MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-240B17
Chromosome	X (Build37)
Map Location	144,081,976 - 144,218,441
singlet/doublet	doublet
Overlap gene	LOC100039462, LOC666789, LOC434863
Upstream gene	EG245663, Htr2c, Il13ra2, V1rb10, Lrch2
Downstream gene	EG623995, EG624023, LOC666184, LOC100039511, LOC666812, LOC100039519, LOC434864, EG624096, LOC100039545, LOC666837, LOC100039553, LOC100034729, LOC666861, EG666864, LOC434866
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG245663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245663 MGI:3646769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Htr2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15560 MGI:96281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il13ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16165 MGI:1277954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113867 MGI:2148521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210297 MGI:2147870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC666789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC434863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 9 Proteins

name	EG623995 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623995 MGI:3642951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG624023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 15 ESTs, 4 Proteins

name	LOC100039511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC666812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624096 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624096 MGI:3643280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins pseudo : _no_value

name	LOC666837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666837
definition	note : lysyl-tRNA synthetase pseudogene pseudo : _no_value

name	LOC100039553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100034729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666864 MGI:3648921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 8 Proteins

name	Htr2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373665 GeneID:15560 MGI:96281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-hydroxytryptamine (serotonin) receptor 2C transcript_id : NM_008312.3

name	Il13ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345552 GeneID:16165 MGI:1277954
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 13 receptor, alpha 2 transcript_id : NM_008356.2

name	V1rb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118200340 GeneID:113867 MGI:2148521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B10 transcript_id : NM_053240.2

name	Lrch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487174 GeneID:210297 MGI:2147870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeats and calponin homology (CH) domain containing 2 transcript_id : NM_001081173.1

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408343 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 17 ESTs, 5 Proteins product : ovary testis transcribed-like, transcript variant 1 transcript_id : XM_486785.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272432 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 1 Protein product : ovary testis transcribed-like, transcript variant 3 transcript_id : XM_897719.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272434 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : ovary testis transcribed-like transcript_id : XM_001473108.1

name	EG624023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272425 GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624023 transcript_id : XM_888549.3

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408346 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 4 transcript_id : XM_982169.1

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408350 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 2 transcript_id : XM_982089.1

name	LOC434864 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:126032330 GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001081648.1

name	LOC100034729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:131887312 GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001082966.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272441 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_001487784.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272443 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 3 transcript_id : XM_001487786.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272445 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_001487787.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272447 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 2 transcript_id : XM_001487785.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272451 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 5 transcript_id : XM_001487788.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272449 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 6 transcript_id : XM_001487789.1

name	Htr2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542977 CCDS:CCDS30459.1 GeneID:15560 MGI:96281
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004993 - serotonin receptor activity [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0048016 - inositol phosphate-mediated signaling [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 5-HT2C receptor; snoRNA MBI-36 product : 5-hydroxytryptamine (serotonin) receptor 2C protein_id : NP_032338.2

name	Il13ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680405 CCDS:CCDS30460.1 GeneID:16165 MGI:1277954
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 product : interleukin 13 receptor, alpha 2 protein_id : NP_032382.1

name	V1rb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118200341 GeneID:113867 MGI:2148521
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B10 protein_id : NP_444470.2

name	Lrch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487175 GeneID:210297 MGI:2147870
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine-rich repeats and calponin homology (CH) domain containing 2 protein_id : NP_001074642.1

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772467 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 1 protein_id : XP_486785.1

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272433 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 3 protein_id : XP_902812.3

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272435 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 protein_id : XP_001473158.1

name	EG624023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272426 GeneID:624023 MGI:3644694
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893642.3

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408347 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 4 protein_id : XP_987263.1

