MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-216I24
Chromosome	X (Build37)
Map Location	159,858,567 - 159,859,516
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Reps2, LOC654358, LOC100041557, LOC667630, Rbbp7, 4932441K18Rik, LOC671250, Syap1, LOC100041607, Ctps2, S100g, LOC100040610
Downstream gene	EG637051, Grpr, 1700045I19Rik, Ap1s2, Zrsr2, Car5b, Siah1b, Tmem27, Ace2, Bmx, Pir, Figf, Piga
Link	Open Mouse BAC browser

Click to get alignment info.

name	Reps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194590 MGI:2663511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC654358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654358
definition	note : ubiquitin A-52 residue ribosomal protein fusion product 1 pseudogene pseudo : _no_value

name	LOC100041557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC667630 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Rbbp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245688 MGI:1194910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932441K18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353170 MGI:3590652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Syap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67043 MGI:1914293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041607 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ctps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55936 MGI:1933185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12309 MGI:104528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040610 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG637051 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637051 MGI:3645878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Grpr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14829 MGI:95836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700045I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74264 MGI:1921514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Ap1s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108012 MGI:1889383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zrsr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Car5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56078 MGI:1926249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Siah1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20438 MGI:108063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57394 MGI:1926234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ace2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70008 MGI:1917258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12169 MGI:1101778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pir (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69656 MGI:1916906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Figf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14205 MGI:108037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Piga (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18700 MGI:99461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490400 GeneID:194590 MGI:2663511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RALBP1 associated Eps domain containing protein 2 transcript_id : NM_178256.3

name	Rbbp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982058 GeneID:245688 MGI:1194910
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoblastoma binding protein 7 transcript_id : NM_009031.2

name	4932441K18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369021 GeneID:353170 MGI:3590652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932441K18 gene transcript_id : NM_178935.3

name	Syap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385423 GeneID:67043 MGI:1914293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synapse associated protein 1 transcript_id : NM_025932.1

name	Ctps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377114 GeneID:55936 MGI:1933185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytidine 5'-triphosphate synthase 2 transcript_id : NM_018737.3

name	S100g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816950 GeneID:12309 MGI:104528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein G transcript_id : NM_009789.2

name	Grpr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130941 GeneID:14829 MGI:95836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrin releasing peptide receptor transcript_id : NM_008177.2

name	Ap1s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254483 GeneID:108012 MGI:1889383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 1, sigma 2 subunit transcript_id : NM_026887.2

name	Zrsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949799 GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 transcript_id : NM_009453.2

name	Zrsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949774 GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 transcript_id : NM_178794.3

name	Car5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506462 GeneID:56078 MGI:1926249
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5b, mitochondrial transcript_id : NM_019513.1

name	Car5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227235 GeneID:56078 MGI:1926249
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5b, mitochondrial transcript_id : NM_181315.3

name	Siah1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677948 GeneID:20438 MGI:108063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seven in absentia 1B transcript_id : NM_009173.1

name	Tmem27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892354 GeneID:57394 MGI:1926234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 27 transcript_id : NM_020626.2

name	Ace2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389001 GeneID:70008 MGI:1917258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 transcript_id : NM_027286.3

name	Bmx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802105 GeneID:12169 MGI:1101778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BMX non-receptor tyrosine kinase transcript_id : NM_009759.3

name	Pir (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130337 GeneID:69656 MGI:1916906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pirin transcript_id : NM_027153.2

name	Figf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753873 GeneID:14205 MGI:108037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : c-fos induced growth factor transcript_id : NM_010216.1

name	Piga (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126273665 GeneID:18700 MGI:99461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class A transcript_id : NM_011081.2

name	Reps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490401 CCDS:CCDS30508.1 GeneID:194590 MGI:2663511
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : RALBP1-associated Eps domain containing protein 2 product : RalBP1 associated Eps domain containing protein 2 protein_id : NP_839987.2

name	Rbbp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982059 CCDS:CCDS30509.1 GeneID:245688 MGI:1194910
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016581 - NuRD complex [Evidence IDA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence TAS]; GO:0006260 - DNA replication [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G1/S transition control protein-binding protein; histone acetyltransferase type B subunit 2 product : retinoblastoma binding protein 7 protein_id : NP_033057.2

name	4932441K18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725808 CCDS:CCDS30510.1 GeneID:353170 MGI:3590652
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] codon_start : 1 note : lipopolysaccharide-specific response protein 5; factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription product : gamma-taxilin protein_id : NP_849266.1

