MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-194K12
Chromosome	X (Build37)
Map Location	57,098,160 - 57,099,329
singlet/doublet	singlet
Overlap gene	none
Upstream gene	4930550L24Rik, Fgf13
Downstream gene	F9, EG434782, Mcf2, Atp11c, LOC666517, LOC631784, LOC100039611, LOC100039621, Gm715, Hspa9-ps1, EG236831, LOC666559, LOC671636
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930550L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75352 MGI:1922602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14168 MGI:109178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14071 MGI:88384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434782 MGI:3648120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 92 ESTs, 11 Proteins

name	Mcf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109904 MGI:96932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp11c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320940 MGI:1859661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC666517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 6 Proteins pseudo : _no_value

name	LOC631784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279618 MGI:2685561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins

name	Hspa9-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15527 MGI:96246
definition	gene_synonym : 70kDa; Hsc74-ps1; Hsp74-ps1; Hsp74b; Hspa9b note : heat shock protein 9, pseudogene 1 pseudo : _no_value

name	EG236831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236831 MGI:3648723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC666559 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 262 ESTs, 2 Proteins pseudo : _no_value

name	LOC671636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930550L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347713 GeneID:75352 MGI:1922602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930550L24 gene transcript_id : NM_023774.2

name	Fgf13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542808 GeneID:14168 MGI:109178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 13 transcript_id : NM_010200.2

name	F9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73661201 GeneID:14071 MGI:88384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor IX transcript_id : NM_007979.1

name	EG434782 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407468 GeneID:434782 MGI:3648120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 92 ESTs, 11 Proteins product : predicted gene, EG434782 transcript_id : XM_486686.4

name	Mcf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372813 GeneID:109904 MGI:96932
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mcf.2 transforming sequence transcript_id : NM_133197.2

name	Atp11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745142 GeneID:320940 MGI:1859661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class VI, type 11C transcript_id : NM_001001798.2

name	Atp11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745136 GeneID:320940 MGI:1859661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class VI, type 11C transcript_id : NM_001037863.1

name	LOC631784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142354747 GeneID:631784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC631784 transcript_id : NM_001039240.2

name	LOC100039621 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271644 GeneID:100039621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039621 transcript_id : XM_001473214.1

name	Gm715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271650 GeneID:279618 MGI:2685561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins product : gene model 715, (NCBI) transcript_id : XM_205232.5

name	4930550L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963817 GeneID:75352 MGI:1922602
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : novel MAGE family domain containing protein product : mage-k1 protein_id : NP_076263.1

name	Fgf13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542809 CCDS:CCDS30157.1 GeneID:14168 MGI:109178
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0030295 - protein kinase activator activity [Evidence ISS] GO_process : GO:0000165 - MAPKKK cascade [Evidence ISS] codon_start : 1 product : fibroblast growth factor 13 protein_id : NP_034330.2

name	F9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73661202 CCDS:CCDS30158.1 GeneID:14071 MGI:88384
definition	EC_number : 3.4.21.22 GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003803 - coagulation factor IXa activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : coagulation factor IX protein_id : NP_032005.1

name	EG434782 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772073 GeneID:434782 MGI:3648120
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486686.1

name	Mcf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875340 CCDS:CCDS30160.1 GeneID:109904 MGI:96932
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence TAS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0016358 - dendrite development [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mcf.2 transforming protein_id : NP_573460.1

name	Atp11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49355804 GeneID:320940 MGI:1859661
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Atpase 11c, p type product : Atpase, class VI, type 11C isoform b protein_id : NP_001001798.1

name	Atp11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745137 GeneID:320940 MGI:1859661
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Atpase 11c, p type product : Atpase, class VI, type 11C isoform a protein_id : NP_001032952.1

name	LOC631784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85986649 GeneID:631784
definition	codon_start : 1 product : hypothetical protein LOC631784 protein_id : NP_001034329.1

name	LOC100039621 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271645 GeneID:100039621
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473264.1

name	Gm715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746741 GeneID:279618 MGI:2685561
definition	codon_start : 1 product : similar to RIKEN cDNA 1810013L24 gene protein_id : XP_205232.2

name	LOC100039611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039611
definition	number : 2 pseudo : _no_value

