MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233N22
Chromosome	X (Build37)
Map Location	67,892,619 - 68,034,965
singlet/doublet	doublet
Overlap gene	EG280121, LOC666993
Upstream gene	Aff2, 1700020N15Rik, Ids, 1110012L19Rik, 4930567H17Rik, LOC100040304, LOC628002, LOC628012, BC023829, EG547447, LOC666981, LOC100040409, LOC628053, LOC100040432
Downstream gene	Ppia-psx_466.1, EG628080, G630014P10Rik, LOC667013, Mtm1, Mtmr1, Cd99l2, LOC667017, Hmgb3, LOC100040549, Gpr50
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aff2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14266 MGI:1202294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700020N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ids (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15931 MGI:96417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	1110012L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930567H17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC628002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins pseudo : _no_value

name	LOC628012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	BC023829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC666981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins pseudo : _no_value

name	LOC100040409 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC628053 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG280121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC666993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppia-psx_466.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606531
definition	note : peptidylprolyl isomerase A pseudogene x_466.1 pseudo : _no_value

name	EG628080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628080 MGI:3649029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	G630014P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333639 MGI:3045303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667013 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 217 ESTs, 11 Proteins pseudo : _no_value

name	Mtm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17772 MGI:1099452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53332 MGI:1858271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd99l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Hmgb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Gpr50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14765 MGI:1333877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aff2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351744 GeneID:14266 MGI:1202294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AF4/FMR2 family, member 2 transcript_id : NM_008032.2

name	1700020N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271679 GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700020N15 gene transcript_id : XM_001473869.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781803 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038990.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781805 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038991.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781811 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_010498.2

name	1110012L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803513 GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012L19 gene transcript_id : NM_026787.2

name	4930567H17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368528 GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930567H17 gene transcript_id : NM_001033807.2

name	LOC100040304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271675 GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to syndecan-1 transcript_id : XM_001474469.1

name	LOC628012 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271681 GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : hypothetical LOC628012 transcript_id : XM_001474528.1

name	BC023829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131123 GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023829 transcript_id : NM_001033328.2

name	EG547447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001530 GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG547447 transcript_id : XM_892770.1

name	LOC100040409 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271684 GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to syndecan-1 transcript_id : XM_001474636.1

name	LOC628053 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:125490330 GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC628053 transcript_id : NM_001081476.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001321 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG280121, transcript variant 3 transcript_id : XM_898689.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407488 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG280121, transcript variant 1 transcript_id : XM_207492.5

name	EG628080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407533 GeneID:628080 MGI:3649029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG628080 transcript_id : XM_900336.2

name	G630014P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486842 GeneID:333639 MGI:3045303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA G630014P10 gene transcript_id : NM_001081354.1

name	Mtm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802570 GeneID:17772 MGI:1099452
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked myotubular myopathy gene 1 transcript_id : NM_019926.2

name	Mtmr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57528446 GeneID:53332 MGI:1858271
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 1 transcript_id : NM_016985.2

name	Cd99l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129961 GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd99 antigen-like 2 transcript_id : NM_138309.2

name	Hmgb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892877 GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group box 3 transcript_id : NM_008253.3

name	LOC100040549 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271688 GeneID:100040549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001474894.1

name	Gpr50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754059 GeneID:14765 MGI:1333877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein-coupled receptor 50 transcript_id : NM_010340.1

name	Aff2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679819 CCDS:CCDS30173.1 GeneID:14266 MGI:1202294
definition	GO_process : GO:0007611 - learning and/or memory [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Ox19 homolog; fragile X mental retardation 2 homolog; fragile X mental retardation protein 2 homolog product : AF4/FMR2 family, member 2 protein_id : NP_032058.1

name	1700020N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271680 GeneID:75509 MGI:1922759
definition	codon_start : 1 product : hypothetical protein LOC75509 protein_id : XP_001473919.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781812 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform a protein_id : NP_034628.2

