 52 42 35 40 26 31 39 28 32 40 30 33 29 19 46 40 32 42 32 31 37 32 35 51 51 31 29 20 51 51 29 31 37 39 31 27 51 29 41 27 46 16 31 24 46 46 41 32 18 11 22 9 40 22 18 30 51 31 41 36 21 25 19 27 46 33 27 18 20 28 11 42 46 46 31 46 27 33 24 17 29 42 18 31 26 27 28 23 32 48 46 31 32 37 17 46 23 32 30 30 21 30 30 18 17 21 27 31 41 14 16 30 31 37 31 31 30 19 19 31 25 26 36 48 41 31 47 46 32 31 16 24 31 19 8 46 48 33 18 32 29 33 20 21 22 22 11 21 31 31 17 28 21 28 20 30 44 44 19 24 32 19 26 21 29 25 22 22 31 32 26 27 33 11 17 26 19 33 20 14 16 9 33 14 31 24 23 17 33 17 11 26 43 31 32 33 17 48 19 18 14 12 17 19 9 18 30 13 26 48 48 48 48 22 19 10 10 10 21 39 14 13 8 26 22 32 23 12 32 11 27 10 48 11 14 14 48 39 33 19 8 47 28 12 18 14 20 17 21 9 20 7 17 11 10 7 20 22 9 6 4 6 6 8 6 4 4 17 20 18 9 18 8 6 17 20 21 20 16 19 20 20 8 17 8 11 16 10 8 5 8 17 11 3 5 16 16 8 15 5 6 13 4 11 10 5 8 15 13 10 9 8 6 7 5 2 1 2 5 7 12 15 17 4 6 14 22 8 8 7 5 8 8 15 12 4 12	Open. Hide. 62 47 42 47 62 62 62 62 62 62 62 47 51 47 56 56 56 49 32 24 44 59 59 56 56 62 62 62 62 59 62 62 59 47 62 59 62 62 62 62 59 59 62 59 62 62 54 49 54 62 59 62 62 62 59 59 62 62 59 59 44 42 48 38 54 62 62 59 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 59 62 62 62 62 62 62 59 59 54 48 62 62 62 62 62 62 59 62 62 54 62 62 62 59 59 62 62 59 59 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 44 62 62 56 46 46 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 46 62 62 62 52 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 45 58 58 58 58 54 54 54 58 58 58 54 58 58 58 58 54 52 54 58 58 58 58 58 58 42 32 58 54 45 41 54 58 54 58 54 58 46 52 47 38 41 45 58 58 34 58 58 58 58 58 58 54 53 54 58 58 52 58 54 41 30 58 54 54 54 52 50 54 48 39 58 50 54 58 58 58 51 50 38 46 52 58 37 58 58 54 58 58 52 52 58 50 58 53 47 46 45 19 58 54 32 45 51 40 50 50 51 53 51 54 52 53 52 47 53 46 58 24 32 51 49 54 39 58 58 49 37 49 41 39 54 50 50 30 7 58 49 49 19 29 51 36 21 39 39 58 50 41 50 41 39 24 39 39 51 32 51 49 58 58 50 47 46 23 40 41 39 52 25 38 50 50 25 50 32 50 58 51 21 39 32 39 37 54 41 53 45 44 15 15 54 52 35 14 32 29 37 39 32 34 18 28 29 30 19 38 54 37 42 28 51 30 41 49 54 33 34 27 51 37 37 39 53 32 40 33 54 41 41 31 53 36 36 31 42 31 37 52 52 53 35 53 33 29 34 37 37 18 53 51 25 24 25 17 45 40 53 53 28 28 39 23 15 36 20 21 33 21 37 28 41 45 35 52 47 31 49 49 49 41 32 46 32 18 27 32 31 7 29 24 43 34 29 17 35 42 23 21 29 18 28 34 29 14 33 31 13 31 32 51 8 9 15 31 31 20 29 31 33 21 45 12 15 31 31 46 24 31 30 30 30 27 27 42 31 42 37 32 16 34 23 18 22 25 25 30 28 36 21 18 31 18 25 38 32 20 31 42 35 32 25 13 31 27 36 32 42 39 26 41 44 29 24 23 33 33 31 22 31 10 25 6 31 36 23 9 28 21 31 32 25 11 48 27 19 32 25 19 48 46 19 41 25 28 22 18 13 24 9 48 12 10 8 5 25 13 10 19 18 37 16 14 11 11 6 33 32 37 21 21 23 31 19 25 13 12 34 22 6 6 6 31 31 15 16 11 7 5 24 17 22 23 15 12 28 7 24 15 9 15 23 27 30 21 37 21 10 12 13 11 17 33 13 10 12 19 8 32 12 11 4 4 5 14 8 27 14 33 12 15 32 31 10 20 24 15 19 18 16 27 18 5 4 11 3 8 7 9 5 12 5 11 30 22 6 14 16 24 7 13 17 15 7 11 11 12 16 18 4 16 7 15 11 28 6 13 24 16 27 11 24 12 24 6 13 11 10 3 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_30779566_30780536
seq2: B6Ng01-184E20.b_214_1186