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408351 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 2 protein_id : XP_987183.1

name	LOC434864 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:126032331 GeneID:434864
definition	codon_start : 1 product : hypothetical protein LOC434864 protein_id : NP_001075117.1

name	LOC100034729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:131887313 GeneID:100034729
definition	codon_start : 1 product : hypothetical protein LOC100034729 protein_id : NP_001076435.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272442 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001487834.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272446 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001487837.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272444 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001487836.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272448 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001487835.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272452 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_001487838.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272450 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 6 protein_id : XP_001487839.1

name	EG245663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:245663
definition	number : 1 pseudo : _no_value

name	EG245663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:245663
definition	number : 2 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 1 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 2 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 3 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 4 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 5 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 1 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 2 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 3 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 4 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 5 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 7 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 2 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 2 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 3 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 4 pseudo : _no_value

name	LOC666812 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666812
definition	number : 1 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 2 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 1 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 2 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 1 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 2 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 1 pseudo : _no_value

name	LOC666861 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666861
definition	number : 1 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 2 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 1 pseudo : _no_value

name	LOC100039545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272427 GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins product : similar to Ott protein pseudo : _no_value transcript_id : XR_031018.1

clone name	MSMg01-124D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159E17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-350H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346B20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-240B17.b	B6Ng01-240B17.g
ACC	GA050360	GA050361
length	979	1,128
definition	B6Ng01-240B17.b	B6Ng01-240B17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(144,081,976 - 144,082,967)	(144,217,297 - 144,218,441)
sequence	gaattcaccctttctggttcctgattactgcaaagctgtaaaaattaaat atgttatactgatataagggtagatatgtagataaatgagttagacagaa tcgagtctagaaatgtaccatcacgtttatgatcaattgcatttttggcc agtatgaagatagcaatgggaaaacaagtctcaataaatgcttctggaat ttttttttaaaaatatgccatttatgtttaaaattatcattaagatatgt ttaatttttatcgtgattttgttgattcttctttacttttttttagatta ttgtttgttatttatttaatctttactggtattggggctttgcagtttat ctgtgttggacttgaaggattgcttcatggttctctgttcacacaatcct ccaatgaaacttattcttcttgtgctttcatgactaaaactgtcatactt tgcacatgtgtcttgaaatatcattaatacttaggaaataataaaggata tctctgttggatattgcaatgatggttaatactcactcacttttagaact ttaaagatgatgttctgtgcttttctagttataaggggttccagttagag atttcattttactgtgttgtttctggcttggtgtgtaactattttgtctc actgcccttaagctcctattctttccttgattgtatgtttgaaattttga gtatactatacaatggaaagttttgtctatatagaatgctaaatatctct tgacatttgtattcagttgtcaggccctggccaggaatcatgggaccttt ctaatactggtgagttgactggacacagactgcttagttacagatgttgc ttgtaaatatttgctttagtgaccccccaccatagattgtaccaatgtcc accttgtttacatgcacatctaatatgatccttcttgggaaaggagtagt gtttgccactttggagagagtaaaatcaa	gaattccacacccctaagccccttaccccttgaaaaccccgagcttttga gacttgtggacaacaacctttatctacagtgtgggttttcatgttggtcc agaactctgtaattaaactaccttgtctaattacatcaagatggtccttc gtgattttttggatgcatgctgaatggggaattgagtgagggtttcccca ctaggttctatcaggatatgactcaagggttcctaaaggagtatagaatg cagactatggttttataattggaaaggataattaagaccaaatcttgaag gatttttaaacttaaatgtacttcccattcaaattggaaggaaattatac