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781804 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034079.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781806 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 3; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034080.1

name	1110012L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312070 CCDS:CCDS30174.1 GeneID:68618 MGI:1915868
definition	codon_start : 1 product : hypothetical protein LOC68618 protein_id : NP_081063.1

name	4930567H17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702147 GeneID:619303 MGI:3588249
definition	codon_start : 1 product : hypothetical protein LOC619303 protein_id : NP_001028979.1

name	LOC100040304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271676 GeneID:100040304
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474519.1

name	LOC628012 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271682 GeneID:628012
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474578.1

name	BC023829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701820 CCDS:CCDS30176.1 GeneID:236848 MGI:2448555
definition	codon_start : 1 note : ee3 product : cDNA sequence BC023829 protein_id : NP_001028500.1

name	EG547447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001531 GeneID:547447 MGI:3643766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897863.1

name	LOC100040409 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271685 GeneID:100040409
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474686.1

name	LOC628053 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:125490331 GeneID:628053
definition	codon_start : 1 product : hypothetical LOC628053 protein_id : NP_001074945.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001322 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 3 protein_id : XP_903782.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086394 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 1 protein_id : XP_207492.3

name	EG628080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407534 GeneID:628080 MGI:3649029
definition	codon_start : 1 product : hypothetical protein protein_id : XP_905429.2

name	G630014P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486843 GeneID:333639 MGI:3045303
definition	codon_start : 1 product : hypothetical protein LOC333639 protein_id : NP_001074823.1

name	Mtm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910456 CCDS:CCDS30177.1 GeneID:17772 MGI:1099452
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0046716 - muscle maintenance [Evidence IMP]; GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myotubularin protein_id : NP_064310.1

name	Mtmr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393794 CCDS:CCDS30178.1 GeneID:53332 MGI:1858271
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004438 - phosphatidylinositol-3-phosphatase activity [Evidence IDA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : myotubularin-related protein 1 protein_id : NP_058681.1

name	Cd99l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489963 CCDS:CCDS30179.1 GeneID:171486 MGI:2177151
definition	codon_start : 1 note : MIC2 like-1; MIC2 (monoclonal Imperial Cancer Research Fund 2)-like 1 product : Cd99 antigen-like 2 protein_id : NP_612182.1

name	Hmgb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680231 CCDS:CCDS30180.1 GeneID:15354 MGI:1098219
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006323 - DNA packaging [Evidence IEA]; GO:0045578 - negative regulation of B cell differentiation [Evidence IDA]; GO:0045638 - negative regulation of myeloid cell differentiation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : high-mobility group protein 4; high mobilty group protein 2A product : high mobility group box 3 protein_id : NP_032279.1

name	LOC100040549 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271689 GeneID:100040549
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474944.1

name	Gpr50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754060 CCDS:CCDS30181.1 GeneID:14765 MGI:1333877
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein-coupled receptor 50 protein_id : NP_034470.1

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 2 pseudo : _no_value

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 1 pseudo : _no_value

name	LOC666993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666993
definition	number : 1 pseudo : _no_value

name	LOC667017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667017
definition	number : 1 pseudo : _no_value

name	LOC628002 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271683 GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035666.1

name	LOC666981 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271686 GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035667.1

name	LOC667013 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271687 GeneID:667013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 217 ESTs, 11 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_031583.1