name	Syap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385424 CCDS:CCDS30511.1 GeneID:67043 MGI:1914293
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : mismatches in translation product : synapse associated protein 1 protein_id : NP_080208.1

name	Ctps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055198 GeneID:55936 MGI:1933185
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006541 - glutamine metabolism [Evidence IEA] codon_start : 1 note : CTP synthetase homolog product : cytidine triphosphate synthase II protein_id : NP_061207.1

name	S100g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106263 GeneID:12309 MGI:104528
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005499 - vitamin D binding [Evidence IEA] codon_start : 1 note : calbindin-D9K; calbindin 3, (vitamin D-dependent calcium binding protein); calbindin D9k; calbindin-D9K major form; cytidine 5'-triphosphate synthase 2 product : S100 calcium binding protein G protein_id : NP_033919.1

name	Grpr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680111 CCDS:CCDS30512.1 GeneID:14829 MGI:95836
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004946 - bombesin receptor activity [Evidence TAS]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : bombesin receptor product : gastrin releasing peptide receptor protein_id : NP_032203.1

name	Ap1s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254484 CCDS:CCDS30514.1 GeneID:108012 MGI:1889383
definition	GO_component : GO:0030121 - AP-1 adaptor complex [Evidence ISS]; GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence ISS] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA] [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : adaptor-related protein complex 1 sigma 2 subunit protein_id : NP_081163.2

name	Zrsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949800 GeneID:22184 MGI:103287
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 35 kDa, related sequence 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 isoform 1 protein_id : NP_033479.2

name	Zrsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949775 GeneID:22184 MGI:103287
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 35 kDa, related sequence 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 isoform 2 protein_id : NP_848909.2

name	Car5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506463 CCDS:CCDS30515.1 GeneID:56078 MGI:1926249
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA] [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carbonic anhydrase VB product : carbonic anhydrase 5b, mitochondrial protein_id : NP_062386.1

name	Car5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044449 CCDS:CCDS30515.1 GeneID:56078 MGI:1926249
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA] [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carbonic anhydrase VB product : carbonic anhydrase 5b, mitochondrial protein_id : NP_851832.1

name	Siah1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677949 CCDS:CCDS30516.1 GeneID:20438 MGI:108063
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : seven in absentia 1B protein_id : NP_033199.1

name	Tmem27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181182 CCDS:CCDS30517.1 GeneID:57394 MGI:1926234
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : kidney-specific membrane protein product : transmembrane protein 27 protein_id : NP_065651.1

name	Ace2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582782 CCDS:CCDS30518.1 GeneID:70008 MGI:1917258
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004180 - carboxypeptidase activity [Evidence TAS]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 protein_id : NP_081562.2

name	Bmx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753196 CCDS:CCDS30519.1 GeneID:12169 MGI:1101778
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : TYRO8 protein tyrosine kinase 8 product : BMX non-receptor tyrosine kinase protein_id : NP_033889.1

name	Pir (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317401 CCDS:CCDS30520.1 GeneID:69656 MGI:1916906
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : iron-binding nuclear protein product : pirin protein_id : NP_081429.1

name	Figf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753874 CCDS:CCDS30521.1 GeneID:14205 MGI:108037
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005172 - vascular endothelial growth factor receptor binding [Evidence TAS] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : c-fos induced growth factor protein_id : NP_034346.1

name	LOC100041557 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041557
definition	number : 1 pseudo : _no_value

name	LOC667630 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667630
definition	number : 1 pseudo : _no_value

name	LOC671250 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671250
definition	number : 1 pseudo : _no_value

name	LOC671250 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671250
definition	number : 2 pseudo : _no_value

name	LOC671250 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671250
definition	number : 3 pseudo : _no_value

name	LOC100041607 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041607
definition	number : 1 pseudo : _no_value

name	LOC100040610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040610
definition	number : 1 pseudo : _no_value

name	EG637051 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637051
definition	number : 1 pseudo : _no_value

name	1700045I19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272401 GeneID:74264 MGI:1921514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700045I19 gene pseudo : _no_value transcript_id : XR_035172.1

