MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-261O24
Chromosome	X (Build37)
Map Location	156,432,479 - 156,433,594
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100040371, Rps6ka3, Eif1ay, Mtap7d2, A830080D01Rik, LOC100041359, Sh3kbp1
Downstream gene	LOC667524, Pdha1, LOC100041403, LOC100041416, LOC100041427, Gpr64, Phka2, Ppef1, Rs1, Gja6
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Rps6ka3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110651 MGI:104557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif1ay (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66235 MGI:1913485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap7d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78283 MGI:1917474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830080D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382252 MGI:2685992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041359 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 137 ESTs, 1 Protein

name	Sh3kbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58194 MGI:1889583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667524 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Pdha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18597 MGI:97532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC100041427 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gpr64 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237175 MGI:2446854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Phka2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110094 MGI:97577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237178 MGI:1097157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20147 MGI:1336189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gja6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414089 MGI:95717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6ka3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507356 GeneID:110651 MGI:104557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase polypeptide 3 transcript_id : NM_148945.1

name	Eif1ay (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370237 GeneID:66235 MGI:1913485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 1A, Y-linked transcript_id : NM_025437.3

name	Mtap7d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487456 GeneID:78283 MGI:1917474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP7 domain containing 2 transcript_id : NM_001081124.1

name	A830080D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511061 GeneID:382252 MGI:2685992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830080D01 gene transcript_id : NM_001033472.2

name	LOC100041359 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272528 GeneID:100041359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 137 ESTs, 1 Protein product : similar to hepatitis B virus X interacting protein transcript_id : XM_001476187.1

name	Sh3kbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892923 GeneID:58194 MGI:1889583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain kinase binding protein 1 transcript_id : NM_021389.4

name	Pdha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543467 GeneID:18597 MGI:97532
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate dehydrogenase E1 alpha 1 transcript_id : NM_008810.2

name	LOC100041416 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272530 GeneID:100041416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100041416 transcript_id : XM_001476334.1

name	Gpr64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119943141 GeneID:237175 MGI:2446854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 64 transcript_id : NM_178712.3

name	Gpr64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119943130 GeneID:237175 MGI:2446854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 64 transcript_id : NM_001079857.1

name	Gpr64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119943135 GeneID:237175 MGI:2446854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 64 transcript_id : NM_001079847.1

name	Gpr64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119943138 GeneID:237175 MGI:2446854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 64 transcript_id : NM_001079848.1

name	Phka2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801780 GeneID:110094 MGI:97577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase alpha 2 transcript_id : NM_172783.2

name	Ppef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244034 GeneID:237178 MGI:1097157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase with EF hand calcium-binding domain 1 transcript_id : NM_011147.1

name	Rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476340 GeneID:20147 MGI:1336189
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoschisis (X-linked, juvenile) 1 (human) transcript_id : NM_011302.3

name	Gja6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47894400 GeneID:414089 MGI:95717
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 6 transcript_id : NM_001001496.1

name	Rps6ka3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507357 CCDS:CCDS30502.1 GeneID:110651 MGI:104557
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : ribosomal protein S6 kinase 2 product : ribosomal protein S6 kinase polypeptide 3 protein_id : NP_683747.1

name	Eif1ay (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541824 GeneID:66235 MGI:1913485
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 1A, Y-linked protein_id : NP_079713.2

name	Mtap7d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487457 GeneID:78283 MGI:1917474
definition	codon_start : 1 note : novel E-MAP-115 family protein product : MAP7 domain containing 2 protein_id : NP_001074593.1

name	A830080D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511062 CCDS:CCDS30503.1 GeneID:382252 MGI:2685992
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC382252 protein_id : NP_001028644.2

name	LOC100041359 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272529 GeneID:100041359
definition	codon_start : 1 product : similar to hepatitis B virus X interacting protein protein_id : XP_001476237.1

name	Sh3kbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27151744 GeneID:58194 MGI:1889583
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : Sh3 containing, expressed in astrocytes product : SH3-domain kinase binding protein 1 protein_id : NP_067364.2

name	Pdha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679261 GeneID:18597 MGI:97532
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016624 - oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor [Evidence IEA]; GO:0004739 - pyruvate dehydrogenase (acetyl-transferring) activity [Evidence IEA]; GO:0004738 - pyruvate dehydrogenase activity [Evidence IMP] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : pyruvate dehydrogenase E1alpha subunit product : pyruvate dehydrogenase E1 alpha 1 protein_id : NP_032836.1

name	LOC100041416 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272531 GeneID:100041416
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476384.1

