MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-244D19
Chromosome	X (Build37)
Map Location	109,065,177 - 109,236,010
singlet/doublet	doublet
Overlap gene	LOC100038989, Tex16
Upstream gene	Cylc1, LOC100042872, Rps6ka6, EG664791, D030011N01Rik
Downstream gene	LOC622570, 4933403O08Rik, EG385407, Apool, Satl1, EG623341, 2010106E10Rik, Zfp711, Pof1b, LOC623412, EG623428, LOC100039112, Chm
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cylc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67407 MGI:1914657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042872 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Rps6ka6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67071 MGI:1914321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664791 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664791 MGI:3648496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	D030011N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245596 MGI:2685226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tex16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83556 MGI:1890545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 102 ESTs, 33 Proteins pseudo : _no_value

name	4933403O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71030 MGI:1918280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein

name	EG385407 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385407 MGI:3642996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Apool (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68117 MGI:1915367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Satl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73809 MGI:1921059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins

name	EG623341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623341 MGI:3647565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins pseudo : _no_value

name	2010106E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67715 MGI:1914965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp711 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245595 MGI:3045342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pof1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69693 MGI:1916943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG623428 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623428 MGI:3645793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039112 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Chm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12662 MGI:892979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cylc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125630302 GeneID:67407 MGI:1914657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cylicin, basic protein of sperm head cytoskeleton 1 transcript_id : NM_026134.2

name	LOC100042872 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271829 GeneID:100042872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to developmental pluripotency associated 5 transcript_id : XM_001478964.1

name	Rps6ka6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625732 GeneID:67071 MGI:1914321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase polypeptide 6 transcript_id : NM_025949.2

name	D030011N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628655 GeneID:245596 MGI:2685226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030011N01 gene transcript_id : NM_001080549.2

name	LOC100038989 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272133 GeneID:100038989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to testis expressed gene 16 transcript_id : XM_001472045.1

name	Tex16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299740 GeneID:83556 MGI:1890545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 16 transcript_id : NM_031382.2

name	4933403O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408089 GeneID:71030 MGI:1918280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein product : RIKEN cDNA 4933403O08 gene transcript_id : XM_136029.3

name	EG385407 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408095 GeneID:385407 MGI:3642996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG385407 transcript_id : XM_887733.2

name	Apool (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754049 GeneID:68117 MGI:1915367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein O-like transcript_id : NM_026565.2

name	Satl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272135 GeneID:73809 MGI:1921059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins product : spermidine/spermine N1-acetyl transferase-like 1 transcript_id : XM_136025.7

name	2010106E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803565 GeneID:67715 MGI:1914965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010106E10 gene transcript_id : NM_026333.3

name	Zfp711 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347347 GeneID:245595 MGI:3045342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 711 transcript_id : NM_177747.3

name	Pof1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31657131 GeneID:69693 MGI:1916943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : premature ovarian failure 1B transcript_id : NM_181579.1

name	Chm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681713 GeneID:12662 MGI:892979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : choroidermia transcript_id : NM_018818.2

name	Cylc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125630303 GeneID:67407 MGI:1914657
definition	GO_component : GO:0043159 - acrosomal matrix [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cylicin, basic protein of sperm head cytoskeleton 1 protein_id : NP_080410.2

name	LOC100042872 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271830 GeneID:100042872
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479014.1

name	Rps6ka6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625733 CCDS:CCDS30356.1 GeneID:67071 MGI:1914321
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ribosomal protein S6 kinase polypeptide 6 protein_id : NP_080225.2

name	D030011N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123703979 GeneID:245596 MGI:2685226
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245596 protein_id : NP_001074018.1

name	LOC100038989 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272134 GeneID:100038989
definition	codon_start : 1 product : similar to testis expressed gene 16 protein_id : XP_001472095.1

name	Tex16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299741 CCDS:CCDS30358.1 GeneID:83556 MGI:1890545
definition	codon_start : 1 product : testis expressed gene 16 protein_id : NP_113559.2

name	4933403O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408090 GeneID:71030 MGI:1918280
definition	codon_start : 1 product : hypothetical protein LOC71030 protein_id : XP_136029.3

name	EG385407 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408096 GeneID:385407 MGI:3642996
definition	codon_start : 1 product : similar to barrier-to-autointegration factor protein_id : XP_892826.2

name	Apool (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386062 CCDS:CCDS30359.1 GeneID:68117 MGI:1915367
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : apolipoprotein O-like protein_id : NP_080841.1