clone name	MSMg01-478K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444L04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-357I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125B12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-275I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-216I24.b	B6Ng01-216I24.g
ACC	GA033220	GA033221
length	910	944
definition	B6Ng01-216I24.b	B6Ng01-216I24.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	ggaattctttgttcagttctgagccccattttttaatggggttatttgat tttctgaagtccaccttcttgagttctttatatatgttggatattagtcc cctatctgatttaggataggtaaagatcctttcccaatctgttggtggtc tttttgtcttattgactgtgtcttttgccttgcagaaactttggagtttc attaggtcccatttgtcaattctcgatcttacagcacaagccattgctgt tctgttcaggaatttttcccctgtgcccatatcttcaaggcttttcccca ctttctcctctataagtttcagtgtctctggttttatgtgaagttccttg atccacttagatttgaccttagtacaaggagataagtatggatcgattcg cattcttctacacgataacaaccagttgtgccagcaccaattgttgaaaa tgctgtctttcttccactggatggttttagctcccttgtcgaagatcaag tgaccataggtgtgtgggttcatttctgggtcttcaattctattccattg gtctactttgtctgtctctataccagtaccatgcagtttttatcacaatt gctctgtagtaaagcttttaggtctggcatggtgattccgccagaagttc tttttatcctttgagaagactttttgctatcctaggttttttttgttatt ccagacaaatttgcaaattgctcctttccaattcgttgaagaattgagtt ggaaattttgatggggattgcattgaatctgtagattgcttttggcaaga tagccatttttacaatgttgatccttccaatccatgagcatgggaggatc tttccatcttctgagatctttcataatttcttcttcagagatttgaaagt tttatcatac	gaattccaaaaatattccacactttcactttttaaagcattttaattaat gtccttggtaggagacaggaaacaaaagtggcattactaagagaagattt tatggtgtatttaattagaaaatttcactatttaaataaaaaaacagtta atcaaagctctgagagacaggggcactgttaacttgcaacaagcagtggc agcaagtccaaagtaacgacagacacagagccacttgtttgaagtgtgtt gctactaacaagctctctgggcacagattctgtcttaaattaaaggacag ctctactctgtgcacataaaaacaaggccaaggtctcaagtgccttgatg gcaatggccagcagttgggatcaaagaagcaatcacacaaaacactgtac ctaggtttccagccactgtccttgaaaggaattcatagcttccccaccct aaccccctcaaaataattccagttcaccaaatctaaattaatggcagttg atgggtctcagcatagcaaaagtggcctatattggtataataattagttc tttgctgttccttatatatgaagtcatgagattgagttctgaccccaagc tagagaaaacgattggaacatgaaataaacttaagcatagtcatagccat acaagaaaaggccatgtttggattatctgttttctctcctcacccataaa ttcctcctttgagcagtagcaaggcacacatgcaagcaattgtcctctga ctgctttttaccttgctcccccaaagccacatcaaaaaggtacaaattta gatgagaaagccagacctaatgacctggctgcatctagctggaatgagct atgcaattcaaaaacctacaaaagcaaaccctcagttgggtttttcatta agtggttggggtttgtaattgttttaaatcagctttgaaatccc
quality values	Open. Hide. 9 6 39 30 22 54 54 58 58 58 36 45 54 25 13 37 48 62 62 47 49 62 62 62 28 62 45 36 62 62 56 38 32 23 20 20 17 56 32 32 25 56 44 56 47 62 62 62 62 59 62 62 49 62 62 49 62 62 62 62 62 59 43 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 54 59 59 59 59 59 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 59 50 62 59 59 54 48 54 59 59 62 59 59 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 59 59 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 62 56 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 46 51 45 59 51 56 59 51 46 56 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 59 59 62 59 62 62 62 56 62 62 54 47 62 62 62 62 22 35 11 21 11 32 62 56 62 62 62 16 16 16 14 23 31 47 54 24 37 56 42 