clone name	MSMg01-273H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-172L20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-099F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428A10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-492C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233N22.b	B6Ng01-233N22.g
ACC	GA045802	GA045803
length	1,127	1,144
definition	B6Ng01-233N22.b	B6Ng01-233N22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(67,892,619 - 67,893,757)	(68,033,819 - 68,034,965)
sequence	gaattccaggctatcagagagatggtacatcttctacaggtaattagtgg ttaaaaatagagtattatatatcagcaactaacttcaaattttctataca tccaaagatgaccttgaactgctcaccctcatgcttccaactccggagtt ctgggattgtaggcctgtgtgacatcaatcctagtttatgtggtggtgaa tattgatcccccaggattttatgtctaatgagttactttttgctgtgaga aaaaccatgaccaaatgaaacttagaggaggaaagagtttctttcagctt ttacttccaagtcacagtccatcattgagggaagttagggcaggaaactg aaggcaagaactatgtaggaatgctgcttgctggctttctttctggctca tgcttagctagctcatctacttaaggatggtgccacccacagtgggctgg atcctcccacataaatcatcaatcaaagcagattttggagaaaccatgaa tcatttatagaatgtgcttctcttagttcctcctataacaacaacaacaa caacttcttcttcttcttcttcttcttcttcttcttcttcttcttcttct tcttcttcttcttcttctctcctcctcctcctcctcctcctcccctcctc ctttcctttttttttcattttttcttttgataggatctcagatcaggctg attttcaggcttgcaatgcagccaaagctggctttgaacagttgtctctc ctgtttccgcttttccagtgttgcatttgtaagtatgtgcccccatactc cacactgaggttgtccttaaggaattatcacctaccagtttgtgtgtata tgaatgggaacaagctcttttggctatgtgaacgatttttgaaagtacat ttaaactctctgatatagttcttgttttccataaatgtgcacgacaaaca ttgtaaatttcagagagaaatatcatcggagaaagatcatagaatccact aaataccctttaaaaatagcctagcttttcttcctatcctgtagacagca tgcattacaatcatgtcatcttttatactgaattgatcattgttcatgac tttggcaaatgggtgcccatatacact	gaattcaggacagtagaaacgcagaagcagaaagtgaaacagagatcaca aaggaatgctgcttatttgctcaatacccctgcttatctactttttgctt atctacttttcttacacagcaaggctcacatactcagggatgaaaaaaaa aaaaacacttgcttctaagctggaccacctacattgattagacaccaaga aaaatgccccaaggtatgtccacaggacattctgatagaggcaatttcta aactgaggttctctcctcacatgtcaagttgacaattgacactaattggc agaagtcattgaactcagtatcattctaagacaaagtacattattggtct tctttcattctccaatgtaccagagcacaatgtccaagaacaaggttgtg atggcactgcaccaatccattcttaattaagtccaagatccaagagagag gaaggctctgtctcaagtcaagccatgaggtcatgctagctggggctgag cactaggatcctagtctttccctactatgccatacagagatttctcccaa ctctgacttttaacaaatgtatcattagtcttgggatagttaatgatctg tttaagaaattagggaccttagatagcactgaggatagaaaataaattag atgaggattggcatactcatcccaagccatctacctctactatgatcaca gtacaactaatgagcatatgtctttgacaaaaagaagatatagaaaacat ggtagtgaatagttgagtgaacatgcatgtactcatatatgtatgcatgt gtgtgcatgtatgtgtgtgcacatatgtgcccaccttcataaaataaaag cttatggtacccaggaaaccagcaccagatttaagttgtacatagattaa tgatgctggcaacttctttaaacttggataagagatttcttgatttcata cagccaaagtatacagacacaatggatgtgagcaaaaagcagtagatgtt ggaagtcagtttcatctgattctgattattttcctgctattaaagttctt tctttgatcttagacagttaaaacttgcactggaacttcaattgtcttgt cttataaacgtacgccatacgttattatttgtacagtctctact
quality values	Open. Hide. 58 26 22 37 58 58 34 23 58 58 58 54 50 62 41 34 62 62 62 54 62 37 24 62 54 62 53 62 54 62 62 46 30 46 24 36 44 28 38 49 62 62 62 59 59 59 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 49 62 62 62 62 62 62 59 59 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 59 62 62 62 62 59 62 62 59 62 54 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 46 62 62 62 62 62 62 52 62 62 54 54 62 62 62 62 62 58 58 58 54 58 58 46 54 54 58 54 58 49 54 58 58 58 58 58 58 58 58 58 58 54 54 58 58 54 58 58 58 58 58 54 58 54 58 58 49 41 58 58 52 58 38 54 58 58 50 58 58 54 58 58 58 58 58 54 58 58 58 54 58 58 47 58 58 47 58 58 50 58 54 48 58 49 58 58 54 58 58 51 58 58 58 58 58 49 58 58 54 47 58 58 58 49 58 44 58 49 58 58 50 58 58 49 54 58 54 58 58 58 58 58 51 58 58 51 58 58 58 58 58 58 58 51 49 41 15 18 16 14 15 16 34 40 39 58 50 58 58 50 58 58 46 46 54 54 51 42 53 58 58 49 50 44 46 58 49 20 29 58 58 58 39 32 29 25 54 54 54 54 35 53 34 54 54 51 49 53 34 52 35 54 38 