MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-197F16
Chromosome	X (Build37)
Map Location	89,926,118 - 90,021,291
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Mageb5, LOC673766, LOC633484, LOC674396, EG278087, Mageb1, EG236892, EG236893, Mageb18, EG436259, EG668061, EG546347, LOC629568
Downstream gene	LOC100042663, Rp23-438h3.2, Arx, Pola1, EG629581, Pcyt1b, Pdk3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mageb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74271 MGI:2148169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 13 Proteins

name	LOC673766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC633484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633484
definition	note : melanoma antigen, family B pseudogene pseudo : _no_value

name	LOC674396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG278087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278087 MGI:3645128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mageb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17145 MGI:105118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG236892 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236892 MGI:3643139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins

name	EG236893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236893 MGI:3643140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Mageb18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215641 MGI:3045344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436259 MGI:3648071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG668061 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668061 MGI:3645921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG546347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546347 MGI:3646197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042663 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein pseudo : _no_value

name	Rp23-438h3.2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:69357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11878 MGI:1097716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pola1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18968 MGI:99660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629581 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629581 MGI:3644316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Pcyt1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236900 MGI:2384308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mageb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407644 GeneID:74271 MGI:2148169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 13 Proteins product : melanoma antigen, family B, 5 transcript_id : XM_284719.3

name	EG278087 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:136255945 GeneID:278087 MGI:3645128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG278087 transcript_id : NM_001083629.1

name	Mageb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8659569 GeneID:17145 MGI:105118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family B, 1 transcript_id : NM_010759.1

name	EG236892 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407645 GeneID:236892 MGI:3643139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins product : predicted gene, EG236892 transcript_id : XM_141934.2

name	EG236893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20984657 GeneID:236893 MGI:3643140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG236893 transcript_id : XM_141935.1

name	Mageb18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372036 GeneID:215641 MGI:3045344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen family B, 18 transcript_id : NM_173783.3

name	EG668061 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407648 GeneID:668061 MGI:3645921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG668061 transcript_id : XM_994015.1

name	EG546347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539459 GeneID:546347 MGI:3646197
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546347 transcript_id : NM_001034103.1

name	Rp23-438h3.2 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:50356001 GeneID:69357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC69357 transcript_id : NM_183280.2

name	Arx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982501 GeneID:11878 MGI:1097716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aristaless related homeobox gene (Drosophila) transcript_id : NM_007492.3

name	Pola1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679408 GeneID:18968 MGI:99660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), alpha 1 transcript_id : NM_008892.1

name	EG629581 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407659 GeneID:629581 MGI:3644316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG629581 transcript_id : XM_894481.2

name	Pcyt1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877072 GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 1, choline, beta isoform transcript_id : NM_177546.2

name	Pcyt1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877070 GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 1, choline, beta isoform transcript_id : NM_211138.1

name	Pdk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130212 GeneID:236900 MGI:2384308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate dehydrogenase kinase, isoenzyme 3 transcript_id : NM_145630.2

name	Mageb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28528822 GeneID:74271 MGI:2148169
definition	codon_start : 1 product : melanoma antigen, family B, 5 protein_id : XP_284719.1

name	EG278087 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:136255946 GeneID:278087 MGI:3645128
definition	codon_start : 1 note : melanoma antigen, family B, 2 product : predicted gene, EG278087 protein_id : NP_001077098.1

name	Mageb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8659570 CCDS:CCDS30267.1 GeneID:17145 MGI:105118
definition	codon_start : 1 product : melanoma antigen, family B, 1 protein_id : NP_034889.1

name	EG236892 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407646 GeneID:236892 MGI:3643139
definition	codon_start : 1 product : similar to MAGE-B3 protein_id : XP_141934.2

name	EG236893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984658 GeneID:236893 MGI:3643140
definition	codon_start : 1 product : similar to melanoma antigen, family B, 1 protein_id : XP_141935.1

name	Mageb18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424659 CCDS:CCDS30268.1 GeneID:215641 MGI:3045344
definition	codon_start : 1 product : melanoma antigen family B, 18 protein_id : NP_776144.1