seq1  CATGGGGGAGAGGAACCATGAACACTTGGCCATAAGAAACAACAAGTATC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGGGAGAGGAACCATGAACACTTGGCCATAAGAAACAACAAGTATC  50

seq1  TGGGATCCTTTGCTAGGGAAGTAGCTAGGCCAGCAATTAGTAGATTAGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGATCCTTTGCTAGGGAAGTAGCTAGGCCAGCAATTAGTAGATTAGGG  100

seq1  GTGATCCCCCAGTAATTACCAATGCCAAATTAAATAACCATAGTCTGAGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATCCCCCAGTAATTACCAATGCCAAATTAAATAACCATAGTCTGAGT  150

seq1  CTCATTTATGTGTAAACTCATAGGGGATAGCTTAAATTGGTTGTATTCTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATTTATGTGTAAACTCATAGGGGATAGCTTAAATTGGTTGTATTCTA  200

seq1  GACTTTATATGGGTGTAGTAGCTCCTGACATTACTAGAAGACACCATCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTTATATGGGTGTAGTAGCTCCTGACATTACTAGAAGACACCATCTC  250

seq1  ATAAAAGTCCCTGCTTCTCTGACTATTATAATCTTTCTGCAAGAGGAAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAGTCCCTGCTTCTCTGACTATTATAATCTTTCTGCAAGAGGAAAA  300

seq1  TTATGACTAGTACTGGAAACCTAGTCATCTGCTCAAAGCTAGTGATGTCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGACTAGTACTGGAAACCTAGTCATCTGCTCAAAGCTAGTGATGTCA  350

seq1  TGGATCTTGGAGGAAAACCTACAACTGTCATTTTACTAAACCAGCATAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATCTTGGAGGAAAACCTACAACTGTCATTTTACTAAACCAGCATAAT  400

seq1  CCCTAACTACATTGCAAGTATTTGTCCTTATCTCCACAGATAAGTGTAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTAACTACATTGCAAGTATTTGTCCTTATCTCCACAGATAAGTGTAAC  450

seq1  CCTTACTCCTCATTAAGGTCATAGAAGCCTCTCTGAATTAGAGACCATTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTACTCCTCATTAAGGTCATAGAAGCCTCTCTGAATTAGAGACCATTA  500

seq1  GATTAAAAAAAAGCAAATTATAACAACAACTAGTCAAATGTGGAACACAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTAAAAAAAAGCAAATTATAACAACAACTAGTCAAATGTGGAACACAC  550

seq1  TTTTAATCTCAGCACTAGGAAGCTAGAAGCAGGCAATGAGTTCGAGGTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAATCTCAGCACTAGGAAGCTAGAAGCAGGCAATGAGTTCGAGGTCT  600

seq1  GATTGGTCTACATGGTGTGTTCCAGGACAGCGTGAGCTACGTAGTGAGAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGGTCTACATGGTGTGTTCCAGGACAGCGTGAGCTACGTAGTGAGAC  650