atttgtagtacatgttttatctacatttctgatatattcctgtctggtcc tgaaattgtactgtagctgaagagtccatgtaaattactcttatcttctt gacctagccttattacatttgattacctacacatatttgaggatattctt aggcttcaagtccattttcctgagcatcaaactcagattctcatgcttac aagcatacactatgtcccagaactcagcctagccagcagtcatttaatgt tccagtggattacatgagcctggtattgaagttttaaaaaacagtttgtc tattttgaagaatactccaggtaggactgtgtatatgcaaaatcccagca ctgtaaaaagcagaataatggggcatttcctgtcatcctcagccacaatg ggtgtctccagccagcagctttaaaggaaacactttcctaaaaaccaatc caaacaaatgaaattatcacatccctgaatgagcattacctgggcagatt atatctacaatttcatgtctaaaactgcagaagcagaaggattgcattgg aaattcagctcagtgaatactggattttaggacaggcttttaactcaaag tattgtttgaagacaggttgctccttcactctgtagcttcatataaaaaa ttagagtaaataaacgagcatgacacacaaacacataacatgcagcacat tcactgaaggtcagaaatgtataggttaagtgtttcttttgctcaactcc tcatgtatcatgaaagatgcctaattac
quality values	Open. Hide. 58 33 32 31 62 31 27 54 62 62 62 62 62 62 54 62 49 62 62 62 49 62 62 47 47 47 62 59 62 62 59 59 59 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 62 62 56 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 59 56 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 37 62 62 62 56 62 62 62 56 56 56 56 56 56 56 56 56 56 56 56 62 62 62 62 56 56 56 56 56 62 62 62 62 62 62 62 54 54 56 56 62 56 62 62 62 62 56 56 56 52 52 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 52 52 54 58 58 58 58 58 58 54 58 58 58 58 58 58 49 58 54 46 58 58 58 58 54 58 58 58 58 58 58 58 52 58 54 54 52 52 43 52 54 58 58 49 58 58 52 54 54 54 54 52 39 47 48 41 54 54 54 52 47 49 51 58 58 54 40 51 50 47 52 52 54 58 58 54 51 51 35 58 45 41 54 51 58 52 58 51 53 51 48 49 51 58 58 50 58 49 50 58 54 50 51 46 58 42 58 58 49 49 48 42 42 46 46 58 48 43 50 58 49 37 30 58 58 40 53 49 58 44 50 40 44 44 54 52 58 50 51 51 50 58 42 38 53 58 54 28 58 50 58 51 50 58 49 58 50 54 51 40 49 54 49 54 54 54 54 52 53 53 53 40 44 54 51 22 23 22 50 38 29 41 32 38 44 33 35 35 39 39 47 35 47 54 49 31 42 34 51 52 37 32 53 53 33 40 45 53 37 36 33 37 45 54 38 42 54 54 51 40 47 24 52 31 52 27 39 37 32 52 36 42 31 52 32 42 37 53 53 53 35 32 51 52 45 52 31 31 40 39 40 34 41 33 33 53 53 31 52 26 35 31 53 45 37 31 32 31 42 35 38 31 42 30 31 28 41 51 51 33 28 31 31 43 32 30 31 31 42 42 30 35 34 15 10 5 23 9 31 36 19 20 25 25 31 28 24 22 29 22 31 31 31 47 30 27 12 22 34 48 31 30 34 25 33 31 31 29 31 24 31 17 27 39 24 33 22 27 31 25 30 18 19 18 17 19 29 16 17 25 32 32 31 21 19 37 9 7 7 25 21 21 26 31 30 31 31 20 26 31 32 27 25 28 26 33 48 17 31 20 33 48 26 32 26 32 44 30 34 22 32 26 31 22 24 28 22 28 30 33 16 21 22 44 14 6 32 18 20 31 17 23 23 29 15 25 21 30 23 29 14 23 8 25 11 12 24 18 37 14 20 23 14 32 32 31 19 21 17 34 27 32 33 25 20 32 31 22 32 27 10 25 15 7 8 27 21 13 31 20 7 34 13 7 5 13 5 5 3 5 11 12 16 34 20 18 8 5 6 10 14 30 15 9 9 25 5 20 34 27 10 27 28 40 21 18 5 6 19 12	Open. Hide. 62 47 56 47 62 62 37 26 62 51 62 62 62 62 47 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 59 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 49 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 56 56 56 56 56 62 56 62 56 62 62 62 62 62 62 62 56 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 52 52 35 47 62 52 52 62 54 54 54 54 52 62 62 62 62 49 62 62 54 62 52 54 62 62 54 62 62 62 62 62 62 58 58 58 58 58 54 51 54 45 44 54 54 54 52 42 54 52 52 49 51 47 58 52 48 40 39 52 54 58 54 54 54 46 47 52 58 40 54 54 58 54 52 52 52 52 54 54 58 54 54 45 58 54 58 52 52 52 52 52 52 49 52 54 49 52 52 52 52 54 52 52 42 48 48 53 58 51 50 47 41 47 53 39 58 41 48 52 52 45 27 35 47 50 52 37 47 31 47 43 44 50 40 41 50 50 54 54 51 46 58 51 58 50 42 42 37 28 43 50 58 58 28 30 49 48 50 52 51 58 51 37 42 48 50 51 58 53 53 53 58 49 58 58 53 53 58 58 48 50 58 58 53 53 50 44 43 50 51 58 43 51 51 40 49 35 51 58 58 51 50 58 51 35 58 50 42 50 27 50 40 20 28 30 58 53 41 34 50 30 21 42 49 52 54 41 52 53 53 51 50 44 21 52 54 35 49 40 34 39 32 32 44 34 38 40 51 42 53 54 54 50 51 37 40 52 24 54 16 30 35 40 41 49 14 22 39 30 31 51 46 47 35 36 35 54 37 37 32 32 32 35 42 34 37 39 37 27 22 42 35 37 35 44 54 51 32 51 35 32 40 27 40 21 41 33 38 26 32 34 6 8 12 36 51 31 21 49 32 32 35 27 32 29 23 27 29 20 37 21 21 32 31 31 51 27 29 31 20 25 10 33 21 9 18 21 35 30 36 30 45 32 31 45 42 51 31 31 51 30 31 31 31 30 21 30 34 29 15 23 30 46 29 34 36 42 17 22 23 30 41 19 9 8 25 25 46 6 29 38 26 33 17 31 22 17 22 31 31 36 28 29 15 16 33 47 31 31 20 31 39 31 30 32 35 46 46 36 31 30 32 29 32 25 44 31 23 31 30 33 29 17 10 11 27 27 27 31 26 19 32 22 8 25 14 46 6 31 31 22 5 5 9 24 29 31 19 21 25 22 20 31 31 31 31 29 24 17 21 48 48 21 19 21 23 33 16 13 13 37 21 30 44 44 29 19 31 9 6 6 16 34 18 32 32 34 26 16 31 12 37 19 16 20 20 18 21 10 8 13 14 19 10 23 25 5 4 6 16 19 21 17 13 21 27 28 29 16 25 27 31 17 26 21 11 33 17 24 6 47 38 38 31 19 13 18 9 3 3 13 8 10 40 9 24 7 28 17 14 8 27 10 20 20 6 7 27 8 5 5 5 12 5 28 14 20 5 28 9 18 9 5 5 5 3 10 20 19 24 12 5 6 15 8 22 11 15 6 16 6 12 8 3 7 8 16 10 4 17 13 23 11 21 8 10 4 4 12 14 4 8 12 14 11 10 19 10 20 23 16 9 25 30 13 14 11 11 16 5 12 2 3 4 7 10 10 8 5 11 7 6 7 8 3 2 3 9 19 7 5 22 7 18 5 6 6 12 14 2 4 7 8