name	LOC100039611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039611
definition	number : 1 pseudo : _no_value

name	EG236831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236831
definition	number : 1 pseudo : _no_value

name	LOC671636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671636
definition	number : 1 pseudo : _no_value

name	LOC671636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671636
definition	number : 2 pseudo : _no_value

name	LOC666517 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271647 GeneID:666517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 6 Proteins product : similar to interferon-inducible protein 16 pseudo : _no_value transcript_id : XR_031128.1

name	LOC666559 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271646 GeneID:666559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 262 ESTs, 2 Proteins product : similar to farnesyl pyrophosphate synthase pseudo : _no_value transcript_id : XR_031145.1

clone name	MSMg01-062A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081M21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-523L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193D23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-194K12.b	B6Ng01-194K12.g
ACC	GA017290	GA017291
length	1,068	1,167
definition	B6Ng01-194K12.b	B6Ng01-194K12.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctataaattcattgtttttaatagctgagtagtattccattgtgt aaatgtcccgcatttcttgtatccattcctctgttgagggacatctgggt tctttccagcttctggctattataaataaggatgctatgaacatagtgga acatgtgtcctcattacatattggagcattttctgagtatatgcccaggt atatgctagtggtatagctgggcccttggtagtactatgtctaattttct aaagaactgctaaactgatttctagagtggttgtaccagcttgcaatccc accagcaatggaggagtgttcctctttcttcacaaccttgctagcatctg ctgtcaactgagattttgatcttagttcttaaagtcttttatcatcatca tgagatatgattttatctcagagtcttgcttttctggtgtattggggtat ccagggttcactgtggtgggagaactgggttctgatgatgcaaagtagtc ttggtttctgttgcttatattcttatgcttgcattttgccacatggttat ctctggtgttagctggtcttgctgtctctgactttgacttgtccttcctg taagcctgtgtgtcagtcagtactcctaggagaccagatctctccgggag gaatttgggatggagagctgcggtacagggtcaggtctggggtgcagaga ccagaaggatactgtccccagctgatccttggttcctgtgtcctgatgtc tctgtgagtatctctcttgggtaaggaatttgaagagaagtggtggtctt atctgtgcttgtaggtatgaaagcattcctgggagaccagctctcttcct ggaagtatttgtatatgtagctctgtggcacaggatcagttctgcatgca gaatgctcccgttccaggcagccccttggttcctgtgtcctgagggttct gggcaggttctttgagcaatgtggtaatcttcctgcactcacagtcctat ccgcacttctgggagcttgctccctcagagcttatttgggattgagcccc gtgaccgaagatctgcta	gaattcttcccttatgggatagaaaataaggtccaaaatcatcatccttt cttgccatttttactgtttcttgaagtaatgtgtttatgaactctatttt ttgttttgttttcttttgtttttgttttttattagatattttctttatat acatttcaaatgctatcccgaaagttccctataccctcctgctgccttgc tcccctacccacccactcccactttttggccctagcattcccctgatggc ctctatttttattatgattccttccaactattagcattatttgggctagt tttatatcttctttaaagttttttttttttgagacagtgtttctctgtgt agccctggctgtcctggaactcactctgtggaccaggctggcctagaact cagaaatctgcctgcctctgcctcccaagtgctgggattaaaggtgtgca ccaccacgcctggcttcttaaagatttaagacagaaaaaaaggatagcca tacaaaatataaagcctagtaaattattatacaaatagtaatcttgaatg ctatactgaattaagattgctcattcacatcaaatatgtctccaaatgct taatctcaaatatagctcccctttctttctctcttcatacatgattacta tcctgaatttcacagtaatcattttctgccattcttatgatgttattatc taaaagtgaattgttagacaatataaaatttggcatcattcatttttctt aaagactcactatggggatagagagttggctcagtggttaaagaacttgc tgctcttccactggatatgttttcaattcctagaacctatacagagtctc acaacatctgcacctccacagttgtcagacattcatggggagcatataca atatgtagacaattgaataaaataagtaataattaatatttaaagaaaaa aagactgagtttctttttgtaaatatatattaatcttcaggtgttctagt ctgttccctacactctatgtgctaaagtgtccatgaaattattcctccat gatatgcatgttgcctgatgccatagtcatggtaccatcaacaataaagt caatattttcctggtggacaatgcctgctcaagttcagggcttaacttta attaccattccagctag