27 47 40 53 39 32 50 40 42 52 25 54 35 53 52 28 15 54 54 51 37 33 11 26 24 54 19 34 34 37 46 42 52 34 39 32 51 23 11 54 30 31 37 45 42 54 32 54 54 41 32 41 34 32 31 32 40 40 47 35 53 37 52 45 40 53 31 53 32 52 39 32 53 35 40 40 53 53 45 33 41 35 40 37 53 35 39 45 30 31 31 51 27 29 25 36 38 25 30 39 31 33 30 31 31 51 51 51 45 24 31 26 19 15 30 31 29 42 34 42 33 46 34 20 25 21 28 30 21 33 30 28 31 21 33 19 43 37 42 24 42 30 31 33 31 21 32 31 31 31 38 31 24 42 46 14 30 29 30 25 31 22 31 31 31 32 27 31 32 27 23 38 7 38 30 24 22 33 25 37 42 42 31 39 37 16 25 24 23 31 24 24 32 32 31 24 32 29 7 32 18 44 48 48 35 22 31 48 25 17 20 31 27 25 15 44 31 26 44 24 31 24 19 16 9 17 21 27 12 18 24 31 20 21 20 22 18 11 35 23 38 44 33 16 23 32 9 24 37 32 21 32 24 23 32 8 13 11 29 31 21 36 24 12 19 22 21 22 14 11 32 14 25 48 32 27 24 4 11 11 34 14 31 39 34 10 17 17 23 21 27 25 18 17 3 5 21 40 17 10 27 17 28 26 19 28 10 25 11 6 21 10 23 24 16 11 40 23 22 9 13 40 28 16 31 21 18 32 29 40 15 18 6 34 7 13 10 14 21 28 26 38 38 25 23 9 17 13 21 4 4 11 14 9 7 23 16 22 5 16 5 6 12 15 20 16 9 13 11 11 14 13 18 5 12 2 11 11 5 8 4 7 23 13 11 11 29 17 4 11 7 4 21 4 4 3 3 4 13 15 5 4 2 3 23 16 7 4 7 22 5 5 11 8 8 15 22 10 10 18 3 14 12 9 5 10 18 13 4 5 6 11 6 4 6 5 9 13 10 6 4 14	Open. Hide. 62 38 56 47 62 47 41 62 62 47 51 51 56 32 32 28 37 38 38 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 59 59 59 56 62 59 59 54 54 62 62 51 59 62 59 62 59 56 59 51 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 59 62 62 54 59 59 62 59 62 59 62 59 59 59 50 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 59 56 62 56 62 62 62 62 59 56 59 62 62 62 59 59 59 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 56 56 56 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 38 49 43 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 45 62 62 49 62 62 62 54 54 52 58 48 58 54 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 58 58 54 54 58 58 58 52 58 58 58 58 54 54 58 58 58 58 58 58 54 54 52 54 42 58 48 45 54 52 49 58 37 48 58 58 54 54 54 51 58 58 58 58 54 58 58 58 51 51 50 50 54 58 58 45 50 51 58 50 58 41 58 46 45 40 58 58 51 53 58 49 30 35 58 58 58 54 54 58 41 50 58 58 58 50 51 50 50 50 58 51 51 58 50 50 51 53 52 58 51 53 52 51 53 52 50 58 54 49 49 32 53 50 54 49 42 53 40 58 44 41 51 51 58 50 58 40 50 58 35 58 58 50 49 52 53 53 58 49 38 40 44 42 58 51 50 53 49 52 51 54 45 47 50 58 51 49 54 33 37 44 50 54 54 54 53 53 39 51 41 54 53 45 32 49 41 49 51 19 51 37 28 29 54 49 37 37 53 34 41 53 53 32 53 42 54 41 24 52 45 45 53 31 53 45 37 35 53 49 41 53 45 35 45 37 37 40 41 33 37 37 34 53 34 53 37 31 45 40 35 51 41 35 51 40 47 37 34 52 34 45 32 45 52 32 51 45 49 42 32 33 32 37 53 53 53 53 34 53 53 32 41 30 36 52 40 32 47 51 49 31 32 31 32 45 53 31 53 35 31 41 31 42 43 43 39 41 38 30 46 22 34 33 26 42 31 31 43 31 31 23 26 41 23 26 42 36 43 29 31 31 42 30 27 51 37 32 31 31 31 21 30 42 31 42 32 43 38 31 31 31 30 46 31 34 32 42 31 36 23 31 25 31 30 28 31 22 42 31 31 32 30 31 31 47 42 28 26 31 25 37 29 25 36 36 48 48 19 25 31 48 48 36 27 34 37 24 28 29 32 36 26 27 31 48 31 26 28 27 23 46 27 23 37 23 24 32 23 31 31 22 17 15 20 48 31 23 30 18 32 37 33 18 19 25 20 31 26 21 11 9 38 11 25 19 32 32 27 38 34 21 20 19 26 25 18 25 19 9 21 8 43 8 15 43 20 19 14 19 12 18 30 21 34 32 18 33 10 21 19 48 32 29 14 14 33 32 24 47 26 27 17 15 12 9 19 9 13 17 24 39 22 23 23 43 8 20 31 9 7 14 14 6 27 10 14 20 24 21 16 20 28 21 20 25 13 29 13 34 47 34 6 16 11 27 27 28 12 6 4 6 8 3 6 18 11 21 15 23 11 28 20 8 22 28 20 28 16 27 28 10 19 27 17 16 24 7 15 4 5 6 6 4 28 8 12 8 12 7 21 9 5 4 7 23 5 23 14 6 15 7 13 7 18 15 23 15 30 19 18 21 13 12 6 11 23 9 16 6 5 10 4 4 19 30 30 22 14 6 3 1 3 4 12 16 10 12 2 3 18 5 7 24 4 5 21 7 6 7 7 6 5 9 7 7 7 9 6 20 10 15 3 2 3 1 3 4 5 8 7 3 2 2 1 5 2 3 7 5 11 6 7 13 2 4 7 5 21 6 13 9 4 9 9 9 8 14 9

