MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-195K20
Chromosome	X (Build37)
Map Location	57,533,695 - 57,534,855
singlet/doublet	singlet
Overlap gene	Atp11c
Upstream gene	F9, EG434782, Mcf2
Downstream gene	LOC666517, LOC631784, LOC100039611, LOC100039621, Gm715, Hspa9-ps1, EG236831, LOC666559, LOC671636, Sox3, EG631922, Rpl7l1-ps, LOC627159, EG631990, LOC632000, LOC100039759
Link	Open Mouse BAC browser

Click to get alignment info.

name	F9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14071 MGI:88384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434782 MGI:3648120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 92 ESTs, 11 Proteins

name	Mcf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109904 MGI:96932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp11c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320940 MGI:1859661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC666517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 6 Proteins pseudo : _no_value

name	LOC631784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279618 MGI:2685561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins

name	Hspa9-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15527 MGI:96246
definition	gene_synonym : 70kDa; Hsc74-ps1; Hsp74-ps1; Hsp74b; Hspa9b note : heat shock protein 9, pseudogene 1 pseudo : _no_value

name	EG236831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236831 MGI:3648723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC666559 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 262 ESTs, 2 Proteins pseudo : _no_value

name	LOC671636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Sox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20675 MGI:98365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG631922 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631922 MGI:3646842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Rpl7l1-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:207216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC627159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 8 Proteins

name	EG631990 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631990 MGI:3644361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC632000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC100039759 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	F9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73661201 GeneID:14071 MGI:88384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor IX transcript_id : NM_007979.1

name	EG434782 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407468 GeneID:434782 MGI:3648120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 92 ESTs, 11 Proteins product : predicted gene, EG434782 transcript_id : XM_486686.4

name	Mcf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372813 GeneID:109904 MGI:96932
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mcf.2 transforming sequence transcript_id : NM_133197.2

name	Atp11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745142 GeneID:320940 MGI:1859661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class VI, type 11C transcript_id : NM_001001798.2

name	Atp11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745136 GeneID:320940 MGI:1859661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class VI, type 11C transcript_id : NM_001037863.1

name	LOC631784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142354747 GeneID:631784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC631784 transcript_id : NM_001039240.2

name	LOC100039621 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271644 GeneID:100039621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039621 transcript_id : XM_001473214.1

name	Gm715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271650 GeneID:279618 MGI:2685561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins product : gene model 715, (NCBI) transcript_id : XM_205232.5

name	Sox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678070 GeneID:20675 MGI:98365
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 3 transcript_id : NM_009237.1

name	EG631922 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271648 GeneID:631922 MGI:3646842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG631922 transcript_id : XM_001473355.1

name	F9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73661202 CCDS:CCDS30158.1 GeneID:14071 MGI:88384
definition	EC_number : 3.4.21.22 GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003803 - coagulation factor IXa activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : coagulation factor IX protein_id : NP_032005.1

name	EG434782 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772073 GeneID:434782 MGI:3648120
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486686.1

name	Mcf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875340 CCDS:CCDS30160.1 GeneID:109904 MGI:96932
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence TAS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0016358 - dendrite development [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mcf.2 transforming protein_id : NP_573460.1

name	Atp11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49355804 GeneID:320940 MGI:1859661
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Atpase 11c, p type product : Atpase, class VI, type 11C isoform b protein_id : NP_001001798.1

name	Atp11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745137 GeneID:320940 MGI:1859661
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Atpase 11c, p type product : Atpase, class VI, type 11C isoform a protein_id : NP_001032952.1

name	LOC631784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85986649 GeneID:631784
definition	codon_start : 1 product : hypothetical protein LOC631784 protein_id : NP_001034329.1

name	LOC100039621 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271645 GeneID:100039621
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473264.1

name	Gm715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746741 GeneID:279618 MGI:2685561
definition	codon_start : 1 product : similar to RIKEN cDNA 1810013L24 gene protein_id : XP_205232.2

name	Sox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678071 CCDS:CCDS30161.1 GeneID:20675 MGI:98365
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030900 - forebrain development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048515 - spermatid differentiation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : transcription factor product : SRY-box containing gene 3 protein_id : NP_033263.1

name	EG631922 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271649 GeneID:631922 MGI:3646842
definition	codon_start : 1 product : similar to Heat shock factor protein 1 (HSF 1) (Heat shock transcription factor 1) (HSTF 1) protein_id : XP_001473405.1

name	LOC100039611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039611
definition	number : 2 pseudo : _no_value

name	LOC100039611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039611
definition	number : 1 pseudo : _no_value