name	Gpr64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542914 GeneID:237175 MGI:2446854
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; LNB-TM7 heptahelical receptor Me6 product : G protein-coupled receptor 64 isoform 1 protein_id : NP_848827.1

name	Gpr64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119943131 GeneID:237175 MGI:2446854
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; LNB-TM7 heptahelical receptor Me6 product : G protein-coupled receptor 64 isoform 2 protein_id : NP_001073326.1

name	Gpr64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119943136 GeneID:237175 MGI:2446854
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; LNB-TM7 heptahelical receptor Me6 product : G protein-coupled receptor 64 isoform 3 protein_id : NP_001073316.1

name	Gpr64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119943139 GeneID:237175 MGI:2446854
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; LNB-TM7 heptahelical receptor Me6 product : G protein-coupled receptor 64 isoform 4 protein_id : NP_001073317.1

name	Phka2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370156 CCDS:CCDS30504.1 GeneID:110094 MGI:97577
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004689 - phosphorylase kinase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 product : phosphorylase kinase alpha 2 protein_id : NP_766371.1

name	Ppef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244035 GeneID:237178 MGI:1097157
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence ISS] codon_start : 1 note : PPEF 1 product : protein phosphatase with EF hand calcium-binding domain 1 protein_id : NP_035277.1

name	Rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476341 CCDS:CCDS30505.1 GeneID:20147 MGI:1336189
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : retinoschisis 1 homolog protein_id : NP_035432.3

name	Gja6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47894401 CCDS:CCDS30506.1 GeneID:414089 MGI:95717
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : connexin 33 product : gap junction membrane channel protein alpha 6 protein_id : NP_001001496.1

name	LOC100040371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040371
definition	number : 1 pseudo : _no_value

name	LOC667524 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667524
definition	number : 1 pseudo : _no_value

name	LOC100041403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041403
definition	number : 1 pseudo : _no_value

name	LOC100041427 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041427
definition	number : 1 pseudo : _no_value

