MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-275M11
Chromosome	X (Build37)
Map Location	25,751,010 - 25,752,114
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100038968, LOC100038977, LOC100038997, LOC664810, EG382275, LOC100039030, LOC100039065
Downstream gene	LOC100039078, LOC100039003, Slx, LOC100039120, LOC619914, LOC100039039, LOC619991, LOC664844, LOC100042154, EG664861, LOC664866
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100038968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins pseudo : _no_value

name	LOC100038977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 3 ESTs, 5 Proteins

name	LOC100038997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins

name	LOC664810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	EG382275 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382275 MGI:3703318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 5 Proteins

name	LOC100039065 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 5 Proteins

name	LOC100039078 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 90 ESTs, 1 Protein

name	LOC100039003 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins

name	Slx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664829 MGI:99543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 7 ESTs, 5 Proteins

name	LOC100039120 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 5 Proteins

name	LOC619914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC619991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 5 Proteins

name	LOC664844 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein pseudo : _no_value

name	LOC100042154 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs

name	EG664861 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664861 MGI:3646621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs

name	LOC100038977 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271231 GeneID:100038977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 5 Proteins product : hypothetical protein LOC100038977, transcript variant 2 transcript_id : XM_001472083.1

name	LOC100038977 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271229 GeneID:100038977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 5 Proteins product : hypothetical protein LOC100038977, transcript variant 1 transcript_id : XM_001472060.1

name	LOC100038997 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271233 GeneID:100038997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to XMR transcript_id : XM_001472117.1

name	EG382275 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801953 GeneID:382275 MGI:3703318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG382275 transcript_id : NM_001025607.2

name	LOC100039030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271240 GeneID:100039030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 5 Proteins product : similar to Xmr protein, transcript variant 2 transcript_id : XM_001472195.1

name	LOC100039030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271238 GeneID:100039030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 5 Proteins product : similar to Xmr protein, transcript variant 1 transcript_id : XM_001472174.1

name	LOC100039065 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271246 GeneID:100039065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 2 transcript_id : XM_001472332.1

name	LOC100039065 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271244 GeneID:100039065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 1 transcript_id : XM_001472304.1

name	LOC100039078 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271248 GeneID:100039078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 90 ESTs, 1 Protein product : similar to RIKEN cDNA 1810037I17 gene transcript_id : XM_001472358.1

name	LOC100039003 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271235 GeneID:100039003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to Xmr protein transcript_id : XM_001472071.1

name	Slx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407127 GeneID:664829 MGI:99543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs, 5 Proteins product : Sycp3 like X-linked, transcript variant 2 transcript_id : XM_973255.1

name	Slx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407129 GeneID:664829 MGI:99543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 5 Proteins product : Sycp3 like X-linked, transcript variant 3 transcript_id : XM_973298.1

name	LOC100039120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271252 GeneID:100039120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 10 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated, transcript variant 2 transcript_id : XM_001472448.1

name	LOC100039120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271250 GeneID:100039120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated, transcript variant 1 transcript_id : XM_001472427.1

name	LOC100039039 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271242 GeneID:100039039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to pol protein transcript_id : XM_001472138.1

name	LOC619991 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407135 GeneID:619991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 10 ESTs, 5 Proteins product : novel protein similar to Xlr-related, meiosis regulated (Xmr), transcript variant 1 transcript_id : XM_884246.2

name	LOC619991 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271255 GeneID:619991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 5 Proteins product : novel protein similar to Xlr-related, meiosis regulated (Xmr) transcript_id : XM_001472499.1

name	LOC100042154 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271335 GeneID:100042154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100042154, transcript variant 1 transcript_id : XM_001477451.1

name	LOC100042154 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271333 GeneID:100042154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100042154, transcript variant 2 transcript_id : XM_001477462.1

name	LOC664866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271338 GeneID:664866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs product : hypothetical protein LOC664866 transcript_id : XM_973129.2

name	LOC100038977 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271230 GeneID:100038977
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472110.1

name	LOC100038977 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271232 GeneID:100038977
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472133.1

name	LOC100038997 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271234 GeneID:100038997
definition	codon_start : 1 product : similar to XMR protein_id : XP_001472167.1

name	EG382275 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037366 GeneID:382275 MGI:3703318
definition	codon_start : 1 note : novel protein similar to Xlr-related, meiosis regulated (Xmr) product : similar to XMR protein_id : NP_001020778.1

name	LOC100039030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271239 GeneID:100039030
definition	codon_start : 1 product : similar to Xmr protein isoform 1 protein_id : XP_001472224.1

name	LOC100039030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271241 GeneID:100039030
definition	codon_start : 1 product : similar to Xmr protein isoform 2 protein_id : XP_001472245.1

name	LOC100039065 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271245 GeneID:100039065
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 1 protein_id : XP_001472354.1

name	LOC100039065 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271247 GeneID:100039065
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 2 protein_id : XP_001472382.1