name	EG236831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236831
definition	number : 1 pseudo : _no_value

name	LOC671636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671636
definition	number : 1 pseudo : _no_value

name	LOC671636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671636
definition	number : 2 pseudo : _no_value

name	Rpl7l1-ps (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:207216
definition	number : 1 pseudo : _no_value

name	EG631990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631990
definition	number : 1 pseudo : _no_value

name	LOC100039759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039759
definition	number : 3 pseudo : _no_value

name	LOC100039759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039759
definition	number : 2 pseudo : _no_value

name	LOC100039759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039759
definition	number : 1 pseudo : _no_value

name	LOC666517 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271647 GeneID:666517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 6 Proteins product : similar to interferon-inducible protein 16 pseudo : _no_value transcript_id : XR_031128.1

name	LOC666559 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271646 GeneID:666559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 262 ESTs, 2 Proteins product : similar to farnesyl pyrophosphate synthase pseudo : _no_value transcript_id : XR_031145.1

name	LOC627159 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271651 GeneID:627159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 8 Proteins product : similar to Steroid hormone receptor ERR2 (Estrogen-related receptor, beta) (ERR-beta) (Estrogen receptor-like 2) (ERR beta-2) transcript_id : XR_001579.2

name	LOC632000 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271652 GeneID:632000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to CG4090-PA pseudo : _no_value transcript_id : XR_031221.1