name	Satl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272136 GeneID:73809 MGI:1921059
definition	codon_start : 1 product : spermidine/spermine N1-acetyl transferase-like 1 protein_id : XP_136025.5

name	2010106E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754077 CCDS:CCDS30360.1 GeneID:67715 MGI:1914965
definition	codon_start : 1 product : hypothetical protein LOC67715 protein_id : NP_080609.2

name	Zfp711 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347348 GeneID:245595 MGI:3045342
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 711 protein_id : NP_808415.2

name	Pof1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31657132 CCDS:CCDS30362.1 GeneID:69693 MGI:1916943
definition	GO_function : GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : premature ovarian failure 1B protein_id : NP_853557.1

name	Chm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681714 GeneID:12662 MGI:892979
definition	GO_component : GO:0005968 - Rab-protein geranylgeranyltransferase complex [Evidence IEA] GO_function : GO:0005084 - Rab escort protein activity [Evidence IEA]; GO:0004663 - Rab-protein geranylgeranyltransferase activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : choroideremia product : choroidermia protein_id : NP_061288.2

name	EG664791 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664791
definition	number : 1 pseudo : _no_value

name	EG664791 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664791
definition	number : 2 pseudo : _no_value

name	EG664791 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664791
definition	number : 3 pseudo : _no_value

name	LOC623412 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623412
definition	number : 1 pseudo : _no_value

name	EG623428 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623428
definition	number : 2 pseudo : _no_value

name	EG623428 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623428
definition	number : 1 pseudo : _no_value

name	LOC100039112 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039112
definition	number : 1 pseudo : _no_value

name	LOC622570 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272138 GeneID:622570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 102 ESTs, 33 Proteins product : similar to DnaJ-like protein pseudo : _no_value transcript_id : XR_030640.1

name	EG623341 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272137 GeneID:623341 MGI:3647565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : predicted gene, EG623341 pseudo : _no_value transcript_id : XR_030590.1