quality values	Open. Hide. 58 36 22 29 58 62 62 54 62 62 62 62 47 62 31 20 62 62 47 62 62 62 62 47 56 62 62 47 59 62 62 62 62 56 37 37 32 59 59 59 62 62 59 49 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 54 62 62 62 62 62 54 54 54 49 54 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 47 42 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 53 58 58 54 58 58 58 58 52 58 58 58 58 58 58 58 54 58 58 58 58 58 58 48 58 58 58 58 54 47 58 58 58 58 58 58 58 58 54 58 58 58 54 52 58 52 58 58 58 58 54 58 58 58 50 47 49 53 53 54 58 53 53 53 46 58 53 58 52 54 42 51 58 46 58 31 51 52 49 54 54 54 58 53 58 53 58 49 58 58 54 29 51 58 37 37 58 58 53 58 54 41 34 52 58 58 25 58 40 39 54 52 53 51 58 50 37 40 46 22 49 46 50 53 39 19 58 41 53 52 58 31 15 43 50 53 32 50 41 58 29 39 27 50 37 34 58 47 12 58 39 40 41 49 50 58 32 54 58 49 58 50 37 52 53 37 51 32 30 53 53 39 51 44 50 52 34 53 40 54 34 38 33 39 54 40 54 53 42 51 42 37 53 53 47 54 40 34 53 19 35 42 41 52 53 52 53 43 40 47 44 39 46 32 33 31 6 54 38 22 11 54 54 33 54 47 28 54 21 37 49 32 32 53 45 37 41 45 21 41 43 43 43 34 35 28 32 29 37 41 18 21 25 29 25 8 47 29 31 29 32 52 53 53 23 33 23 53 39 53 18 19 43 51 33 33 13 43 17 34 35 32 33 33 31 36 20 24 8 9 51 31 32 28 35 43 18 30 31 31 51 41 36 29 36 36 29 38 43 38 31 24 31 42 34 30 32 30 24 27 28 24 31 26 9 31 31 31 32 32 16 19 31 26 27 30 28 12 31 34 30 21 13 29 20 4 6 6 34 21 41 34 32 33 36 30 30 41 26 27 30 25 24 33 46 46 33 38 13 13 33 19 33 21 31 22 31 18 27 31 27 37 20 30 31 11 43 19 33 19 27 26 24 24 14 10 17 24 17 20 24 29 17 30 30 25 32 11 32 26 14 22 24 5 10 26 25 30 28 20 12 10 7 5 6 27 28 8 7 7 9 14 18 11 28 27 32 23 21 29 18 15 30 19 21 24 31 13 37 34 31 27 21 39 10 28 30 17 20 17 32 22 30 14 48 14 27 27 20 10 27 5 11 20 12 7 21 27 13 19 21 5 4 6 4 8 10 13 28 32 47 32 8 15 27 4 6 6 5 25 6 11 8 11 11 10 6 6 16 14	Open. Hide. 62 49 51 44 62 62 62 62 62 62 62 59 44 50 29 38 38 34 26 38 59 62 62 62 62 62 59 62 59 62 59 59 62 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 42 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 34 49 62 54 62 62 62 62 62 54 54 62 59 62 54 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 48 62 59 56 59 62 62 62 56 59 59 59 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 62 62 62 59 62 62 62 51 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 43 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 47 38 54 49 62 62 62 62 62 62 34 62 62 62 62 62 62 58 58 58 58 58 58 58 58 48 54 52 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 41 54 54 54 54 54 58 58 58 58 47 42 47 58 52 54 39 58 58 54 54 54 50 54 58 54 50 53 50 58 51 41 58 58 51 50 51 58 58 58 58 45 41 19 58 58 51 58 50 58 46 53 58 50 58 51 50 47 38 58 53 52 52 54 51 54 58 53 49 58 58 54 58 51 51 50 58 51 53 53 58 43 51 51 51 47 31 51 41 46 29 54 58 58 32 49 50 47 50 51 50 53 58 53 58 41 32 28 58 52 50 37 41 49 51 40 50 50 53 52 33 41 58 58 51 53 42 39 39 41 9 46 52 49 33 32 39 39 52 53 33 51 47 40 35 42 42 52 37 52 39 37 54 54 54 31 52 52 51 29 30 54 39 21 31 32 28 35 42 38 49 39 42 45 54 54 54 29 28 54 54 44 32 37 32 37 38 31 44 41 41 32 37 54 54 54 44 33 33 53 37 54 51 37 33 24 45 40 32 37 33 33 28 17 51 51 41 34 23 31 34 27 22 37 29 23 31 37 40 31 34 43 43 28 27 33 30 29 25 49 49 40 21 33 33 25 32 31 42 35 36 32 42 40 53 26 32 31 33 24 29 10 32 28 18 17 30 28 41 37 51 51 33 31 30 18 23 41 22 33 20 31 18 29 31 29 33 24 31 30 14 31 17 31 42 24 31 34 31 29 14 11 7 36 30 32 38 31 25 43 31 31 32 35 34 33 25 12 16 9 12 30 30 31 23 33 26 15 31 17 14 30 25 30 24 26 31 47 48 42 33 28 22 16 27 10 32 19 17 13 15 8 13 30 31 33 27 30 31 12 13 6 6 12 23 26 28 13 7 46 41 27 24 22 30 13 32 10 7 14 35 35 16 11 25 25 8 11 31 44 25 44 44 44 13 32 44 36 38 36 41 22 13 17 22 21 22 22 9 36 48 24 31 18 44 44 38 15 20 16 27 39 21 18 25 34 22 27 27 24 34 10 22 19 15 10 32 17 7 25 7 10 8 22 11 34 22 32 6 7 4 15 21 15 25 21 34 8 17 4 4 7 8 6 15 21 22 17 11 5 15 23 13 24 34 24 13 10 23 11 15 26 20 24 27 23 9 5 6 10 16 16 16 26 7 7 13 28 20 18 12 14 5 6 18 28 26 24 9 20 15 21 28 10 11 6 6 11 6 6 9 6 5 5 15 5 12 7 5 11 11 12 3 3 10 6 3 3 5 8 6 6 7 6 8 16 28 7 11 5 4 4 4 7 6 13 8 8 5 8 5 4 4 2 1 7 6 2 3 17 23 5 9 10 15 4 6 11 9 8 8 11 10 8 6 13 9 11 13 11 4 3 2 4 6 8 16 28 8 3 4 3 2 4 5 3 3 6 11 4 12 6 6 8 11 13 23