clone name	MSMg01-389O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081M21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-523L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327O02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-195K20.b	B6Ng01-195K20.g
ACC	GA018030	GA018031
length	910	1,187
definition	B6Ng01-195K20.b	B6Ng01-195K20.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaggctatatattgcattccaggctagccaggactacatggtga gatcctgttaaatattaaacagttaccataggtaactagttaccatatag ttactcctaggtatatagcaaaaaaaaaaaaaattgcctattttttttat aacagggttagagatggctcagtggttaaaagcattaactgctctcttag aggatcatggttagattcccagatcccacatgatggttcacaaccatttg taattccagttttaacaaatacaaaaccatcctctggcctttgaggatac tacatccacatggtacatgaacatgaatgcaggaaaaaaacacatacact ataaaataataaataacatttctaaaagagttgttatagctatggtaaac aaaagatagaaacaagccaaatgcctatcaactaatgaccatattcatca aatatgatctatcaactcagaaaaatattcaaacaggaaaaagaaagtat tgttacataaaatggcatgaggctcaaaaatattgttaaataagcagttc tcaacctatggatcatgacgctattggggtcggagtatcagatatcctgc atatcatatatacacattacaatttataacaatagcaaaatgacagttat aaagtatcaataaaatatttgtatggctggggatcaccacaacatgaaga cctgtattaaagggtctcagcattcagaagagtgagaactgatgcagata gccctggggttaatatatttgatgttaattctgttctgctgtgagggctg acaccaaggaatgaatcagcactcaggtgatttactgtaaacctgcttcc cactttaatttataaataaaggctagagccgggtgattgggttggggaat gaagggaagg	gaattcattgaatgctgcatagatgggcacaaatataaaggcacaactca ggaagttgatggattatctcagactgatgggcccttagcctattttgata aagcagataaggtgacattttctctgttgttttacctgagaaatcaatct ttgtaagcatgttttatccctatatagtagaaataccgaattttccaatg ggtgcatgataacgagttttgaataattatttgctttttttttaactaca cctttcttttattaatacttttagcatttgtagacaactagaacttagaa gtagaattatgggaaatggcatttgaacaaaaatattaacttagctgtat gtgcattcacttaaaaaaatcagcttttctaagaatgttgtctcttcaaa tcattaaagacctaatatttacatgttaggtaaatcaaagtcttcctaca catgaacaattgctagattgtgatacctaactacatcttaagccataaag aagtcactaccttaggtataggtgatactacatgtgaatttgaatgagtt aataatatatatgagtacactgttagctgtcttcagatacagcttggtta cagatggttgtgagccaccaggtagtttctgagaattgaactcaggaccc ctggaagagcagtcagtgctcttaacctctgagctctctctccagcttcc aggaaccagtaattgtattcgttgctatgtagtcgtttgagtatttggaa tttataaaattttcagagagattatgacattctgtcacctttaatatttt taattttgttcactgttctgggttacctagtgatcaaaataaaaagaata gtaattttgatgcttctgtttccacagaaccgagaggcactcttttctcc gtgcccttatgctttatgtcacaactgttagaaatgaaaacaaatgatga tgttgatgggacctgtagaagagcccggattccacatatattccttcctc ctcacaagatgaaatagctttggtgaaggagcctaaaggtaagttacttt cttgaatttctgagaatgggataagcagaatgaaggacagcgtcttgttg gaagtttttcattgcttcagttacttcagtcattgtgagccctctcactg atatgagtcaaacataaaaatggtggaggcaattcgt
quality values	Open. Hide. 58 20 22 26 52 31 33 43 52 62 62 62 56 54 47 62 62 47 62 43 43 51 62 62 62 44 31 62 62 62 59 59 62 62 59 59 59 56 46 59 62 62 62 59 62 62 62 59 62 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 59 56 62 59 59 62 62 62 59 56 59 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 51 62 54 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 56 59 59 62 59 56 59 59 56 56 49 54 62 62 62 62 62 62 62 62 54 59 59 62 59 59 59 59 51 56 48 54 54 59 62 59 59 59 59 35 33 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 59 59 56 62 62 51 62 56 54 54 62 59 59 62 62 62 51 59 59 56 59 62 62 62 62 62 59 56 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 59 59 59 56 62 59 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 59 59 56 56 59 62 59 62 62 59 59 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 56 49 43 62 62 62 62 62 62 62 59 56 56 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 62 62 59 59 59 59 62 59 49 62 62 62 62 56 62 50 62 56 56 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 46 62 62 62 54 47 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 49 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 52 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 52 43 54 62 62 62 62 62 62 54 48 54 58 58 54 49 54 54 58 58 54 54 54 58 58 54 58 58 49 58 58 42 54 58 54 54 54 54 52 58 58 48 54 54 52 44 54 41 54 58 54 58 49 54 48 58 58 37 58 54 58 58 58 47 42 54 41 52 58 34 35 34 26 54 58 30 36 48 47 45 54 49 51 58 58 41 53 50 49 41 46 51 53 50 50 52 46 42 29 53 50 45 45 49 50 50 48 51 58 51 42 42 46 58 46 50 50 51 58 52 58 50 58 58 50 50 58 50 46 52 37 58 58 53 45 34 58 48 34 40 25 28 50 52 50 58 50 49 51 50 53 52 28 38 44 51 41 40 39 58 51 32 52 58 58 49 58 38 41 50 39 53 58 40 52 32 40 58 39 39 33 51 49 23 50 49 40 38 52 37 52 40 33 38 54 37 46 54 39 32 53 53 45 40 32 53 45 54 39 39 41 24 36 33 13 44 16 35 52 46 26 28 23 37 45 52 42 29 45 40 40 16 52 37 42 31 38 51 28 22 33 46 49 47 31 40 18 51 29 33 31 30 32 33 25 41 53 30 53 28 25 33 45 36 32 53 31 46 23 33 51 30 30 24 31 37 25 31 22 12 33 25 26 20 23 30 23 23 32 46 21 35 33 33 27 29 31 31 33 27 31 38 26 9 31 21 35 42 30 14 25 36 14 28 19 8 48 31 28 43 23 31 13 16 46 21 30 33 17 31 31 32 25 36 46 31 26 31 33 46 33 11 25 32 48 31 31 29 33 41 26 32 25 46 27 8 37 23 31 31 18 38 21 32 31 11 25 9 14 23 36 16 29 19 15 13 12 9 11 38 38 27 25 31 11 13 10 15 31 29 20 14 8 8 5	Open. Hide. 62 49 23 21 56 56 51 47 56 62 47 51 54 62 62 56 43 50 38 56 47 56 59 62 62 62 62 62 51 62 62 56 56 59 56 59 45 49 62 62 49 62 44 62 62 59 59 62 59 59 59 62 59 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 59 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 56 50 59 62 59 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 56 62 62 62 62 62 62 50 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 47 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 46 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 52 62 62 62 54 54 58 58 52 54 58 52 54 58 58 58 58 58 58 54 41 58 54 54 41 58 54 58 54 58 36 41 35 54 58 49 58 52 58 58 58 58 58 45 37 58 58 58 58 34 42 58 52 39 49 54 58 58 52 58 48 54 52 58 52 58 54 54 58 58 54 58 49 58 52 54 54 58 52 38 42 40 43 52 52 50 53 58 58 52 50 35 51 28 37 51 53 51 51 58 58 51 41 50 53 52 52 41 54 48 50 54 45 26 50 46 19 50 51 36 34 45 40 46 49 50 41 45 48 51 39 44 58 16 49 41 49 32 8 53 30 20 54 52 51 48 50 53 52 46 34 58 38 18 58 54 58 50 49 37 50 49 40 58 32 50 37 37 46 58 46 53 38 58 37 42 53 39 49 47 49 51 46 39 54 42 49 51 21 50 50 42 45 39 51 41 39 39 39 22 28 41 58 50 31 50 32 19 37 49 29 29 37 40 29 22 54 28 28 28 35 32 40 49 30 39 42 32 11 38 42 39 20 30 40 31 39 23 35 54 53 52 32 17 14 40 24 42 42 37 51 33 54 15 17 27 40 54 51 35 28 15 32 41 16 15 39 44 8 13 21 10 54 21 35 28 37 32 51 28 37 37 45 32 23 37 33 53 34 53 26 52 31 46 46 16 54 17 22 42 17 29 31 52 52 52 34 52 9 5 46 47 29 30 31 31 45 29 39 18 45 14 10 15 31 52 46 36 34 20 28 34 24 31 32 28 28 29 28 31 21 9 47 46 31 14 16 51 45 45 30 8 26 31 12 12 16 32 26 19 11 32 31 20 23 39 29 31 25 32 24 23 14 11 6 41 15 42 15 12 12 18 18 24 33 30 31 16 42 23 42 15 32 13 31 31 42 30 18 48 42 11 9 16 34 14 13 13 28 18 37 33 10 18 18 18 19 18 17 47 16 42 33 37 31 32 18 27 7 8 16 21 8 5 5 11 6 29 46 24 12 23 25 46 46 29 34 18 39 37 29 27 15 9 11 31 29 29 20 25 19 26 20 17 41 9 31 16 38 21 21 22 25 6 26 12 5 5 6 19 44 8 20 10 11 8 26 14 11 11 11 9 17 12 6 20 9 6 8 7 10 7 14 13 10 11 12 4 5 10 25 10 24 7 17 5 5 9 40 24 17 9 7 19 33 36 24 27 6 6 15 29 6 5 6 12 14 21 11 11 34 32 19 6 8 21 32 12 11 10 11 10 23 12 38 16 28 11 6 10 16 17 27 40 16 11 6 7 9 6 28 25 4 21 34 18 8 5 11 17 11 5 5 5 10 27 7 5 6 8 5 12 6 8 11 23 4 5 10 4 16 7 21 13 27 4 6 21 7 9 9 28 15 25 6 6 4 3 5 18 12 10 11 21 16 11 4 7 22 11 5 4 10 10 7 11 10 13 6 5 8 4 14 6 7 22 28 10 20 9 16 13 4 10 5 3 1 3 1 2 2 3 2 3 5 3 3 6 5 4 3 3 17 26 6 8 5 12 13 5 6 6 5 4 14 4 3 4 7 6 11 6 8