name	EG668061 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407649 GeneID:668061 MGI:3645921
definition	codon_start : 1 product : similar to Predicted gene, EG546347 protein_id : XP_999109.1

name	EG546347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539460 GeneID:546347 MGI:3646197
definition	codon_start : 1 product : hypothetical protein LOC546347 protein_id : NP_001029275.1

name	Rp23-438h3.2 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:46518547 GeneID:69357
definition	codon_start : 1 product : hypothetical protein LOC69357 protein_id : NP_899103.1

name	Arx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024213 CCDS:CCDS30271.1 GeneID:11878 MGI:1097716
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : aristaless related homeobox gene protein_id : NP_031518.2

name	Pola1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679409 CCDS:CCDS30272.1 GeneID:18968 MGI:99660
definition	GO_component : GO:0005658 - alpha DNA polymerase:primase complex [Evidence IDA] [Evidence ISS]; GO:0000785 - chromatin [Evidence ISS]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0003889 - alpha DNA polymerase activity [Evidence ISS]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0003896 - DNA primase activity [Evidence ISS]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence ISS] [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0006260 - DNA replication [Evidence IDA] [Evidence IMP]; GO:0006270 - DNA replication initiation [Evidence ISS]; GO:0000731 - DNA synthesis during DNA repair [Evidence ISS]; GO:0006303 - double-strand break repair via nonhomologous end joining [Evidence ISS]; GO:0006273 - lagging strand elongation [Evidence ISS]; GO:0006272 - leading strand elongation [Evidence ISS]; GO:0009268 - response to pH [Evidence ISS]; GO:0009615 - response to virus [Evidence ISS]; GO:0000084 - S phase of mitotic cell cycle [Evidence ISS] codon_start : 1 note : DNA polymerase alpha 1, 180 kDa; G7a/Bat6Hom product : polymerase (DNA directed), alpha 1 protein_id : NP_032918.1

name	EG629581 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001907 GeneID:629581 MGI:3644316
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899574.1

name	Pcyt1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29164513 GeneID:236899 MGI:2147987
definition	EC_number : 2.7.7.15 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004105 - choline-phosphate cytidylyltransferase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; phosphorylcholine transferase B product : phosphate cytidylyltransferase 1, choline, beta isoform isoform 2 protein_id : NP_808214.1

name	Pcyt1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877071 CCDS:CCDS30274.1 GeneID:236899 MGI:2147987
definition	EC_number : 2.7.7.15 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004105 - choline-phosphate cytidylyltransferase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; phosphorylcholine transferase B product : phosphate cytidylyltransferase 1, choline, beta isoform isoform 1 protein_id : NP_997593.1

name	Pdk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704122 CCDS:CCDS30275.1 GeneID:236900 MGI:2384308
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0016310 - phosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : pyruvate dehydrogenase kinase, isoenzyme 3 protein_id : NP_663605.1

name	LOC673766 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673766
definition	number : 1 pseudo : _no_value

name	LOC674396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674396
definition	number : 2 pseudo : _no_value

name	LOC674396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674396
definition	number : 1 pseudo : _no_value

name	EG436259 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436259
definition	number : 2 pseudo : _no_value

name	EG436259 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436259
definition	number : 1 pseudo : _no_value

name	LOC629568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629568
definition	number : 1 pseudo : _no_value

name	LOC629568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629568
definition	number : 2 pseudo : _no_value

name	LOC100042663 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271822 GeneID:100042663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein product : hypothetical protein LOC100042663 pseudo : _no_value transcript_id : XR_033643.1