seq1  CCTGTCTCAAAACAAAATTGCAAACAAACAAAAAACTAAATATAAAACAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTCTCAAAACAAAATTGCAAACAAACAAAAAACTAAATATAAAACAG  700

seq1  AACAACAAAAACCTAATGTATTGCAAAATGTTTATAATGGCCAGTTCTAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAACAAAAACCTAATGTATTGCAAAATGTTTATAATGGCCAGTTCTAC  750

seq1  TCAGTAGGAAATTTTGTATA-TTTCCATTACAACTGAACTCAAAATCATT  799
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  TCAGTAGGAAATTTTGTATATTTTCCATTACAACTGAACTCAAAATCATT  800

seq1  GCCATCTAC-TCCTATA-GGAAC-TTAAAAGGAAACAACCTTAGTTTTT-  845
      ||||||||| ||||||| ||||| ||||||||||||||||||||||||| 
seq2  GCCATCTACTTCCTATAGGGAACTTTAAAAGGAAACAACCTTAGTTTTTT  850

seq1  -CTGTTTGTTTGCTTACTTTGTTTTGTTTTGAGACAGAGACTCACTGTGT  894
        |||||||||||||   |||||||| |||||||||||||||||||||||
seq2  CTTGTTTGTTTGCTTTACTTGTTTTG-TTTGAGACAGAGACTCACTGTGT  899

seq1  AGCCTACTAGGCTGGCCTCAGATTCACAGAGGTCCACCTGCCTCTGCTGT  944
      || ||||||||||||||||||||||||||| |||||||||||||||||||
seq2  AG-CTACTAGGCTGGCCTCAGATTCACAGA-GTCCACCTGCCTCTGCTGT  947

seq1  CTGAGTGCTGGGATTAAAGGTGTGTAC  971
      |||| |||  ||||| |||||||||||
seq2  CTGAATGCCTGGATT-AAGGTGTGTAC  973

seq1: chrX_30981373_30982443
seq2: B6Ng01-184E20.g_67_1134 (reverse)

seq1  TTACATAACTCACAT-CCTTACTAGTCCTTCCAAGATTTTCGGGTCTTTC  49
      | ||||||||||||| |||||||||||||||||||||||   ||||||  
seq2  TGACATAACTCACATCCCTTACTAGTCCTTCCAAGATTTCAAGGTCTTCT  50

seq1  TTTGTTACTAGGTCTTCCATAGTTAGTAGTACATCCCGTTCTTGCTCAGC  99
      || |||| |||||||||||  || ||||||||||||||||||||||||||
seq2  TTGGTTAATAGGTCTTCCAAGGTAAGTAGTACATCCCGTTCTTGCTCAGC  100

seq1  TAATCATGCTGTCCATGCCTCCTAAGCTTCCCAGGCCTCCGTGGCATTCA  149
      |||||||||||| |||||||||||||| ||||||||||||||||||||||
seq2  TAATCATGCTGT-CATGCCTCCTAAGC-TCCCAGGCCTCCGTGGCATTCA  148

seq1  ACTTTGCCAAATAGTTCTAGGCCTCCCATGCTTTCCCTATCTTCCATGAG  199
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTGCCAAATAGTTCTAGGCCTCCCATGCTTTCCCTATCTTCCATGAG  198

seq1  TTCTAGCGTTTCTGTGTTTACTAGGCCTCCT-AATTCTGACT-AAGCTTC  247
      |||||||  |||||||||||||||||||||| |||||||||| |||||||
seq2  TTCTAGC-ATTCTGTGTTTACTAGGCCTCCTAAATTCTGACTAAAGCTTC  247

seq1  TCTTGCTCACTGAGCCTCCTAACTTTTTCAAGAATCTCAGGCTAACCAGA  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCTCACTGAGCCTCCTAACTTTTTCAAGAATCTCAGGCTAACCAGA  297

seq1  CCTTTTGTGTCCATCAGATACCCTATTTGTACTAGGTCTCCTATGTTTCC  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTTGTGTCCATCAGATACCCTATTTGTACTAGGTCTCCTATGTTTCC  347