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_57533695_57534855
seq2: B6Ng01-195K20.g_65_1251 (reverse)

seq1  ACGAA-TGCCT-CACCA-TTTTCTGTTTGAACTTACAAAACAG-GAGAGG  46
      ||||| ||||| ||||| |||| |||||| |||  || | ||| ||||||
seq2  ACGAATTGCCTCCACCATTTTTATGTTTG-ACT--CATATCAGTGAGAGG  47

seq1  ---CAC-ATGACTG-AGTTACTGAAGCAAATGAAAAACATCAAACAA-AC  90
         ||| ||||||| ||| |||||||| |||||||||| || ||||| ||
seq2  GCTCACAATGACTGAAGTAACTGAAGC-AATGAAAAACTTCCAACAAGAC  96

seq1  GCCTGTCCT--CTTCTGCTT-TCCCTTTCTCAGAAATTCAAG-AAGT-AC  135
      | |||||||   |||||||| |||| |||||||||||||||| |||| ||
seq2  G-CTGTCCTTCATTCTGCTTATCCCATTCTCAGAAATTCAAGAAAGTAAC  145

seq1  TTACCTTTTAGCTCCTTTCACCAAAGCTATTTCATCTGGTGAGGAGGA--  183
      ||||||||  ||||| ||||||||||||||||||||| ||||||||||  
seq2  TTACCTTTAGGCTCC-TTCACCAAAGCTATTTCATCTTGTGAGGAGGAAG  194

seq1  -GATATATGT-GAATCCGGCTCCTTCTACAGGT-CCATCAACATCATCAT  230
        |||||||| ||||||||   ||||||||||| ||||||||||||||||
seq2  GAATATATGTGGAATCCGGGCTCTTCTACAGGTCCCATCAACATCATCAT  244

seq1  TTGTTTTCATTTCT-ACAG-TGTGACAT-AAGCAT-AGGGCACGGAG-AA  275
      |||||||||||||| |||| |||||||| |||||| ||||||||||| ||
seq2  TTGTTTTCATTTCTAACAGTTGTGACATAAAGCATAAGGGCACGGAGAAA  294