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_67892619_67893757
seq2: B6Ng01-233N22.b_46_1172

seq1  GAATTCCAGGCTATCAGAGAGATGGTACATCTTCTACAGGTAATTAGTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGCTATCAGAGAGATGGTACATCTTCTACAGGTAATTAGTGG  50

seq1  TTAAAAATAGAGTATTATATATCAGCAACTAACTTCAAATTTTCTATACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAATAGAGTATTATATATCAGCAACTAACTTCAAATTTTCTATACA  100

seq1  TCCAAAGATGACCTTGAACTGCTCACCCTCATGCTTCCAACTCCGGAGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAAGATGACCTTGAACTGCTCACCCTCATGCTTCCAACTCCGGAGTT  150

seq1  CTGGGATTGTAGGCCTGTGTGACATCAATCCTAGTTTATGTGGTGGTGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGATTGTAGGCCTGTGTGACATCAATCCTAGTTTATGTGGTGGTGAA  200

seq1  TATTGATCCCCCAGGATTTTATGTCTAATGAGTTACTTTTTGCTGTGAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGATCCCCCAGGATTTTATGTCTAATGAGTTACTTTTTGCTGTGAGA  250

seq1  AAAACCATGACCAAATGAAACTTAGAGGAGGAAAGAGTTTCTTTCAGCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACCATGACCAAATGAAACTTAGAGGAGGAAAGAGTTTCTTTCAGCTT  300

seq1  TTACTTCCAAGTCACAGTCCATCATTGAGGGAAGTTAGGGCAGGAAACTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTTCCAAGTCACAGTCCATCATTGAGGGAAGTTAGGGCAGGAAACTG  350

seq1  AAGGCAAGAACTATGTAGGAATGCTGCTTGCTGGCTTTCTTTCTGGCTCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCAAGAACTATGTAGGAATGCTGCTTGCTGGCTTTCTTTCTGGCTCA  400

seq1  TGCTTAGCTAGCTCATCTACTTAAGGATGGTGCCACCCACAGTGGGCTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTAGCTAGCTCATCTACTTAAGGATGGTGCCACCCACAGTGGGCTGG  450

seq1  ATCCTCCCACATAAATCATCAATCAAAGCAGATTTTGGAGAAACCATGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTCCCACATAAATCATCAATCAAAGCAGATTTTGGAGAAACCATGAA  500

seq1  TCATTTATAGAATGTGCTTCTCTTAGTTCCTCCTATAACAACAACAACAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTATAGAATGTGCTTCTCTTAGTTCCTCCTATAACAACAACAACAA  550

seq1  CAACTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT  600

seq1  TCTTCTTCTTCTTCTTCTCTCCTCCTCCTCCTCCTCCTCCTCCCCTCCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCTTCTTCTTCTTCTCTCCTCCTCCTCCTCCTCCTCCTCCCCTCCTC  650

seq1  CTTTCCTTTTTTTTTCATTTTTTCTTTTGATAGGATCTCAGATCAGGCTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCTTTTTTTTTCATTTTTTCTTTTGATAGGATCTCAGATCAGGCTG  700