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_57098160_57099329
seq2: B6Ng01-194K12.g_63_1229

seq1  GAATTCTTCCCTTATGGGATAGAAAATAAGGTCCAAAATCATCATCCTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCCCTTATGGGATAGAAAATAAGGTCCAAAATCATCATCCTTT  50

seq1  CTTGCCATTTTTACTGTTTCTTGAAGTAATGTGTTTATGAACTCTATTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCATTTTTACTGTTTCTTGAAGTAATGTGTTTATGAACTCTATTTT  100

seq1  TTGTTTTGTTTTCTTTTGTTTTTGTTTTTTATTAGATATTTTCTTTATAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTGTTTTCTTTTGTTTTTGTTTTTTATTAGATATTTTCTTTATAT  150

seq1  ACATTTCAAATGCTATCCCGAAAGTTCCCTATACCCTCCTGCTGCCTTGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTCAAATGCTATCCCGAAAGTTCCCTATACCCTCCTGCTGCCTTGC  200

seq1  TCCCCTACCCACCCACTCCCACTTTTTGGCCCTAGCATTCCCCTGATGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCTACCCACCCACTCCCACTTTTTGGCCCTAGCATTCCCCTGATGGC  250

seq1  CTCTATTTTTATTATGATTCCTTCCAACTATTAGCATTATTTGGGCTAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTATTTTTATTATGATTCCTTCCAACTATTAGCATTATTTGGGCTAGT  300