clone name	MSMg01-425F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-457M24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184D09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-115I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261A01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194F20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-197F16.b	B6Ng01-197F16.g
ACC	GA019241	GA019242
length	1,184	1,009
definition	B6Ng01-197F16.b	B6Ng01-197F16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(90,020,075 - 90,021,291)	(89,926,118 - 89,926,960)
sequence	gaattctgtcctagaatatatatgcaaggctgatagagataggcaaatgg ctatggtgagaagtgagcatttgctttccatattagagaaagatgacaga tcctaaatgaagtagaagactgattcttgatattcagaatggagacagtt cttcatcaagcctatattaaattcatttcattaatgttttgtgtgagaag gcagaaaaaagtaacttttggggggagactgggagactgaaattgcccaa tgttccagttacttttattatgatgtgaactcacatctcataaaaaaaaa aaaaaacatgaaaaaagtattttctttatctgcctggcagatgcgtttca attacagttggtcgggtatgatgacaaatgcctttaatgatctgctgcct ttcagggttctgcaaagaatgctttttaatgtcacaggtgctagaagaag gatttttcatagcagttttcctagtatttgagatgtgatttttaaaatta ttacatttattcttttcctctccctgcctccttccccctctctcttctcc atgtctacacacacacacacacacacacacacacacacacacacatgaag gccagagaacaacatgtagaagatagttctttccttttaccgtgtggatc ctggaatagaactcatgtcttcaggcttaaaaacaatcatctttacagtt acccctcccagccattctcagcagcccagagatatgatctcatgtgttgt gttgtggcacatgcatcgaaacatttggggtttcagcctatccacgcagg tttcttgtccttttttccttgaatcttgtgttctttcttggatttgaata gacttttatcaggataaaacttgcataatgactttagttctcccaacgtc taccactctgtgctatagtgtgctaaatgagagccccaaatcactgggta tagatgattatcatctatacttttagagacttcaattagagactgagttt tgggactcctccaaaagtgccattctactccgaggatctatgaagaatct ttgcctcaaacaccttatctgtgtttgcattaggatattaggacagtaga tgactcagcttattgaaggaaccggactcagatgaaccatctccaaagtc ttagaacctgaataaacttgagactctacttgaa	gaattcattaacaaagctatcatcattctattgcctagaaaaattaaatt aaaatatattattattaaaaataggaaatttaataaattctaaatgggcc atttaatattaaaagaatttaatttctttaagaccgtttcccactacctg ctattttcaaagccatctttcagcacatacccactttaaatttctaatta tctgtgagtgattgactttagataattcaggtaaaccggtatttgaagtt cttggcagcaaggaactgggatcagtattggccataaacatctactcagc taacttagccattgtcactaagtatgaatagaatgccagctatgagaata ggcaatgcagaaataaaactccatattgcagagaagattttgacaaggat cccaggaacacaaaatgtagggacagtctatctagtatgatggtggggaa actgagtatccttgtgcagaacactgatagatcatcatctcatatagtat atgaaaaaatcaagccaaaaaggacaataggcttaaatatgacttaaaat gaagaaaaacctacaagacaaaatcattagggactatgtccattacatgg acagtggaagacaacaacaggggatatccatgatgagtattcatgcaaaa ctcctcagcatagtaccagcaaactgaattggacaatatgtaaagaagat tacaccccatggctaaaatgttatacctggaatacaagtattgttaacca cattataaatagtgctacccatgacattagccaaatggaaaataaaaatt actcaatcatctaaataatgaacaaaaattgagaaaggttcaacatcgtg tcacagtaatacaataaacaaaaaagaagaaagttatagctacataataa atgataaggttgtctgcttctgccactgctattcacatagcattgggaaa tcctagccccagttatgaggcacgtaaaaaaaaaaaaaaaagccctgcaa atcatttaa
quality values	Open. Hide. 62 47 39 41 62 62 47 47 62 62 62 62 47 62 59 59 59 62 59 62 62 62 59 59 59 59 62 54 62 62 62 62 59 62 62 62 62 62 59 49 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 54 54 62 62 62 59 59 62 62 62 54 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 54 59 59 59 62 62 62 62 54 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 59 56 54 56 62 62 62 59 56 48 56 59 59 56 43 54 59 59 62 59 62 56 54 54 56 59 56 62 51 43 43 39 54 34 59 62 59 62 62 54 59 59 59 62 62 59 62 59 59 59 59 62 62 59 62 62 62 62 51 59 59 59 54 46 62 62 62 56 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 59 50 62 62 59 62 62 62 62 62 62 59 62 56 62 62 59 62 62 62 62 56 62 56 62 62 62 56 50 62 62 56 62 62 62 62 54 54 62 62 62 