seq1  AGAGTGCCTCTCGGTTCTGTGG-AACAGAAGCATC-AAATTACTATTCTT  323
      |||||||||||||||||||||| |||||||||||| ||||||||||||||
seq2  AGAGTGCCTCTCGGTTCTGTGGAAACAGAAGCATCAAAATTACTATTCTT  344

seq1  TTTATTTTGATCACTAGGTAACCCAG-ACAGTGAAC-AAATTAAAAATAT  371
      |||||||||||||||||||||||||| ||||||||| |||||||||||||
seq2  TTTATTTTGATCACTAGGTAACCCAGAACAGTGAACAAAATTAAAAATAT  394

seq1  T-AAGGTGACAGAATGTCATAATCTCTCTGAAA--TTTATAAATTCCAAA  418
      | |||||||||||||||||||||||||||||||  |||||||||||||||
seq2  TAAAGGTGACAGAATGTCATAATCTCTCTGAAAATTTTATAAATTCCAAA  444

seq1  TACTCAAACGACTACATAGCAACGAATACAATTACTGGTTCCTGGAAGCT  468
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTCAAACGACTACATAGCAACGAATACAATTACTGGTTCCTGGAAGCT  494

seq1  GGAGAGAGAGCTCAGAGGTTAAGAGCACTGACTGCTCTTCCAGGGGTCCT  518
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGAGAGCTCAGAGGTTAAGAGCACTGACTGCTCTTCCAGGGGTCCT  544

seq1  GAGTTCAATTCTCAGAAACTACCTGGTGGCTCACAACCATCTGTAACCAA  568
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTCAATTCTCAGAAACTACCTGGTGGCTCACAACCATCTGTAACCAA  594

seq1  GCTGTATCTGAAGACAGCTAACAGTGTACTCATATATATTATTAACTCAT  618
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTATCTGAAGACAGCTAACAGTGTACTCATATATATTATTAACTCAT  644

seq1  TCAAATTCACATGTAGTATCACCTATACCTAAGGTAGTGACTTCTTTATG  668
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAATTCACATGTAGTATCACCTATACCTAAGGTAGTGACTTCTTTATG  694

seq1  GCTTAAGATGTAGTTAGGTATCACAATCTAGCAATTGTTCATGTGTAGGA  718
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTAAGATGTAGTTAGGTATCACAATCTAGCAATTGTTCATGTGTAGGA  744

seq1  AGACTTTGATTTACCTAACATGTAAATATTAGGTCTTTAATGATTTGAAG  768
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTTTGATTTACCTAACATGTAAATATTAGGTCTTTAATGATTTGAAG  794

seq1  AGACAACATTCTTAGAAAAGCTGATTTTTTTAAGTGAATGCACATACAGC  818
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAACATTCTTAGAAAAGCTGATTTTTTTAAGTGAATGCACATACAGC  844

seq1  TAAGTTAATATTTTTGTTCAAATGCCATTTCCCATAATTCTACTTCTAAG  868
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTTAATATTTTTGTTCAAATGCCATTTCCCATAATTCTACTTCTAAG  894

seq1  TTCTAGTTGTCTACAAATGCTAAAAGTATTAATAAAAGAAAGGTGTAGTT  918
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAGTTGTCTACAAATGCTAAAAGTATTAATAAAAGAAAGGTGTAGTT  944

seq1  AAAAAAAAAGCAAATAATTATTCAAAACTCGTTATCATGCACCCATTGGA  968
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAGCAAATAATTATTCAAAACTCGTTATCATGCACCCATTGGA  994

seq1  AAATTCGGTATTTCTACTATATAGGGATAAAACATGCTTACAAAGATTGA  1018
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCGGTATTTCTACTATATAGGGATAAAACATGCTTACAAAGATTGA  1044

seq1  TTTCTCAGGTAAAACAACAGAGAAAATGTCACCTTATCTGCTTTATCAAA  1068
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTCAGGTAAAACAACAGAGAAAATGTCACCTTATCTGCTTTATCAAA  1094

seq1  ATAGGCTAAGGGCCCATCAGTCTGAGATAATCCATCAACTTCCTGAGTTG  1118
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGGCTAAGGGCCCATCAGTCTGAGATAATCCATCAACTTCCTGAGTTG  1144

seq1  TGCCTTTATATTTGTGCCCATCTATGCAGCATTCAATGAATTC  1161
      |||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTTATATTTGTGCCCATCTATGCAGCATTCAATGAATTC  1187

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information