62 62 62 62 62 62 62 62 62 56 56 56 51 47 56 62 62 62 62 62 44 43 62 56 56 47 37 56 56 62 56 62 56 62 47 46 39 38 47 41 45 47 38 47 62 33 47 31 62 27 42 30 27 23 34 16 10 9 12 14 13 54 42 47 39 41 23 41 48 48 52 39 45 39 28 34 40 40 52 52 54 52 46 47 39 27 34 34 52 52 54 54 48 54 54 52 49 42 46 33 39 39 52 52 42 50 54 52 50 35 19 8 14 12 15 20 49 47 42 46 52 34 20 10 11 34 40 46 50 34 21 35 46 32 30 50 25 16 38 46 36 10 50 44 50 25 39 51 46 49 28 58 23 41 46 24 40 46 26 51 26 50 58 58 51 54 37 29 34 29 32 36 32 35 30 25 30 10 52 37 54 51 54 51 16 37 31 50 32 39 30 25 28 20 9 25 25 23 22 9 9 37 26 13 40 39 50 41 41 26 41 22 39 52 53 23 49 6 20 27 25 41 20 51 50 22 33 46 40 49 39 30 40 33 38 49 39 40 21 28 51 49 33 23 51 25 41 19 19 18 29 22 12 17 16 42 37 51 27 32 33 31 28 16 33 33 34 41 34 32 32 32 26 28 7 45 11 35 32 26 29 51 47 51 42 32 32 31 21 25 53 32 30 21 32 26 24 31 42 45 51 31 14 21 22 24 28 30 21 15 8 20 19 30 12 8 6 5 9 18 18 19 27 30 31 34 33 31 24 20 11 28 28 32 10 12 10 11 30 31 37 31 32 29 11 32 29 34 38 31 37 26 5 10 31 10 38 33 24 19 19 6 12 5 16 18 24 24 25 12 9 11 17 21 15 24 37 22 9 35 18 43 24 31 38 17 8 32 16 27 18 32 29 20 32 31 33 20 10 16 9	Open. Hide. 62 47 31 37 62 62 41 24 62 62 27 22 23 20 21 21 25 11 15 24 39 56 56 56 59 59 34 59 62 62 62 62 59 59 62 49 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 56 38 34 28 43 54 51 59 51 59 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 59 62 62 62 62 54 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 59 62 62 62 62 59 62 62 62 62 59 59 59 59 62 48 54 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 49 47 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 58 58 54 47 58 58 58 58 54 46 58 58 58 58 41 54 54 58 58 58 58 58 54 54 54 54 54 54 58 58 58 58 58 54 58 58 54 58 54 58 54 58 58 58 58 58 45 54 52 52 58 54 54 52 48 58 54 58 58 58 54 54 58 54 49 58 53 58 53 50 54 58 58 46 50 51 46 30 58 53 58 51 51 42 49 48 49 51 58 51 58 58 58 51 49 58 42 53 53 58 39 39 53 53 50 52 53 58 58 51 38 39 50 47 32 58 58 58 39 58 28 58 49 51 50 51 52 53 53 40 48 26 54 58 58 40 58 50 54 53 51 30 39 39 58 58 51 50 36 27 50 37 41 36 16 25 44 30 50 50 50 52 58 52 35 23 49 41 53 39 39 39 51 44 41 40 53 38 34 49 53 33 35 35 44 53 54 39 53 32 52 18 54 39 54 54 54 46 49 54 25 42 34 29 33 39 54 26 29 36 42 37 35 31 36 33 37 44 16 54 54 42 41 34 52 45 37 45 52 42 37 27 54 42 28 42 32 54 31 32 32 33 33 41 47 34 33 51 41 39 41 27 32 28 31 40 39 16 41 39 31 47 40 31 34 34 31 35 24 34 32 40 47 46 20 32 33 33 41 39 41 33 41 51 31 33 31 30 42 30 13 31 33 30 51 51 51 21 31 31 45 45 26 32 26 27 25 51 51 51 24 20 51 42 31 31 31 25 37 31 31 32 38 46 46 46 30 28 31 19 24 38 6 36 23 42 47 31 22 21 21 22 38 43 24 42 47 43 25 28 35 24 31 30 12 28 31 22 28 22 29 25 29 31 36 31 23 17 30 36 31 20 31 34 33 32 32 36 31 33 36 18 25 30 31 31 26 25 32 30 31 32 37 28 27 31 37 26 33 44 47 48 17 31 32 23 25 26 18 44 44 35 28 25 14 41 22 20 44 28 21 33 31 19 6 5 11 47 21 9 44 44 41 31 32 30 32 28 41 36 11 10 29 29 10 7 10 21 33 24 6 26 9 13 6 10 6 16 5 9 7 4 13 32 28 37 22 17 33 11 6 7 25 36 27 11 6 24 5 6 14 12 24