clone name	MSMg01-054E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-407D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075D24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-244D19.b	B6Ng01-244D19.g
ACC	GA053422	GA053423
length	504	1,172
definition	B6Ng01-244D19.b	B6Ng01-244D19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(109,065,177 - 109,065,686)	(109,234,847 - 109,236,010)
sequence	aagcccttgtgtttgcaaggaaagtattgtgctgactgaagtatcttctt agaccctgagttttttatttttaataatttaagaaattgtttgtagaact tacagtttgacagtttgcctctagctagccaataaaagtctactttagaa gttgctagttattagtttcattgattaaataagaatctgtaaccagtact gggtgttactaagtatattaaggtgttaaacattagtcatacacaagtaa tcagcatagaaaagaagcaattttaacaattatgctgtcagtttttctgc ctggaggcaaagatctgtgtgttgaattgaatgcttaatgttggttattt gtgacattgattagcatctctttctgggaaacttctagttcttataaaat aaatgaacctccaaattttatggaagttagaaatatcaagcaagttaaca aatgaagaagaaattaagaatgtaggatagaggggattggtggtatatgg atat	gaattcttttaattttaaagatttttatctcacaaatatttttattactc atactagccaacactccctttaattttatataagaaaaacattcttgctg tttctaggaagatggtgtctcttggaagaaaaaacataaaactgttctct attatagtaaaaacacgaaggagataagtttgtacttttattttgcctat ttaaatctgtgctattttaaatatttatttacttattttatggaaaacaa attagaggaagttaaacatttatccagatactaaaataaaatttgagttt atttatttactttgtctaatatataaaagggctaaaattcaatgtatata aatttaattatgcccactgagaacatttcggtagttttgtaaaaataaat aaataaataaataaaacaaccccccccccaaaaaaccagtgctttacagt tgtcaaatataggtttccaaatgccacagcaaccttaatttgtgcatgta attcagactactagaggaaatgtttgataaaaatatatgtttacttatta taaagaaaaataaatcagacaggttttaaattaaaggtcgaaaagctact ggtagggaactttgctttctgatatgtcatcaaaataattcagagtttag aatgtcatagctacttcagatacccatttttaaaacacaagtgttttcaa agttgattttggttaaagggtttcattcacaatacttatgatgaatttac accattcttctcttttgtcctccttccttctgtccctttcccccatcctt cccttcgtatttcctctttcactgaagaggaatgtaaccaaaaggagggt acatgtgtaaaaattttactagctttcctgtgactaggtttatatttatg gactattcaaacactgttaagaaaatcgagaagtagaaaacatctattac aagcctagtcaatgaatatttttttctattcaccaaaggtaatagaacaa gaatatttcctatgaaactatactcctgacactcaagttcaaataagtaa tacttgataacttatcttacctctattcacagtttatgttatccaactta aataaaaataattaacatatgttcaataacctagtagtaagaaatccagg aaatggaaaatggaatttgaaa
quality values	Open. Hide. 19 34 54 58 49 58 62 62 62 62 54 49 62 62 47 56 56 47 62 62 47 62 62 62 62 47 41 62 49 47 49 62 62 62 47 47 62 62 54 62 62 62 56 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 45 41 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 54 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 54 58 58 58 54 58 58 54 58 58 58 51 58 45 42 58 58 58 58 58 58 58 45 32 58 58 58 58 58 58 49 51 48 51 53 58 58 49 50 13 13	Open. Hide. 62 47 39 37 62 62 62 62 62 47 51 62 62 62 62 44 56 49 37 62 47 44 62 62 62 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 54 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 54 58 58 58 45 36 58 58 58 58 52 58 50 58 58 58 58 58 54 58 58 49 58 54 58 58 58 58 58 54 58 54 52 58 58 54 46 58 54 58 54 46 52 58 54 54 54 58 51 58 50 58 46 58 58 58 50 49 58 49 54 49 58 58 50 51 58 58 58 50 49 50 49 50 51 58 47 58 58 52 54 58 58 50 54 51 52 52 50 58 58 49 58 58 49 58 50 37 49 58 53 53 53 53 50 58 52 46 58 58 46 58 58 50 53 58 51 50 50 40 58 51 53 58 34 53 41 58 58 41 58 50 46 51 50 51 53 51 58 50 50 32 58 42 49 51 35 54 58 50 51 52 58 58 53 50 53 54 51 42 39 39 51 35 41 39 53 53 32 54 54 52 53 37 38 49 51 53 40 29 54 45 54 54 39 49 39 49 42 40 54 37 52 38 52 52 37 53 41 33 52 31 53 39 37 37 53 28 34 40 54 49 33 40 54 54 54 52 38 54 54 37 33 40 45 40 52 52 45 54 25 54 54 32 40 33 51 46 32 33 52 25 42 34 52 47 32 47 40 27 33 35 53 32 32 51 37 21 53 40 32 32 28 36 32 28 40 33 33 35 36 37 31 27 31 39 43 45 33 36 42 41 31 51 31 28 32 35 38 36 36 43 39 43 37 31 43 29 45 26 46 51 31 46 24 31 33 30 31 31 31 41 31 46 37 35 37 21 46 27 26 48 43 39 47 31 31 47 46 47 43 31 31 25 31 31 42 20 47 28 30 46 31 28 31 38 42 48 17 26 35 20 29 26 48 43 32 17 26 31 37 38 34 31 41 23 44 28 28 27 31 19 26 39 34 35 30 46 46 27 27 16 31 25 48 33 13 30 31 26 30 35 29 35 21 32 48 48 48 37 38 48 48 31 20 27 30 32 26 32 32 48 30 20 31 21 35 23 31 27 20 33 18 25 26 24 48 25 10 8 16 42 44 31 19 16 19 20 21 31 31 32 30 27 34 29 48 24 15 10 30 22 24 13 14 34 34 23 33 48 47 16 25 34 17 16 10 24 37 22 21 19 9 21 39 39 10 11 8 23 19 7 12 6 26 21 6 4 10 8 18 19 20 28 11 20 20 14 12 21 28 13 5 5 7 9 34 29 34 34 47 11 6 5 13 12 28 11 6 11 28 19 40 15 13 21 7 8 9 6 5 12 24 10 13 7 7 15 13 14 9 15 18 47 18 11 13 6 5 5 8 15 34 15 21 30 7 14 18 26 19 14 25 5 16 21 5 3 5 11 6 7 5 12 3 6 6 15 26 11 14 7 20 15 18 21 18 9 5 12 9 6 12 2 2 7 22 11 11 12 12 7 12 10 8 15 12 9 16 13 10 12 8 15 22 5 10 12 4 4 9 7 6 4 4 5 16 10 14 14 16 8 6 8 5 4 22 28 8 11 16 23 28 28 17 4 8 7 3 3 3 5 8 4 3 5 6 21 7 11 8 6 16 7 6 5 8 12 3 3 3 3 4 9 11 7 7 6 16 9 4 11 6 15 7 4 4 7 25 15 3 3 1 3 14 28 11 5 5 8 10 9 11 17 17 5 3 15 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_109065177_109065686
seq2: B6Ng01-244D19.b_41_550