seq1  AGGTCTTCTCTAGGTTCTAGGACTCTCCTGCTTACTAGGCTTCCCCATGC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCTTCTCTAGGTTCTAGGACTCTCCTGCTTACTAGGCTTCCCCATGC  397

seq1  TTGGATCCATCTCATCCTTGGCAGTCCTTTTCCAGCCCTCACAGGCTTAA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGATCCATCTCATCCTTGGCAGTCCTTTTCCAGCCCTCACAGGCTTAA  447

seq1  CACTCCTCTGATGTATTTTCACACCTCCCAATCCTTCTAGACCTCCAGGG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCTCTGATGTATTTTCACACCTCCCAATCCTTCTAGACCTCCAGGG  497

seq1  CTTTCCCCATCATTTTTGGATTCTAGCATCCCCAGGCTTAGTAATCCTGT  547
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  CTTTCCCCATCATTTTTGGATTCTAGCATCCCCAGGCTTAGTAACCCTGT  547

seq1  CCTTATTCACCAGGCTTCTAATGCTTATCACACCTCCTAAGCTTTCCAGG  597
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  CCTTATTCACCATGCTTCTAATGCTTATCACACCTCCTAAGCTTTCCAGG  597

seq1  TTCCAGGGCTTAGCAAGCCGCAAGTTTTTCTCAGAACGCCCATGCATCCC  647
       ||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  CTCCAGGGCTTAGCAAGCCGCAAGTTTTTCTCAGAAAGCCCATGCATCCC  647

seq1  AGGTCACTCAAATTTAACAGGTTTTCCAGGGAGCCATAACCTGCTTGGTC  697
      |||||||||||||||||||||| ||||||||||| |||||||||||||||
seq2  AGGTCACTCAAATTTAACAGGTATTCCAGGGAGCAATAACCTGCTTGGTC  697

seq1  ACAAGGCCTTCCATATTCTCTAGGCCTCCCTAAGTTACTAGACCTCATTT  747
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  ACAAGGCCTTCCATATTGTCTAGGCCTCCCTAAGTTACTAGACCTCATTT  747

seq1  GTGTACCAGACCTCACATTTATATTAGACTTCATTTGGCTTCTGTGCTTT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTACCAGACCTCACATTTATATTAGACTTCATTTGGCTTCTGTGCTTT  797

seq1  ATAAGACTCTAATCATTATTGAGACCTTCTATGTGTATTGAGATACTCAT  847
      |||||||||| |||||||||||||||||| ||||||| ||||||||||||
seq2  ATAAGACTCTGATCATTATTGAGACCTTCCATGTGTACTGAGATACTCAT  847

seq1  ATTACCCAGCATTCCCATGTACATCTGGCCTAACAGGCCAAGTAGGACTC  897
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  ATTACCCAGCATTCCCATGTACACCTGGCCTAACAGGCCAAGTAGGACTC  897

seq1  TGATGTTTGCCAGGTCTCCCAAGCTTCTCCCCACATCTTATGCTCAGCAG  947
      |||||||||||||||||| || ||||| ||||||||||||||||||||||
seq2  TGATGTTTGCCAGGTCTCTCATGCTTCCCCCCACATCTTATGCTCAGCAG  947

seq1  CATAAGATGTTTATCCAGACCTCACATCCTTATTTGTTCTTCCAATATTT  997
      |||   ||||||||||||||||||||||||||||||||||||||||||||
seq2  CAT---ATGTTTATCCAGACCTCACATCCTTATTTGTTCTTCCAATATTT  994

seq1  CCAGGCGTTTCTATGGTTCTAGAATTCCCATGGTCCCTAGGCCTTCCAAT  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGCGTTTCTATGGTTCTAGAATTCCCATGGTCCCTAGGCCTTCCAAT  1044

seq1  TGCTGCCAGGATACTCAAGAATTC  1071
      ||||||||||||||||||||||||
seq2  TGCTGCCAGGATACTCAAGAATTC  1068

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information