62 62 51 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 46 46 47 54 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 43 40 62 52 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 48 44 40 52 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 54 58 58 58 52 58 52 58 54 58 54 58 54 58 48 58 54 58 58 58 54 54 58 27 43 58 50 58 30 58 58 34 48 50 51 48 51 58 53 58 42 58 58 35 58 30 58 50 58 49 52 58 51 48 42 44 43 50 58 48 46 49 54 58 42 58 50 58 51 37 39 50 51 50 54 46 58 50 41 51 37 58 51 50 53 53 49 50 58 50 52 58 38 51 31 53 58 31 51 50 50 58 58 58 50 52 39 52 50 51 42 53 53 58 58 41 38 51 39 50 42 54 31 32 54 54 50 49 53 51 50 32 45 51 50 35 54 49 42 52 42 42 42 53 34 34 54 54 52 47 30 41 28 39 37 38 41 52 45 32 42 52 45 31 39 54 40 53 32 46 53 32 32 20 53 53 31 54 53 32 38 32 34 38 45 40 31 53 42 27 47 53 32 34 28 38 46 25 34 53 53 53 31 51 32 36 34 28 34 46 26 35 34 23 51 25 31 37 42 29 21 51 31 46 32 51 45 24 51 22 44 30 32 47 46 46 46 31 29 33 23 33 31 30 33 22 32 26 24 46 13 51 31 18 41 31 51 31 43 29 16 29 18 13 13 46 31 24 33 31 24 31 24 31 32 32 46 46 28 31 38 38 29 31 31 19 9 24 48 48 43 29 31 36 36 26 31 21 18 19 24 31 28 30 31 47 29 31 30 15 25 22 27 22 41 38 20 31 26 29 31 42 30 27 16 36 35 34 38 30 27 31 20 33 31 26 22 25 31 24 20 31 15 30 26 22 31 44 31 20 27 28 9 31 16 31 44 44 9 7 28 19 35 34 31 25 28 37 48 25 22 21 19 23 24 20 15 32 33 24 7 12 31 27 22 32 26 27 27 22 21 34 22 48 48 26 11 15 26 9 10 16 11 8 24 6 6 9 25 6 6 7 9 5 3 12 15 20 14 22 34 31 13 19 28 10 14 16 20 18 28 24 20 15 15 28 27 18 11 10 27 5 10 6 27 24 20 11 20 20 16 9 28 12 28 16 22 5 5 7 5 16 27 12 22 19 11 24 28 14 16 12 38 18 11 10 6 18 9 13 27 8 6 3 3 3 3 5 16 23 9 12 22 5 7 6 28 18 19 16 20 15 13 7 4 8 11 4 5 5 14 11 6 14 8 9 5 19 21 11 22 16 8 8 18 16 6 14 7 6 13 11 10 17 10 5 2 3 13 2 7 12 9 8 5 7 14 3 2 3 4 7 11 17 10 16 4 3 3 5 3 2 8 4 13 3 1 13 6 1 2 6 22 6 1 1 2 4 7 10 4 1 9 3 3 2 4 17 4 3 3 6 4 15 5 5 1 6 4 3 6 5 3 7 12 28	Open. Hide. 62 49 46 47 62 59 43 62 59 62 62 59 49 62 62 62 62 62 62 62 59 54 62 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 49 45 58 58 58 58 58 58 54 46 58 58 58 58 58 58 58 58 46 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 54 58 58 58 58 54 54 58 58 58 51 53 58 51 51 51 58 58 58 51 51 54 51 44 58 58 49 58 58 58 47 53 52 58 58 58 58 58 47 45 49 50 51 42 58 58 58 58 49 49 58 53 58 58 58 51 50 54 32 52 50 51 47 51 58 50 46 49 49 58 39 39 52 53 51 54 46 53 58 58 46 58 58 53 53 39 35 54 53 42 53 58 53 32 58 58 51 49 51 53 53 52 51 41 39 53 52 51 51 50 53 42 40 22 18 52 58 41 51 43 36 54 54 54 42 44 54 54 49 53 39 35 42 49 52 53 54 37 33 54 52 52 54 54 38 41 24 50 40 52 34 53 54 46 38 35 32 54 54 47 31 28 54 54 47 39 54 26 45 52 45 37 42 51 39 54 40 32 30 34 32 42 30 33 36 45 37 33 39 54 45 24 28 39 45 45 32 45 34 42 32 53 42 35 51 40 32 52 52 25 52 39 40 34 41 53 42 26 32 53 35 32 26 20 31 33 29 41 42 31 51 43 31 41 28 30 51 51 42 33 31 51 51 51 31 19 26 31 31 31 31 31 33 31 43 32 33 34 33 33 47 36 30 29 42 31 42 33 31 28 17 47 47 47 30 28 46 41 38 14 17 46 11 33 22 7 30 34 26 30 37 29 31 32 30 23 42 18 29 25 35 35 26 30 30 21 28 19 28 30 18 32 31 48 30 20 24 47 48 47 47 32 29 27 33 26 34 48 31 43 29 30 31 34 32 31 37 34 24 31 15 37 24 33 31 31 43 43 25 42 32 28 18 17 6 44 16 24 38 22 38 32 32 18 25 21 21 24 36 28 29 18 29 24 32 31 31 26 18 31 26 34 12 20 24 24 22 32 21 17 21 7 43 7 28 47 19 19 19 30 32 34 21 37 39 37 33 13 14 25 19 19 21 20 32 18 19 6 19 27 31 32 37 39 48 48 48 37 47 34 47 40 30 38 38 40 40 21 24 15 34 21 13 20 21 13 34 13 16 27 13 26 40 27 14 40