clone name	MSMg01-116B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-261O24.b	B6Ng01-261O24.g
ACC	GA066485	GA066486
length	1,138	989
definition	B6Ng01-261O24.b	B6Ng01-261O24.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcattgctactgcataactgtaattttgctactggaatgaactgca atgtaaatagctgtgttttccaatggtcttaggtgacctctttgaaaagg tcacccccaaaggaagtgacctacaggttgagaaccgctgcgacagtatt tcagtgcatgaagatgccacagtttgttttctattatgaataagcattcg agttgcttctgtctggagataatcatgaatagtgctgctgttatgaatag tctagtacttaggcttttgacaactttatgcgatgtaatgctcttatgta aagtataaagtacagtggatttgggtatattcacagttatagtgccatca ccactgtcaaattttagattatttctattagccctcaaataacaactcac tcttgtagaaccacctggaatctagtgagaactgcattaatcctttctaa gggcagcgaccccagtgacctagccactttatactaggaccacctcttaa aggtcccattatctttataccaccacactgaacataaaatatttcaacac ataaaccttgagagacacagccaaatcatatataaaaccatggcttccaa atactcatatgaactgggagcaattaccatttttatgtttagaatagcta ttcgattcgttagatttcacaagaccaaaatttcaaaccttgtaagatga gtttgtttataatgtcctgagaatgaaaattctgcatcaagaatgctgct tgttcctaaagcctatggcttatggaagtatgctgcatgaaaataataag cactgtgcatttcattgtacagtggatatcagacacgagataatacaatg aatctagacgaggttaaagacaaagaatgatgtctttcatatcgaacaga gtctccaaccaccaaatgaactcagtggctctttaaagggctgtgggtga cagatgccaatgaggaagtcattaaagcacagaagaaggtgaaatcagca gtccatgccaaaagttcccagtgttttagtgatctttgaaggaacaattg atttttccttcagtaaaaggagagcaaggatgattgtttgggggaataag atgcaaatccctcagttcccttttcccttgactgacac	gaattccacttcaaacacctacctaaacctgaagagcatcttccaaagta tcccacagttcagaaatatcagttccagtatgggttctggttggtgggaa gttgtgtgaacagtatggtcaggaaagccctcaccaaagaggtaatgttt gaacaaatgtcactgggttgagaaacaagatgtgaaagtatgtatgcaac gaatattcttggtggacaagttaacatgcacaacagacctgaggtgggaa taaccttggtgtgctcaaaaatagcaagaaacaccagtgtggttatgtaa ccctagaatttggaaggtagaagaaagacgctaaagagtcccaagccctg tacaaccactctggaaatccgtctggcggttcctcagaaaattggacata gtactaccagaggatcctgcaatacctctcctgggcatatatccagaaga tgttccaaccggtaagaaggacacatgctccactatgttcatagcagcct tatttataatagccagaagctggaaagaacccagatgcccctcaacagag gaatggatacagaaaatgtggtacacttacacaatggagtactactcagc tattaaaaagaatgaattttatgaaattcctagccaaatggatggacctg gagggtatcttcctgagtgaggtaacccaatcacaaaggaactcacacaa tatgtactcactgataagtggatattagcccagaaacttagaatacccaa gatataagatacaatttgctaaacgcatgaaactcaaagaagaaggaaga ccaaagtgtggacacttttgcacccttcttagaattggggaacaaaaaca cctatgggaaaggagtttacagagacaaagttttgaagctgagataaaaa ggatgggatcatctagaaactgcccatatccgggaatccattcccataat cagcttccaacgctgacaccattgcatacactagcaaga
quality values	Open. Hide. 52 36 18 31 58 28 19 54 58 58 54 54 49 47 52 62 41 39 47 42 62 62 49 62 62 56 56 62 62 56 47 44 44 22 21 24 50 62 49 44 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 59 59 59 62 62 54 48 56 48 48 56 50 54 48 56 59 59 62 62 62 62 54 49 62 59 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 59 59 59 59 62 62 59 59 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 59 62 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 56 62 59 59 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 51 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 56 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 59 59 59 56 59 56 62 62 62 62 59 62 59 59 59 62 56 51 59 62 59 38 59 51 56 56 56 62 62 62 62 62 44 62 62 62 62 56 62 51 47 62 56 56 62 56 53 51 54 47 47 56 56 62 47 56 51 51 56 56 56 62 62 62 56 62 62 62 56 62 47 43 43 50 56 56 56 62 62 54 56 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 56 56 54 41 33 62 56 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 54 47 56 62 51 62 62 62 42 38 30 40 41 47 54 62 54 62 62 42 47 43 48 54 52 50 52 62 52 62 62 62 62 54 52 62 62 62 62 62 62 62 58 48 45 41 54 58 58 58 54 47 54 38 33 38 54 54 52 54 54 54 58 52 54 58 54 58 52 54 54 58 58 58 54 47 58 54 52 54 54 52 42 52 54 58 58 