seq1  TTTATATCTTCTTTAAAGTTTTTTTTTTTTGAGACAGTGTTTCTCTGTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATATCTTCTTTAAAGTTTTTTTTTTTTGAGACAGTGTTTCTCTGTGT  350

seq1  AGCCCTGGCTGTCCTGGAACTCACTCTGTGGACCAGGCTGGCCTAGAACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCTGGCTGTCCTGGAACTCACTCTGTGGACCAGGCTGGCCTAGAACT  400

seq1  CAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCA  450

seq1  CCACCACGCCTGGCTTCTTAAAGATTTAAGACAGAAAAAAAGGATAGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCACGCCTGGCTTCTTAAAGATTTAAGACAGAAAAAAAGGATAGCCA  500

seq1  TACAAAATATAAAGCCTAGTAAATTATTATACAAATAGTAATCTTGAATG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAAAATATAAAGCCTAGTAAATTATTATACAAATAGTAATCTTGAATG  550

seq1  CTATACTGAATTAAGATTGCTCATTCACATCAAATATGTCTCCAAATGCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATACTGAATTAAGATTGCTCATTCACATCAAATATGTCTCCAAATGCT  600

seq1  TAATCTCAAATATAGCTCCCCTTTCTTTCTCTCTTCATACATGATTACTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCTCAAATATAGCTCCCCTTTCTTTCTCTCTTCATACATGATTACTA  650

seq1  TCCTGAATTTCACAGTAATCATTTTCTGCCATTCTTATGATGTTATTATC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGAATTTCACAGTAATCATTTTCTGCCATTCTTATGATGTTATTATC  700

seq1  TAAAAGTGAATTGTTAGACAATATAAAATTTGGCATCATTCATTTTTCTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAGTGAATTGTTAGACAATATAAAATTTGGCATCATTCATTTTTCTT  750

seq1  AAAGACTCACTATGGGGATAGAGAGTTGGCTCAGTGGTTAAAAGAACTTG  800
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  AAAGACTCACTATGGGGATAGAGAGTTGGCTCAGTGGTT-AAAGAACTTG  799

seq1  CTGCTCTTCCACTGGATATGTTTTCAATTCCTAGAACCTATACAGAGTCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCTTCCACTGGATATGTTTTCAATTCCTAGAACCTATACAGAGTCT  849

seq1  CACAACATCTGCACCTCCACAGTTGTCAGACATTCATGGGGAGCATATAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAACATCTGCACCTCCACAGTTGTCAGACATTCATGGGGAGCATATAC  899

seq1  AAATATGTAGACAAATGAATAAAATAAGTATAAATAAATATTTAAAAGAA  950
       ||||||||||||| |||||||||||||||  ||| ||||||||||  ||
seq2  -AATATGTAGACAATTGAATAAAATAAGTAATAATTAATATTTAAAGAAA  948

seq1  AAAAGACTGAGTTTC-TTTTGTAAATATATATTAATCTTCAGGTGTTCTA  999
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  AAAAGACTGAGTTTCTTTTTGTAAATATATATTAATCTTCAGGTGTTCTA  998

seq1  GTTCTGTTCCTTACACTCTATGTGCTAAAGTGTCCATGATA-TATT-CTC  1047
      | |||||||| |||||||||||||||||||||||||||| | |||| |||
seq2  G-TCTGTTCCCTACACTCTATGTGCTAAAGTGTCCATGAAATTATTCCTC  1047

seq1  CATGATATGCATGTTG-CTGATTGCATAGTCATGGTACAATTCAACATAA  1096
      |||||||||||||||| |||||  |||||||||||||| | ||||||  |
seq2  CATGATATGCATGTTGCCTGATGCCATAGTCATGGTACCA-TCAACAATA  1096

seq1  AGGTCATTA-TTTCCTGGTGGGACAATGCCCTGCTCAAGTTCAGGCTTTA  1145
      | |||| || ||||||||| |||||||| ||||||||||||||||  |||
seq2  AAGTCAATATTTTCCTGGT-GGACAATG-CCTGCTCAAGTTCAGGGCTTA  1144

seq1  ACTTTTATATTACTATTCCAGCTAG  1170
      |||||   ||||| |||||||||||
seq2  ACTTT--AATTACCATTCCAGCTAG  1167

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information