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_90020075_90021291
seq2: B6Ng01-197F16.b_50_1233 (reverse)

seq1  TTCAAGTAGAG-CTCAAGATTTAATTTTAGTGTTTATAAAGATTTGGGGA  49
      ||||||||||| |||||| ||||  || |  | || |||   ||||| ||
seq2  TTCAAGTAGAGTCTCAAG-TTTA--TTCA--GGTTCTAAGACTTTGGAGA  45

seq1  GGATGGGGTTCTCATCCTGAGCTCCGTCTCCTTTTAAAATAAGGCTGAGG  99
       | |       |||| ||||| ||||  |||||    ||||| ||||| |
seq2  TGGT-------TCAT-CTGAG-TCCGGTTCCTT---CAATAA-GCTGA-G  81

seq1  TCATCCTAACTGTCCTTAATATCCTTAATGCAAACACAGAATAAGGGGTT  149
      |||||   ||||||| |||||||| |||||||||||||| ||||||    
seq2  TCATC--TACTGTCC-TAATATCC-TAATGCAAACACAG-ATAAGG----  122

seq1  TGTTTGAAGCAAAGATTCTTTCATAGGTCCCTCGGAGTAGAAATGCCACT  199
      ||||||| |||||||||| ||||||| | ||||||||||| |||| ||||
seq2  TGTTTGAGGCAAAGATTC-TTCATAGAT-CCTCGGAGTAG-AATGGCACT  169

seq1  TTTGGAGGAGTCCCAAAACTCAGTTCCTCCTAATTGGAGTCTCTAAAAGT  249
      ||||||||||||||||||||||||  || ||||||| |||||||||||||
seq2  TTTGGAGGAGTCCCAAAACTCAGT--CT-CTAATTGAAGTCTCTAAAAGT  216

seq1  ATAGATGATAATCATCTATACCCAGTGATTTGGGGCTCTCATTTAGCACA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGATGATAATCATCTATACCCAGTGATTTGGGGCTCTCATTTAGCACA  266

seq1  CTATAGCACAGAGTGGTAGACGTTGGGAGAACTAAAGTCATTATGCAAGT  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATAGCACAGAGTGGTAGACGTTGGGAGAACTAAAGTCATTATGCAAGT  316