seq1  ATTTTCAGGCTTGCAATGCAGCCAAAGCTGGCTTTGAACAGTTGTCTCTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCAGGCTTGCAATGCAGCCAAAGCTGGCTTTGAACAGTTGTCTCTC  750

seq1  CTGTTTCCGCTTTTCCAGTGTTGCATTTGTAAGTATGTGCCCCCATACTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTTCCGCTTTTCCAGTGTTGCATTTGTAAGTATGTGCCCCCATACTC  800

seq1  CACACTGAGGTTGTCCTTAAGGAATTATCACCTACCAGTTTGTGTGTATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACTGAGGTTGTCCTTAAGGAATTATCACCTACCAGTTTGTGTGTATA  850

seq1  TGAAT-GGAACAAGCTC-TTTGGCTATGTGAACGATTTTTGAAAGTACAT  898
      ||||| ||||||||||| ||||||||||||||||||||||||||||||||
seq2  TGAATGGGAACAAGCTCTTTTGGCTATGTGAACGATTTTTGAAAGTACAT  900

seq1  TTAAACTCTTCTGATATAGTTCTTGTTTTCCATAAAATGTGCACCGACAA  948
      |||||||| |||||||||||||||||||||||| ||||||||| |||| |
seq2  TTAAACTC-TCTGATATAGTTCTTGTTTTCCAT-AAATGTGCA-CGAC-A  946

seq1  AACATTGTAAATTTCAAGAGAGAAAATAATCATCGGGAGAAAGAATCATA  998
      ||||||||||||||| |||||||||   |||||| |||||||| ||||||
seq2  AACATTGTAAATTTC-AGAGAGAAA--TATCATC-GGAGAAAG-ATCATA  991

seq1  GAAAATCCACTAAATACCCTTTAAAAATAGGCCTAGCTTTTCTTCCTATC  1048
      |  |||||||||||||||||||||||||| ||||||||||||||||||||
seq2  G--AATCCACTAAATACCCTTTAAAAATA-GCCTAGCTTTTCTTCCTATC  1038

seq1  CTGTAAGACAGCATGCCATTACAAATCCATGTCATCTTTTATACTGTATT  1098
      |||| |||||||||| ||||||||   ||||||||||||||||||| |||
seq2  CTGT-AGACAGCATG-CATTACAA--TCATGTCATCTTTTATACTGAATT  1084

seq1  GATTTCATTG-TCATGACTTTGGAAATAGTGT---CATATACATT  1139
      ||  |||||| |||||||||||| ||  | ||   |||||||| |
seq2  GA--TCATTGTTCATGACTTTGGCAAATGGGTGCCCATATACACT  1127

seq1: chrX_68033819_68034965
seq2: B6Ng01-233N22.g_66_1209 (reverse)

seq1  AGTAGAGACTGTACAAATAATAACCCTTATTGGCTTCCTTTTAT-AGACA  49
      |||||||||||||||||||||||  | || |||| | | ||||| |||||
seq2  AGTAGAGACTGTACAAATAATAA--CGTA-TGGCGTACGTTTATAAGACA  47

seq1  AGACAA-TGGAGGTCCAGTG-AAGTTTTTACTGTCTAAGATCAAAG-AAG  96
      |||||| || || ||||||| ||||||| ||||||||||||||||| |||
seq2  AGACAATTGAAGTTCCAGTGCAAGTTTTAACTGTCTAAGATCAAAGAAAG  97

seq1  AAC-TTAATAGCAGAAATAAAATTCAGAATCAGATGAAACTGACTTCCAA  145
      ||| |||||||||| || || | |||||||||||||||||||||||||||
seq2  AACTTTAATAGCAGGAA-AATAATCAGAATCAGATGAAACTGACTTCCAA  146

seq1  CCATTCCTACTGCCTTTTGCTCACATCCATTGTGTCTGTATTACTTTGGC  195
       |||  ||||||| |||||||||||||||||||||||||| |||||||||
seq2  -CAT--CTACTGCTTTTTGCTCACATCCATTGTGTCTGTA-TACTTTGGC  192

seq1  TTGTTATGAAATCAAGAAATCTCTTATCCAAGTTTAA--GAGTTGCCAGC  243
      |   |||||||||||||||||||||||||||||||||   ||||||||||
seq2  T--GTATGAAATCAAGAAATCTCTTATCCAAGTTTAAAGAAGTTGCCAGC  240