name	LOC100039078 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271249 GeneID:100039078
definition	codon_start : 1 product : similar to RIKEN cDNA 1810037I17 gene protein_id : XP_001472408.1

name	LOC100039003 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271236 GeneID:100039003
definition	codon_start : 1 product : similar to Xmr protein protein_id : XP_001472121.1

name	Slx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407128 GeneID:664829 MGI:99543
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_978349.1

name	Slx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407130 GeneID:664829 MGI:99543
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_978392.1

name	LOC100039120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271251 GeneID:100039120
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472477.1

name	LOC100039120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271253 GeneID:100039120
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472498.1

name	LOC100039039 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271243 GeneID:100039039
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472188.1

name	LOC619991 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271256 GeneID:619991
definition	codon_start : 1 product : hypothetical protein LOC619991 protein_id : XP_001472549.1

name	LOC619991 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83000366 GeneID:619991
definition	codon_start : 1 product : hypothetical protein LOC619991 isoform 1 protein_id : XP_889339.1

name	LOC100042154 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271334 GeneID:100042154
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477512.1

name	LOC100042154 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271336 GeneID:100042154
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477501.1

name	LOC664866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407235 GeneID:664866
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978223.1

name	LOC100038968 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271228 GeneID:100038968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : similar to Sycp3 like X-linked pseudo : _no_value transcript_id : XR_030540.1

name	LOC664810 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271237 GeneID:664810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : hypothetical LOC664810 pseudo : _no_value transcript_id : XR_001649.2

name	LOC619914 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271254 GeneID:619914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to Sycp3 like X-linked pseudo : _no_value transcript_id : XR_030717.1

name	LOC664844 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271257 GeneID:664844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein product : hypothetical LOC664844 pseudo : _no_value transcript_id : XR_030752.1

name	EG664861 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271337 GeneID:664861 MGI:3646621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664861 pseudo : _no_value transcript_id : XR_035688.1