seq1  TTTATCCTGATAAAAGTCTATTCAAATCCAAGAAAGAACACAAGATTCAA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATCCTGATAAAAGTCTATTCAAATCCAAGAAAGAACACAAGATTCAA  366

seq1  GGAAAAAAGGACAAGAAACCTGCGTGGATAGGCTGAAACCCCAAATGTTT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAAAAGGACAAGAAACCTGCGTGGATAGGCTGAAACCCCAAATGTTT  416

seq1  CGATGCATGTGCCACAACACAACACATGAGATCATATCTCTGGGCTGCTG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGATGCATGTGCCACAACACAACACATGAGATCATATCTCTGGGCTGCTG  466

seq1  AGAATGGCTGGGAGGGGTAACTGTAAAGATGATTGTTTTTAAGCCTGAAG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATGGCTGGGAGGGGTAACTGTAAAGATGATTGTTTTTAAGCCTGAAG  516

seq1  ACATGAGTTCTATTCCAGGATCCACACGGTAAAAGGAAAGAACTATCTTC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGAGTTCTATTCCAGGATCCACACGGTAAAAGGAAAGAACTATCTTC  566

seq1  TACATGTTGTTCTCTGGCCTTCATGTGTGTGTGTGTGTGTGTGTGTGTGT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATGTTGTTCTCTGGCCTTCATGTGTGTGTGTGTGTGTGTGTGTGTGT  616

seq1  GTGTGTGTGTGTAGACATGGAGAAGAGAGAGGGGGAAGGAGGCAGGGAGA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTAGACATGGAGAAGAGAGAGGGGGAAGGAGGCAGGGAGA  666

seq1  GGAAAAGAATAAATGTAATAATTTTAAAAATCACATCTCAAATACTAGGA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAAGAATAAATGTAATAATTTTAAAAATCACATCTCAAATACTAGGA  716

seq1  AAACTGCTATGAAAAATCCTTCTTCTAGCACCTGTGACATTAAAAAGCAT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGCTATGAAAAATCCTTCTTCTAGCACCTGTGACATTAAAAAGCAT  766

seq1  TCTTTGCAGAACCCTGAAAGGCAGCAGATCATTAAAGGCATTTGTCATCA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGCAGAACCCTGAAAGGCAGCAGATCATTAAAGGCATTTGTCATCA  816

seq1  TACCCGACCAACTGTAATTGAAACGCATCTGCCAGGCAGATAAAGAAAAT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCGACCAACTGTAATTGAAACGCATCTGCCAGGCAGATAAAGAAAAT  866

seq1  ACTTTTTTCATGTTTTTTTTTTTTTTTATGAGATGTGAGTTCACATCATA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTTTTCATGTTTTTTTTTTTTTTTATGAGATGTGAGTTCACATCATA  916

seq1  ATAAAAGTAACTGGAACATTGGGCAATTTCAGTCTCCCAGTCTCCCCCCA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAGTAACTGGAACATTGGGCAATTTCAGTCTCCCAGTCTCCCCCCA  966

seq1  AAAGTTACTTTTTTCTGCCTTCTCACACAAAACATTAATGAAATGAATTT  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTACTTTTTTCTGCCTTCTCACACAAAACATTAATGAAATGAATTT  1016

seq1  AATATAGGCTTGATGAAGAACTGTCTCCATTCTGAATATCAAGAATCAGT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATAGGCTTGATGAAGAACTGTCTCCATTCTGAATATCAAGAATCAGT  1066

seq1  CTTCTACTTCATTTAGGATCTGTCATCTTTCTCTAATATGGAAAGCAAAT  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTACTTCATTTAGGATCTGTCATCTTTCTCTAATATGGAAAGCAAAT  1116

seq1  GCTCACTTCTCACCATAGCCATTTGCCTATCTCTATCAGCCTTGCATATA  1199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCACTTCTCACCATAGCCATTTGCCTATCTCTATCAGCCTTGCATATA  1166