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_144081976_144082967
seq2: B6Ng01-240B17.b_44_1022

seq1  GAATTCACCCTTTCTGGTTCCTGATTACTGCAAAGCTGTAAAAATTAAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACCCTTTCTGGTTCCTGATTACTGCAAAGCTGTAAAAATTAAAT  50

seq1  ATGTTATACTGATATAAGGGTAGATATGTAGATAAATGAGTTAGACAGAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTATACTGATATAAGGGTAGATATGTAGATAAATGAGTTAGACAGAA  100

seq1  TCGAGTCTAGAAATGTACCATCACGTTTATGATCAATTGCATTTTTGGCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGAGTCTAGAAATGTACCATCACGTTTATGATCAATTGCATTTTTGGCC  150

seq1  AGTATGAAGATAGCAATGGGAAAACAAGTCTCAATAAATGCTTCTGGAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATGAAGATAGCAATGGGAAAACAAGTCTCAATAAATGCTTCTGGAAT  200

seq1  TTTTTTTTAAAAATATGCCATTTATGTTTAAAATTATCATTAAGATATGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTAAAAATATGCCATTTATGTTTAAAATTATCATTAAGATATGT  250

seq1  TTAATTTTTATCGTGATTTTGTTGATTCTTCTTTACTTTTTTTTAGATTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATTTTTATCGTGATTTTGTTGATTCTTCTTTACTTTTTTTTAGATTA  300

seq1  TTGTTTGTTATTTATTTAATCTTTACTGGTATTGGGGCTTTGCAGTTTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTGTTATTTATTTAATCTTTACTGGTATTGGGGCTTTGCAGTTTAT  350

seq1  CTGTGTTGGACTTGAAGGATTGCTTCATGGTTCTCTGTTCACACAATCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGTTGGACTTGAAGGATTGCTTCATGGTTCTCTGTTCACACAATCCT  400

seq1  CCAATGAAACTTATTCTTCTTGTGCTTTCATGACTAAAACTGTCATACTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATGAAACTTATTCTTCTTGTGCTTTCATGACTAAAACTGTCATACTT  450