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_159858567_159859516
seq2: B6Ng01-216I24.g_66_1009 (reverse)

seq1  GGGATTTCAAAGCTGATTTAAAAACAAATACAAACCCCAAACCCACTTTA  50
      ||||||||||||||||||| ||||||| ||||||||||||  |||| |||
seq2  GGGATTTCAAAGCTGATTT-AAAACAATTACAAACCCCAA--CCAC-TTA  46

seq1  ATGAAAAACCCAAACTGAGGGTTTGCTTTTGTAGGTTTTTGAATTGCATA  100
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  ATGAAAAACCC-AACTGAGGGTTTGCTTTTGTAGGTTTTTGAATTGCATA  95

seq1  GCTCATTCCAGCTAGATGCAGCCAGGTCATTAGGTCTGGCTTTCTCATCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCATTCCAGCTAGATGCAGCCAGGTCATTAGGTCTGGCTTTCTCATCT  145

seq1  AAATTGGTACCTTTTTGATGTGGCTTTGGGGGAGCAAGGTAAAAAGCAGT  200
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTTGTACCTTTTTGATGTGGCTTTGGGGGAGCAAGGTAAAAAGCAGT  195

seq1  CAGAGGACAATTGCTTTGCATGTGTGCCTTGCTACTGCTCAAAGGAGGAA  250
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  CAGAGGACAATTGC-TTGCATGTGTGCCTTGCTACTGCTCAAAGGAGGAA  244

seq1  TTTATGGGTGAGGAGAGAAAACAGATAATCCAAACATGGCCTTTTCTTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATGGGTGAGGAGAGAAAACAGATAATCCAAACATGGCCTTTTCTTGT  294

seq1  ATGGCTATGACTATGCTTAAGTTTATTTCATGTTCCAATCGTTTTCTCTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCTATGACTATGCTTAAGTTTATTTCATGTTCCAATCGTTTTCTCTA  344

seq1  GCTTGGGGTCAGAACTCAATCTCATGACTTCATATATAAGGAACAGCAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGGGGTCAGAACTCAATCTCATGACTTCATATATAAGGAACAGCAAA  394

seq1  GAACTAATTATTATACCAATATAGGCCACTTTTGCTATGCTGAGACCCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTAATTATTATACCAATATAGGCCACTTTTGCTATGCTGAGACCCAT  444

seq1  CAACTGCCATTAATTTAGATTTGGTGAACTGGAATTATTTTGAGGGGGTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTGCCATTAATTTAGATTTGGTGAACTGGAATTATTTTGAGGGGGTT  494

seq1  AGGGTGGGGAAGCTATGAATTCCTTTCAAGGACAGTGGCTGGAAACCTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGGGGAAGCTATGAATTCCTTTCAAGGACAGTGGCTGGAAACCTAG  544

seq1  GTACAGTGTTTTGTGTGATTGCTTCTTTGATCCCAACTGCTGGCCATTGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACAGTGTTTTGTGTGATTGCTTCTTTGATCCCAACTGCTGGCCATTGC  594

seq1  CATCAAGGCACTTGAGACCTTGGCCTTGTTTTTATGTGCACAGAGTAGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAAGGCACTTGAGACCTTGGCCTTGTTTTTATGTGCACAGAGTAGAG  644

seq1  CTGTCCTTTAATTTAAGACAGAATCTGTGCCCAGAGAGCTTGTTAGTAGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCCTTTAATTTAAGACAGAATCTGTGCCCAGAGAGCTTGTTAGTAGC  694

seq1  AACACACTTCAAACAAGTGGCTCTGTGTCTGTCGTTACTTTGGACTTGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACACTTCAAACAAGTGGCTCTGTGTCTGTCGTTACTTTGGACTTGCT  744

seq1  GCCACTGCTTGTTGCAAGTTAACAGTGCCCCTGTCTCTCAGAGCTTTGAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACTGCTTGTTGCAAGTTAACAGTGCCCCTGTCTCTCAGAGCTTTGAT  794

seq1  TAACTGTTTTTTTATTTAAATAGTGAAATTTTCTAATTAAATACACCATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTGTTTTTTTATTTAAATAGTGAAATTTTCTAATTAAATACACCATA  844

seq1  AAATCTTCTCTTAGTAATGCCACTTTTGTTTCCTGTCTCCTACCAAGGAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTTCTCTTAGTAATGCCACTTTTGTTTCCTGTCTCCTACCAAGGAC  894

seq1  ATTAATTAAAATGCTTTAAAAAGTGAAAGTGTGGAATATTTTTGGAATTC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAATTAAAATGCTTTAAAAAGTGAAAGTGTGGAATATTTTTGGAATTC  944

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information