seq1  TATTCTAGGACAGAATTC  1217
      ||||||||||||||||||
seq2  TATTCTAGGACAGAATTC  1184

seq1: chrX_89926118_89926960
seq2: B6Ng01-197F16.g_62_905

seq1  GAATTCATTAACAAAGCTATCATCATTCTATTGCCTAGAAAAATTAAATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTAACAAAGCTATCATCATTCTATTGCCTAGAAAAATTAAATT  50

seq1  AAAATATATTATTATTAAAAATAGGAAATTTAATAAATTCTAAATGGGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATATATTATTATTAAAAATAGGAAATTTAATAAATTCTAAATGGGCC  100

seq1  ATTTAATATTAAAAGAATTTAATTTCTTTAAGACCGTTTCCCACTACCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAATATTAAAAGAATTTAATTTCTTTAAGACCGTTTCCCACTACCTG  150

seq1  CTATTTTCAAAGCCATCTTTCAGCACATACCCACTTTAAATTTCTAATTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTTCAAAGCCATCTTTCAGCACATACCCACTTTAAATTTCTAATTA  200

seq1  TCTGTGAGTGATTGACTTTAGATAATTCAGGTAAACCGGTATTTGAAGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTGAGTGATTGACTTTAGATAATTCAGGTAAACCGGTATTTGAAGTT  250

seq1  CTTGGCAGCAAGGAACTGGGATCAGTATTGGCCATAAACATCTACTCAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGCAGCAAGGAACTGGGATCAGTATTGGCCATAAACATCTACTCAGC  300

seq1  TAACTTAGCCATTGTCACTAAGTATGAATAGAATGCCAGCTATGAGAATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTTAGCCATTGTCACTAAGTATGAATAGAATGCCAGCTATGAGAATA  350

seq1  GGCAATGCAGAAATAAAACTCCATATTGCAGAGAAGATTTTGACAAGGAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAATGCAGAAATAAAACTCCATATTGCAGAGAAGATTTTGACAAGGAT  400

seq1  CCCAGGAACACAAAATGTAGGGACAGTCTATCTAGTATGATGGTGGGGAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGAACACAAAATGTAGGGACAGTCTATCTAGTATGATGGTGGGGAA  450

seq1  ACTGAGTATCCTTGTGCAGAACACTGATAGATCATCATCTCATATAGTAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGTATCCTTGTGCAGAACACTGATAGATCATCATCTCATATAGTAT  500

seq1  ATGAAAAAATCAAGCCAAAAAGGACAATAGGCTTAAATATGACTTAAAAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAAAAATCAAGCCAAAAAGGACAATAGGCTTAAATATGACTTAAAAT  550

seq1  GAAGAAAAACCTACAAGACAAAATCATTAGGGACTATGTCCATTACATGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAAAACCTACAAGACAAAATCATTAGGGACTATGTCCATTACATGG  600

seq1  ACAGTGGAAGACAACAACAGGGGATATCCATGATGAGTATTCATGCAAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGGAAGACAACAACAGGGGATATCCATGATGAGTATTCATGCAAAA  650

seq1  CTCCTCAGCATAGTACCAGCAAACTGAATTGGACAATATGTAAAGAAGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTCAGCATAGTACCAGCAAACTGAATTGGACAATATGTAAAGAAGAT  700

seq1  TACACCCCATGGCTAAAATGTTATACCTGGAATACAAGTATTGTTAACCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACCCCATGGCTAAAATGTTATACCTGGAATACAAGTATTGTTAACCA  750

seq1  CATTATAAATAGTGCTACCCATGACATTAGCCAAATGGAAAATAAAAATT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTATAAATAGTGCTACCCATGACATTAGCCAAATGGAAAATAAAAATT  800

seq1  ACTCAATCATCTAAATAATGAACAAAAATTGAG-AAGGTTCAAC  843
      ||||||||||||||||||||||||||||||||| ||||||||||
seq2  ACTCAATCATCTAAATAATGAACAAAAATTGAGAAAGGTTCAAC  844

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information