seq1  TGCACATGTGTCTTGAAATATCATTAATACTTAGGAAATAATAAAGGATA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACATGTGTCTTGAAATATCATTAATACTTAGGAAATAATAAAGGATA  500

seq1  TCTCTGTTGGATATTGCAATGATGGTTAATACTCACTCACTTTTAGAACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGTTGGATATTGCAATGATGGTTAATACTCACTCACTTTTAGAACT  550

seq1  TTAAAGATGATGTTCTGTGCTTTTCTAGTTATAAGGGGTTCCAGTTAGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGATGATGTTCTGTGCTTTTCTAGTTATAAGGGGTTCCAGTTAGAG  600

seq1  ATTTCATTTTACTGTGTTGTTTCTGGCTTGGTGTGTAACTATTTTGTCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCATTTTACTGTGTTGTTTCTGGCTTGGTGTGTAACTATTTTGTCTC  650

seq1  ACTGCCCTTAAGCTCCTATTCTTTCCTTGATTGTATGTTTGAAATTTTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCCCTTAAGCTCCTATTCTTTCCTTGATTGTATGTTTGAAATTTTGA  700

seq1  GTATACTATACAATGGAAAGTTTTGTCTATATAGAATGCTAAATATCTCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATACTATACAATGGAAAGTTTTGTCTATATAGAATGCTAAATATCTCT  750

seq1  TGACATTTGTATTCAGTTGTCAGGGCCTGGCCAGGAATCATGGGACCTTT  800
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  TGACATTTGTATTCAGTTGTCAGGCCCTGGCCAGGAATCATGGGACCTTT  800

seq1  CTAATACTGGTGAGTTGACTGGACACAGACTGCTTAGGTTACAGATGTTG  850
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  CTAATACTGGTGAGTTGACTGGACACAGACTGCTTA-GTTACAGATGTTG  849

seq1  CTTGTAAATATTTGCTTTAGTGACCCCCCACCATTAGATTGTACCAATGT  900
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CTTGTAAATATTTGCTTTAGTGACCCCCCACCA-TAGATTGTACCAATGT  898

seq1  CCACCTTGTTTACATGCACATCTAATATGATCCTTCTTTGGGGAAAGGAG  950
      ||||||||||||||||||||||||||||||||||||||  ||||||||||
seq2  CCACCTTGTTTACATGCACATCTAATATGATCCTTCTT--GGGAAAGGAG  946

seq1  TTAAGTGTTTTGCCCACTTTGGAAGAGGAAGTAAAAAATCAA  992
      |  |||||||   ||||||||| ||||  |||  ||||||||
seq2  T--AGTGTTT--GCCACTTTGG-AGAG--AGT--AAAATCAA  979

seq1: chrX_144217297_144218441
seq2: B6Ng01-240B17.g_67_1194 (reverse)

seq1  GTAATTTATGCATCTTTCATTGGTACATTGAGAGTTTGGGAGCAAA--GA  48
      |||| ||| |||||||||| || |||||   |||||   |||||||   |
seq2  GTAA-TTAGGCATCTTTCA-TGATACATGAGGAGTT---GAGCAAAAGAA  45

seq1  ACACTTACCCTATTACCATTTTCTGACCTTTCAGTTGAAATTGTGCTGCA  98
      ||||||| |||| |||   ||||||||| ||||| ||||  |||||||||
seq2  ACACTTAACCTA-TAC--ATTTCTGACC-TTCAG-TGAA--TGTGCTGCA  88

seq1  TTTGTTTATGTGTTTGTGTGTTCATTGCTTCGTTTATTTACCTCTTAATT  148
      |    ||||||||||||||| ||| ||| ||||||||||| ||| |||||
seq2  T---GTTATGTGTTTGTGTG-TCA-TGC-TCGTTTATTTA-CTC-TAATT  130

seq1  TTTTATATGAAGCTACAGAGTGAAGGGGCAACCTGTCTTCAAACAATACT  198
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  TTTTATATGAAGCTACAGAGTGAAGGAGCAACCTGTCTTCAAACAATACT  180

seq1  TTG-GTTAAAAGCCTGTCCTAAAATCCAGTATTCACTGAGCCTGAA-TTC  246
      ||| |||||||||||||||||||||||||||||||||||| ||||| |||
seq2  TTGAGTTAAAAGCCTGTCCTAAAATCCAGTATTCACTGAG-CTGAATTTC  229