58 54 45 49 58 58 58 58 43 54 54 58 39 49 54 52 58 54 54 54 45 54 42 34 49 58 46 42 58 58 47 42 54 35 58 54 52 42 54 50 49 50 42 22 44 50 50 48 48 54 58 53 36 8 41 29 45 54 41 26 45 39 35 58 46 53 32 51 52 52 46 58 50 58 42 58 51 50 39 33 44 49 54 35 37 54 52 50 47 29 58 34 29 50 52 51 51 28 52 58 45 52 50 46 39 38 48 43 13 29 51 28 29 50 42 48 50 38 44 28 39 50 21 40 43 37 42 58 41 42 52 43 40 41 28 37 46 29 17 22 50 31 51 50 46 50 31 45 30 52 50 41 39 49 50 32 35 38 41 54 54 54 41 19 37 42 40 46 37 35 34 53 52 54 37 53 30 17 7 41 24 41 25 32 40 50 32 28 41 32 53 27 41 28 37 24 30 42 40 37 13 53 22 24 37 12 54 18 14 17 20 20 26 18 17 19 18 26 28 54 18 31 31 33 32 33 33 39 21 29 7 49 8 19 15 52 34 32 32 9 9 26 29 7 22 33 32 32 26 31 23 8 12 47 51 21 30 19 32 29 31 26 14 23 25 26 14 21 39 15 15 27 25 21 38 26 17 21 10 13 14 31 6 37 33 31 30 31 22 19 15 25 25 21 31 31 42 9 8 31 26 46 42 24 46 25 21 46 29 25 38 32 26 14 46 17 15 25 16 21 9 16 29 24 38 26 25 26 24 30 26 28 24 22 33 30 20 8 11 13 27 9 26 46 14 14 30 20 24 8 8 20 25 8 5 22 19 31 10 12 15 23 9 8 9 17 16 37 23 24 22 10 12 9 20 25 11 20 31 41 48 32 20 24 7 24 37 25 24 20 21 20 10 37 36 26 29 11 18 26 18 25 17 8 35 26 32 17 12 4 5 20 11 7 5 30 20 23 19 12 13 36 29 32 9 7 7 22 6 12 5 9 4 9 10 25 18 5 6 5 4 11 7 21 7 5 20 18 29 5 6 18 19 6 27 9 22 26 24 32 40 27 7 15 12 6 6 6 6 6 4 3 3 3 3 11 24 22 33 10 8 27 5 17 7 9 13 28 17 27 38 10 6 8 20 7 3 8 7 8 4 5 7 6 5 6 7	Open. Hide. 62 47 51 47 62 62 44 24 59 62 43 39 18 17 25 20 16 28 28 28 50 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 54 59 51 62 62 62 59 62 62 62 62 62 62 62 59 59 48 54 43 33 46 62 59 59 62 62 62 59 59 62 62 62 62 62 59 62 54 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 59 62 54 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 59 51 62 59 56 62 62 59 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 62 59 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 56 62 62 62 62 59 62 62 59 59 62 59 62 59 59 62 62 62 62 62 59 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 44 46 49 62 51 49 54 62 62 62 62 54 47 56 62 56 56 56 62 62 62 56 62 62 56 62 44 56 56 62 56 62 62 56 62 56 56 40 46 56 56 62 62 62 62 54 62 62 62 62 56 51 33 56 56 56 56 62 62 62 47 56 62 56 62 56 56 43 56 47 47 41 54 56 36 56 56 56 62 62 46 46 56 62 54 54 62 47 62 43 62 56 56 52 52 43 52 52 52 34 35 47 50 35 62 38 36 62 45 38 62 62 62 62 52 54 22 52 62 62 62 45 41 62 52 62 62 46 52 48 42 50 49 54 43 58 52 54 51 52 58 58 58 58 40 52 42 52 52 52 52 52 52 41 29 43 58 54 31 28 38 58 58 58 48 54 54 58 58 47 54 54 54 54 54 25 32 54 52 58 52 26 52 52 42 34 52 54 52 52 48 33 54 44 54 54 58 31 39 52 48 52 42 47 50 44 43 48 35 58 47 30 49 53 53 32 30 29 29 35 41 30 17 41 49 50 50 58 40 37 52 46 41 41 38 40 54 42 39 46 27 22 44 37 44 32 22 41 53 36 41 41 47 51 32 44 41 52 52 53 52 40 41 41 50 32 34 32 48 40 28 20 18 31 38 36 29 53 40 39 39 34 29 30 32 32 39 30 29 58 50 27 34 53 53 32 14 51 24 39 30 35 37 37 30 33 32 32 18 35 35 27 49 21 30 17 25 44 20 45 39 54 54 52 32 42 18 29 25 15 19 37 21 40 45 50 44 44 44 36 19 13 49 9 12 28 25 30 51 25 20 46 42 38 37 37 21 21 24 27 19 37 34 34 38 27 29 30 31 21 34 20 53 32 33 24 28 16 16 31 8 32 40 41 33 16 13 30 40 25 25 38 31 45 42 26 37 32 24 22 40 47 30 26 26 28 22 28 34 20 33 19 32 13 25 37 6 31 18 26 15 21 45 30 18 33 30 26 51 28 30 30 30 40 27 15 34 46 46 6 41 18 26 9 32 42 30 42 30 33 31 16 46 46 46 21 29 27 31 19 27 42 19 9 5 25 8 27 35 25 11 6 17 31 37 31 34 38 9 14 13 9 22 28 22 24 38 21 41 27 10 13 14 14 32 14 23 13 27 27 24 15 33 32 27 21 19 20 33 31 34 23 24 26 26 35 20 21 15 7 6 25 20 10 29 10 9 25 14 31 25 25 19 10 8 11 21 15 22 14 34 22 13 18 28