seq1  ATCATTAATCTATGTACAACTTAAATCTGGTGCTGGTTTCCTGGGTACCA  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATTAATCTATGTACAACTTAAATCTGGTGCTGGTTTCCTGGGTACCA  290

seq1  TAAGCTTTTATTTTATGAAGGTGGGCACATATGTGCACACACATACATGC  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCTTTTATTTTATGAAGGTGGGCACATATGTGCACACACATACATGC  340

seq1  ACACACATGCATACATATATGAGTACATGCATGTTCACTCAACTATTCAC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACATGCATACATATATGAGTACATGCATGTTCACTCAACTATTCAC  390

seq1  TACCATGTTTTCTATATCTTCTTTTTGTCAAAGACATATGCTCATTAGTT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCATGTTTTCTATATCTTCTTTTTGTCAAAGACATATGCTCATTAGTT  440

seq1  GTACTGTGATCATAGTAGAGGTAGATGGCTTGGGATGAGTATGCCAATCC  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTGTGATCATAGTAGAGGTAGATGGCTTGGGATGAGTATGCCAATCC  490

seq1  TCATCTAATTTATTTTCTATCCTCAGTGCTATCTAAGGTCCCTAATTTCT  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCTAATTTATTTTCTATCCTCAGTGCTATCTAAGGTCCCTAATTTCT  540

seq1  TAAACAGATCATTAACTATCCCAAGACTAATGATACATTTGTTAAAAGTC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACAGATCATTAACTATCCCAAGACTAATGATACATTTGTTAAAAGTC  590

seq1  AGAGTTGGGAGAAATCTCTGTATGGCATAGTAGGGAAAGACTAGGATCCT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTTGGGAGAAATCTCTGTATGGCATAGTAGGGAAAGACTAGGATCCT  640

seq1  AGTGCTCAGCCCCAGCTAGCATGACCTCATGGCTTGACTTGAGACAGAGC  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTCAGCCCCAGCTAGCATGACCTCATGGCTTGACTTGAGACAGAGC  690

seq1  CTTCCTCTCTCTTGGATCTTGGACTTAATTAAGAATGGATTGGTGCAGTG  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTCTCTCTTGGATCTTGGACTTAATTAAGAATGGATTGGTGCAGTG  740

seq1  CCATCACAACCTTGTTCTTGGACATTGTGCTCTGGTACATTGGAGAATGA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCACAACCTTGTTCTTGGACATTGTGCTCTGGTACATTGGAGAATGA  790

seq1  AAGAAGACCAATAATGTACTTTGTCTTAGAATGATACTGAGTTCAATGAC  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAGACCAATAATGTACTTTGTCTTAGAATGATACTGAGTTCAATGAC  840

seq1  TTCTGCCAATTAGTGTCAATTGTCAACTTGACATGTGAGGAGAGAACCTC  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCCAATTAGTGTCAATTGTCAACTTGACATGTGAGGAGAGAACCTC  890

seq1  AGTTTAGAAATTGCCTCTATCAGAATGTCCTGTGGACATACCTTGGGGCA  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTAGAAATTGCCTCTATCAGAATGTCCTGTGGACATACCTTGGGGCA  940

seq1  TTTTTCTTGGTGTCTAATCAATGTAGGTGGTCCAGCTTAGAAGCAAGTGT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTCTTGGTGTCTAATCAATGTAGGTGGTCCAGCTTAGAAGCAAGTGT  990

seq1  TTTTTTTTTTTTCATCCCTGAGTATGTGAGCCTTGCTGTGTAAGAAAAGT  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTTTTTCATCCCTGAGTATGTGAGCCTTGCTGTGTAAGAAAAGT  1040

seq1  AGATAAGCAAAAAGTAGATAAGCAGGGGTATTGAGCAAATAAGCAGCATT  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAAGCAAAAAGTAGATAAGCAGGGGTATTGAGCAAATAAGCAGCATT  1090

seq1  CCTTTGTGATCTCTGTTTCACTTTCTGCTTCTGCGTTTCTACTGTCCTGA  1143
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTGTGATCTCTGTTTCACTTTCTGCTTCTGCGTTTCTACTGTCCTGA  1140

seq1  ATTC  1147
      ||||
seq2  ATTC  1144

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information