seq1  CAATGCAATCCTTCTGCTTCTGCAGTTTTAGACATGAAATTGTAGATATA  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGCAATCCTTCTGCTTCTGCAGTTTTAGACATGAAATTGTAGATATA  279

seq1  ATCTG-CCAGGTAATGCTCATTCAGGGATGTGATAATTTCATTTGTTTGG  345
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGCCCAGGTAATGCTCATTCAGGGATGTGATAATTTCATTTGTTTGG  329

seq1  ATTGGTTTTTAGGAAAGTGTTTCCTTTAAAGCCTGCTGGCTGGAGACACC  395
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  ATTGGTTTTTAGGAAAGTGTTTCCTTTAAAG-CTGCTGGCTGGAGACACC  378

seq1  CATTGTGGCTGAGGATGACAGGAAATGCCCCATTATTCTGCTTTTTACAG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGTGGCTGAGGATGACAGGAAATGCCCCATTATTCTGCTTTTTACAG  428

seq1  TGCTGGGATTTTGCATATACACAGTCCTACCTGGAGTATTCTTCAAAATA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGGGATTTTGCATATACACAGTCCTACCTGGAGTATTCTTCAAAATA  478

seq1  GACAAACTGTTTTTTAAAACTTCAATACCAGGCTCATGTAATCCACTGGA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAACTGTTTTTTAAAACTTCAATACCAGGCTCATGTAATCCACTGGA  528

seq1  ACATTAAATGACTGCTGGCTAGGCTGAGTTCTGGGACATAGTGTATGCTT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTAAATGACTGCTGGCTAGGCTGAGTTCTGGGACATAGTGTATGCTT  578

seq1  GTAAGCATGAGAATCTGAGTTTGATGCTCAGGAAAATGGACTTGAAGCCT  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGCATGAGAATCTGAGTTTGATGCTCAGGAAAATGGACTTGAAGCCT  628

seq1  AAGAATATCCTCAAATATGTGTAGGTAATCAAATGTAATAAGGCTAGGTC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAATATCCTCAAATATGTGTAGGTAATCAAATGTAATAAGGCTAGGTC  678

seq1  AAGAAGATAAGAGTAATTTACATGGACTCTTCAGCTACAGTACAATTTCA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAGATAAGAGTAATTTACATGGACTCTTCAGCTACAGTACAATTTCA  728

seq1  GGACCAGACAGGAATATATCAGAAATGTAGATAAAACATGTACTACAAAT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACCAGACAGGAATATATCAGAAATGTAGATAAAACATGTACTACAAAT  778

seq1  GTATAATTTCCTTCCAATTTGAATGGGAAGTACATTTAAGTTTAAAAATC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATAATTTCCTTCCAATTTGAATGGGAAGTACATTTAAGTTTAAAAATC  828

seq1  CTTCAAGATTTGGTCTTAATTATCCTTTCCAATTATAAAACCATAGTCTG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAAGATTTGGTCTTAATTATCCTTTCCAATTATAAAACCATAGTCTG  878

seq1  CATTCTATACTCCTTTAGGAACCCTTGAGTCATATCCTGATAGAACCTAG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCTATACTCCTTTAGGAACCCTTGAGTCATATCCTGATAGAACCTAG  928

seq1  TGGGGAAACCCTCACTCAATTCCCCATTCAGCATGCATCCAAAAAATCAC  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGAAACCCTCACTCAATTCCCCATTCAGCATGCATCCAAAAAATCAC  978

seq1  GAAGGACCATCTTGATGTAATTAGACAAGGTAGTTTAATTACAGAGTTCT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGACCATCTTGATGTAATTAGACAAGGTAGTTTAATTACAGAGTTCT  1028

seq1  GGACCAACATGAAAACCCACACTGTAGATAAAGGTTGTTGTCCACAAGTC  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACCAACATGAAAACCCACACTGTAGATAAAGGTTGTTGTCCACAAGTC  1078

seq1  TCAAAAGCTCGGGGTTTTCAAGGGGTAAGGGGCTTAGGGGTGTGGAATTC  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAAGCTCGGGGTTTTCAAGGGGTAAGGGGCTTAGGGGTGTGGAATTC  1128

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information