seq1  GAATTCAAGCCCTTGTGTTTGCAAGGAAAGTATTGTGCTGACTGAAGTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGCCCTTGTGTTTGCAAGGAAAGTATTGTGCTGACTGAAGTAT  50

seq1  CTTCTTAGACCCTGAGTTTTTTATTTTTAATAATTTAAGAAATTGTTTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTAGACCCTGAGTTTTTTATTTTTAATAATTTAAGAAATTGTTTGT  100

seq1  AGAACTTACAGTTTGACAGTTTGCCTCTAGCTAGCCAATAAAAGTCTACT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACTTACAGTTTGACAGTTTGCCTCTAGCTAGCCAATAAAAGTCTACT  150

seq1  TTAGAAGTTGCTAGTTATTAGTTTCATTGATTAAATAAGAATCTGTAACC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAAGTTGCTAGTTATTAGTTTCATTGATTAAATAAGAATCTGTAACC  200

seq1  AGTACTGGGTGTTACTAAGTATATTAAGGTGTTAAACATTAGTCATACAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACTGGGTGTTACTAAGTATATTAAGGTGTTAAACATTAGTCATACAC  250

seq1  AAGTAATCAGCATAGAAAAGAAGCAATTTTAACAATTATGCTGTCAGTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAATCAGCATAGAAAAGAAGCAATTTTAACAATTATGCTGTCAGTTT  300

seq1  TTCTGCCTGGAGGCAAAGATCTGTGTGTTGAATTGAATGCTTAATGTTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCCTGGAGGCAAAGATCTGTGTGTTGAATTGAATGCTTAATGTTGG  350

seq1  TTATTTGTGACATTGATTAGCATCTCTTTCTGGGAAACTTCTAGTTCTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTGTGACATTGATTAGCATCTCTTTCTGGGAAACTTCTAGTTCTTA  400

seq1  TAAAATAAATGAACCTCCAAATTTTATGGAAGTTAGAAATATCAAGCAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAATAAATGAACCTCCAAATTTTATGGAAGTTAGAAATATCAAGCAAG  450

seq1  TTAACAAATGAAGAAGAAATTAAGAATGTAGGATAGAGGGGATTGGTGGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACAAATGAAGAAGAAATTAAGAATGTAGGATAGAGGGGATTGGTGGT  500

seq1  ATATGGATAT  510
      ||||||||||
seq2  ATATGGATAT  510

seq1: chrX_109234847_109236010
seq2: B6Ng01-244D19.g_67_1238 (reverse)

seq1  TTTCAAATT-CATTCTCCATTTCTTGTA-ATCTTACTACTAGTGTATTGA  48
      ||||||||| |||| |||||||| || |  ||||||||||||  ||||||
seq2  TTTCAAATTCCATTTTCCATTTCCTGGATTTCTTACTACTAGGTTATTGA  50

seq1  ACATATGTTTAAAATTA-TTTTATTT-AGTTGGAT-ACATAAACTGTGGA  95
      |||||||||   ||||| |||||||| |||||||| ||||||||||| ||
seq2  ACATATGTT---AATTATTTTTATTTAAGTTGGATAACATAAACTGT-GA  96

seq1  ATAGAG--TAGATAAGTTATCCAGTATTACTTATTTGAAACCTGAGTGTC  143
      ||||||   |||||||||||| ||||||||||||||| ||| ||||||||
seq2  ATAGAGGTAAGATAAGTTATCAAGTATTACTTATTTG-AACTTGAGTGTC  145

seq1  AGGAGTATAAGTTTCAATAGGAAATA-TCT--GTCTA-TACCTTTGGTGA  189
      |||||||| |||||| |||||||||| |||   |||| ||||||||||||
seq2  AGGAGTAT-AGTTTC-ATAGGAAATATTCTTGTTCTATTACCTTTGGTGA  193

seq1  ATAG-AAAAAATA-TCATTGACTAGGC-TGTAATAGATG-TTTCTACTTC  235
      |||| |||||||| ||||||||||||| ||||||||||| ||||||||||
seq2  ATAGAAAAAAATATTCATTGACTAGGCTTGTAATAGATGTTTTCTACTTC  243