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_156432479_156433594
seq2: B6Ng01-261O24.b_46_1183

seq1  GAATTCATTGCTACTGCATAACTGTAATTTTGCTACTGGAATGAACTGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTGCTACTGCATAACTGTAATTTTGCTACTGGAATGAACTGCA  50

seq1  ATGTAAATAGCTGTGTTTTCCAATGGTCTTAGGTGACCTCTTTGAAAAGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAAATAGCTGTGTTTTCCAATGGTCTTAGGTGACCTCTTTGAAAAGG  100

seq1  TCACCCCCAAAGGAAGTGACCTACAGGTTGAGAACCGCTGCGACAGTATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCCCCAAAGGAAGTGACCTACAGGTTGAGAACCGCTGCGACAGTATT  150

seq1  TCAGTGCATGAAGATGCCACAGTTTGTTTTCTATTATGAATAAGCATTCG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGCATGAAGATGCCACAGTTTGTTTTCTATTATGAATAAGCATTCG  200

seq1  AGTTGCTTCTGTCTGGAGATAATCATGAATAGTGCTGCTGTTATGAATAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGCTTCTGTCTGGAGATAATCATGAATAGTGCTGCTGTTATGAATAG  250

seq1  TCTAGTACTTAGGCTTTTGACAACTTTATGCGATGTAATGCTCTTATGTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGTACTTAGGCTTTTGACAACTTTATGCGATGTAATGCTCTTATGTA  300

seq1  AAGTATAAAGTACAGTGGATTTGGGTATATTCACAGTTATAGTGCCATCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTATAAAGTACAGTGGATTTGGGTATATTCACAGTTATAGTGCCATCA  350

seq1  CCACTGTCAAATTTTAGATTATTTCTATTAGCCCTCAAATAACAACTCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTGTCAAATTTTAGATTATTTCTATTAGCCCTCAAATAACAACTCAC  400

seq1  TCTTGTAGAACCACCTGGAATCTAGTGAGAACTGCATTAATCCTTTCTAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGTAGAACCACCTGGAATCTAGTGAGAACTGCATTAATCCTTTCTAA  450

seq1  GGGCAGCGACCCCAGTGACCTAGCCACTTTATACTAGGACCACCTCTTAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGCGACCCCAGTGACCTAGCCACTTTATACTAGGACCACCTCTTAA  500

seq1  AGGTCCCATTATCTTTATACCACCACACTGAACATAAAATATTTCAACAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCCCATTATCTTTATACCACCACACTGAACATAAAATATTTCAACAC  550

seq1  ATAAACCTTGAGAGACACAGCCAAATCATATATAAAACCATGGCTTCCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAACCTTGAGAGACACAGCCAAATCATATATAAAACCATGGCTTCCAA  600

seq1  ATACTCATATGAACTGGGAGCAATTACCATTTTTATGTTTAGAATAGCTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTCATATGAACTGGGAGCAATTACCATTTTTATGTTTAGAATAGCTA  650

seq1  TTCGATTCGTTAGATTTCACAAGACCAAAATTTCAAACCTTGTAAGATGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGATTCGTTAGATTTCACAAGACCAAAATTTCAAACCTTGTAAGATGA  700

seq1  GTTTGTTTATAATGTCCTGAGAATGAAAATTCTGCATCAAGAATGCTGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGTTTATAATGTCCTGAGAATGAAAATTCTGCATCAAGAATGCTGCT  750

seq1  TGTTCCTAAAGCCTATGGCTTATGGAAGTATGCTGCATGAAAATAATAAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCCTAAAGCCTATGGCTTATGGAAGTATGCTGCATGAAAATAATAAG  800

seq1  CACTGTGCA-TTCATTGTACAGTGGATATCAGACACGAGATAATACAATG  849
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  CACTGTGCATTTCATTGTACAGTGGATATCAGACACGAGATAATACAATG  850

seq1  AATCTAGACGAGG-TAAAGACAAAGAATGATG-CTTTCATATCGAACAGA  897
      ||||||||||||| |||||||||||||||||| |||||||||||||||||
seq2  AATCTAGACGAGGTTAAAGACAAAGAATGATGTCTTTCATATCGAACAGA  900

seq1  GTCTCCAA-CACCAAATGAACTCAGTGGC-CTTTAAA-GGCTGT-GGTGA  943
      |||||||| |||||||||||||||||||| ||||||| |||||| |||||
seq2  GTCTCCAACCACCAAATGAACTCAGTGGCTCTTTAAAGGGCTGTGGGTGA  950

seq1  CAGATGCCAATGAGGAAG-CA-TAAAGCACAGAAG-AGGTGAAATCAGCA  990
      |||||||||||||||||| || ||||||||||||| ||||||||||||||
seq2  CAGATGCCAATGAGGAAGTCATTAAAGCACAGAAGAAGGTGAAATCAGCA  1000

seq1  GT-CATG-CAAAAG-TCCCAGTG-TTTAGTGATC-TTGAAGGAACAATTG  1035
      || |||| |||||| |||||||| |||||||||| |||||||||||||||
seq2  GTCCATGCCAAAAGTTCCCAGTGTTTTAGTGATCTTTGAAGGAACAATTG  1050

seq1  ATTTT--CTTCAGTAAAA-GAGAGC-AGGATGATTGTT--GGGGAAATAG  1079
      |||||  ||||||||||| |||||| ||||||||||||  ||||||  ||
seq2  ATTTTTCCTTCAGTAAAAGGAGAGCAAGGATGATTGTTTGGGGGAATAAG  1100

seq1  ATGGAAAATCCTCCAGT--CCTTTCCCATTGACTGACAC  1116
      || | ||||||  ||||  ||||| || |||||||||||
seq2  AT-GCAAATCCCTCAGTTCCCTTTTCCCTTGACTGACAC  1138

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information