seq1  TCGATTTTCTTAACAGTGTTTGAATAGTCCATAAATATAAACCTAGTCAC  285
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGATTTTCTTAACAGTGTTTGAATAGTCCATAAATATAAACCTAGTCAC  293

seq1  AGGAAAGCTAGTAAAATTTTTACACATGTACCCTCCTTTTGGTTACATTC  335
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAAGCTAGTAAAATTTTTACACATGTACCCTCCTTTTGGTTACATTC  343

seq1  CTCTTCAGTGAAAGAGGAAATACGAAGGGAAGGATGGGGGAAAGGGACAG  385
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCAGTGAAAGAGGAAATACGAAGGGAAGGATGGGGGAAAGGGACAG  393

seq1  AAGGAAGGAGGACAAAAGAGAAGAATGGTGTAAATTCATCATAAGTATTG  435
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAAGGAGGACAAAAGAGAAGAATGGTGTAAATTCATCATAAGTATTG  443

seq1  TGAATGAAACCCTTTAACCAAAATCAACTTTGAAAACACTTGTGTTTTAA  485
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGAAACCCTTTAACCAAAATCAACTTTGAAAACACTTGTGTTTTAA  493

seq1  AAATGGGTATCTGAAGTAGCTATGACATTCTAAACTCTGAATTATTTTGA  535
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGGGTATCTGAAGTAGCTATGACATTCTAAACTCTGAATTATTTTGA  543

seq1  TGACATATCAGAAAGCAAAGTTCCCTACCAGTAGCTTTTCGACCTTTAAT  585
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACATATCAGAAAGCAAAGTTCCCTACCAGTAGCTTTTCGACCTTTAAT  593

seq1  TTAAAACCTGTCTGATTTATTTTTCTTTATAATAAGTAAACATATATTTT  635
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAACCTGTCTGATTTATTTTTCTTTATAATAAGTAAACATATATTTT  643

seq1  TATCAAACATTTCCTCTAGTAGTCTGAATTACATGCACAAATTAAGGTTG  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAAACATTTCCTCTAGTAGTCTGAATTACATGCACAAATTAAGGTTG  693

seq1  CTGTGGCATTTGGAAACCTATATTTGACAACTGTAAAGCACTGGTTTTTT  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGGCATTTGGAAACCTATATTTGACAACTGTAAAGCACTGGTTTTTT  743

seq1  GGGGGGGGGGTTGTTTTATTTATTTATTTATTTATTTTTACAAAACTACC  785
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGGGGGTTGTTTTATTTATTTATTTATTTATTTTTACAAAACTACC  793

seq1  GAAATGTTCTCAGTGGGCATAATTAAATTTATATACATTGAATTTTAGCC  835
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATGTTCTCAGTGGGCATAATTAAATTTATATACATTGAATTTTAGCC  843

seq1  CTTTTATATATTAGACAAAGTAAATAAATAAACTCAAATTTTATTTTAGT  885
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTATATATTAGACAAAGTAAATAAATAAACTCAAATTTTATTTTAGT  893

seq1  ATCTGGATAAATGTTTAACTTCCTCTAATTTGTTTTCCATAAAATAAGTA  935
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGGATAAATGTTTAACTTCCTCTAATTTGTTTTCCATAAAATAAGTA  943

seq1  AATAAATATTTAAAATAGCACAGATTTAAATAGGCAAAATAAAAGTACAA  985
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAATATTTAAAATAGCACAGATTTAAATAGGCAAAATAAAAGTACAA  993

seq1  ACTTATCTCCTTCGTGTTTTTACTATAATAGAGAACAGTTTTATGTTTTT  1035
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTATCTCCTTCGTGTTTTTACTATAATAGAGAACAGTTTTATGTTTTT  1043

seq1  TCTTCCAAGAGACACCATCTTCCTAGAAACAGCAAGAATGTTTTTCTTAT  1085
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCAAGAGACACCATCTTCCTAGAAACAGCAAGAATGTTTTTCTTAT  1093

seq1  ATAAAATTAAAGGGAGTGTTGGCTAGTATGAGTAATAAAAATATTTGTGA  1135
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAATTAAAGGGAGTGTTGGCTAGTATGAGTAATAAAAATATTTGTGA  1143

seq1  GATAAAAATCTTTAAAATTAAAAGAATTC  1164
      |||||||||||||||||||||||||||||
seq2  GATAAAAATCTTTAAAATTAAAAGAATTC  1172

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information