clone name	MSMg01-451D23
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-269L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275G12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-275M11.b	B6Ng01-275M11.g
ACC	GA076725	GA076726
length	1,206	1,104
definition	B6Ng01-275M11.b	B6Ng01-275M11.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccttaaagaaaaacaggaagacacatccaacaggtgatagaaatg aacaaaaccatactagacctaaaaagggaagtaggcacaataaagaaaac acaaagtgaggcaatggtggagatagaaaccctaggaaagtaatctggaa ccatagatgagagcatcagcaatagaatacaagagatggaagagaaaaat ctcagatacaaacgattccatagagaacatgggcacaacaatcaaagaaa atgcaaaatgcaaaacgatcctaactcaaaacatccaggaaaaccagtac ttaattagaagactaaacctactgataatagtggtagatgagaaggaaga ttttcaaattaaagggccagcaaatatcttcaacaaaattctagaagaaa agttcccaaacctaaagaaagaaatgcccatgtacacacaagaagcctac agaactccaaatagactgcaccagaaaagaaattcctcctgacacataat aatcagaacaacaaatgcactaaataaagatagaatattaaaagcagtaa gggaaaaatgtcaagtaacatataaaggcaggcctatcagaattacatca gacttttcaccagacactatgaaagcctggatagttattatacagactct aagagaacacaaatgctagcccaggctactattcccacccaaacttaaaa ttacaatagatggagaaaccaaagtattccatgacaaatccaaattcaca caatatctttccacaaatccagcccttcaaaggataataaagaaaaaaca ccaacacaagaacagaaaacacatcaagccccttccgctccactcgagcc ccaggctaccttgccagcagagtctcgcccaacacccgcaagggcccaca caggattccccacgggatcctaagacctctggtgagtggaacacagtgcc tgccccaatccaatcgtgcgaacctgagactgtggtacaatagggaagca gctgcccgggcctgatctggggcacaagccccttcgcttcactcgagccc cgggtaacctgccagcagagtctgcccaacacccgcaaggcccacacaga acaccccacggatctaagacctctggtgatggaaccagtgctgcccaatc catcacggactgaactgcgtactacggaagcaggctacccgggccgtgaa tatctg	gaattcagcagtttctccagaagcagtacagatcatagtcatcaccatga tctccatcagaaatattaaaaatagactctatcttgttactggtgacagc attcagctggtatgactatgactgaaacctcttgtctagtgaaagaatga aaatggacataaaaatgtttataaatggcagaacacttatcatgaatgtg gcagaattatacataattgacatcagtaattattctaatgcagtacaaga ctgtcatattaatttggtcccataatgcagcacggatcactgacatgatt gctgctaaaggcctaaagtatcttggccatacattgtctgttgccagtat atatgtgacctcgacaaaacatatctcagaacatttaactcaacatgacc tgagggaacagtactgactgtgaagttcactgtaaattctgatggtttct gggatccttgacattaacaatatcttcagaagcaacatgaaatgtgggtt tcaatatggctactgatggcagcatgaataattgtgattgtcataatttc tggagacactttggagagtcaggtgctaatgagaaagattaatgtagaag gaatagggaagaaggtaagataaactaaggatatctgcaaaagtcataag aaatctcactactaacttcataaaaacctatacctcaaataagctataag taaatgagcatgtacagtttaattagaactttacagtttgaattgactta ttaaaccaatgtatgcaattgtttatgtatcttttatttcaaattatata acattttctatttatatatgttttgcttcaaataataaaattagggttca tattactgctaaatattacccaaatatgcatgatgcattttgatgtgggg atttattgatactgtatacatataggtaaaataataacagtaggttctcc ctatgtcctatcaccaccctgagctattgctttttgatcaatttgcatta atgagcatggtactctcctgttgtagtgagccttgaatctaataggagcg tattttctattgactaaagttactattttcttattcctaaggtcaagggg tgtt
quality values	Open. Hide. 58 29 19 34 58 54 58 47 18 22 41 52 62 62 62 62 62 43 46 41 62 62 47 62 62 47 43 56 62 54 62 56 47 39 56 47 42 56 62 62 47 41 47 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 59 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 58 58 58 58 54 54 58 58 54 58 58 58 58 54 58 58 48 54 58 58 58 58 54 58 58 58 54 54 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 52 58 58 49 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 58 51 58 58 58 58 58 58 58 47 42 58 54 51 50 58 58 58 50 47 47 48 58 51 58 54 58 51 54 58 52 53 51 58 40 58 58 51 51 52 53 52 58 50 46 54 50 54 50 58 58 50 50 49 48 58 58 58 58 49 50 41 44 35 49 58 50 53 54 54 53 58 49 49 58 58 53 51 58 49 58 58 38 39 51 58 58 51 50 41 51 52 52 50 49 50 51 51 29 54 53 53 40 58 47 49 34 58 51 39 52 50 54 58 49 50 58 44 44 43 50 44 38 43 41 52 58 50 54 50 41 44 50 52 52 41 37 34 36 44 33 42 35 54 49 40 51 51 41 54 54 27 41 54 37 49 41 46 51 53 49 41 39 54 46 49 39 53 54 40 38 44 21 52 52 52 52 37 37 51 33 46 32 45 54 38 32 30 54 44 40 40 40 31 54 33 36 39 37 37 47 37 45 24 35 52 42 47 52 53 54 42 32 40 31 42 29 51 27 47 25 40 31 34 31 40 40 34 53 34 22 52 45 32 49 15 22 31 32 47 32 49 40 40 52 53 53 52 40 31 45 31 33 46 28 32 51 30 51 24 37 38 40 31 46 31 45 45 47 46 40 32 31 45 30 45 26 24 23 45 31 51 41 27 37 42 33 42 32 28 41 18 29 25 27 41 29 28 31 30 31 46 40 32 26 27 46 27 31 30 24 21 29 30 38 24 31 32 32 30 21 19 42 22 32 31 37 32 31 28 39 31 25 33 30 24 26 33 20 21 29 28 25 26 41 18 7 29 23 21 31 25 30 25 25 19 32 9 30 23 36 28 26 24 14 24 41 17 11 17 11 18 29 15 22 18 32 11 19 29 17 25 27 33 16 29 42 28 32 24 21 29 24 18 26 31 24 31 27 32 14 22 22 32 23 31 26 13 8 17 26 18 27 16 30 24 23 14 18 33 9 25 9 18 8 16 32 32 34 11 24 18 31 32 8 9 33 11 31 13 8 6 7 6 8 34 16 10 20 15 22 5 3 5 13 14 13 21 13 5 32 18 14 16 24 28 28 22 7 14 20 34 34 20 8 9 5 9 27 12 17 28 27 14 10 11 11 4 14 11 12 6 4 3 6 20 8 24 8 11 27 17 19 7 30 8 2 3 7 15 4 2 4 6 11 11 7 8 6 8 18 4 2 5 21 14 9 22 8 14 5 6 4 12 25 11 6 10 9 6 17 12 3 15 10 6 9 7 6 5 11 6 5 4 5 7 13 14 9 13 10 16 17 5 9 17 9 18 16 4 9 10 5 4 4 7 14 8 7 4 6 4 5 4 2 4 7 5 3 1 3 5 3 1 3 3 4 16 5 12 7 6 7 19 6 5 3 5 5 4 3 2 5 9 19 15 12 16 20 5 6 5 2 3 6 2 1 5 11 20 9 5 8 2 3 5 4 8 9 13 18 6 2 3 16 11 7 6 4 15 8 7 6 9 5 8 7 9	Open. Hide. 56 35 47 47 56 42 26 27 51 56 51 56 56 56 56 56 62 56 44 50 62 62 59 62 62 59 62 62 62 59 59 59 62 59 62 62 62 56 62 59 43 62 62 62 62 59 59 62 59 59 62 62 62 62 59 59 62 54 62 59 62 62 49 62 62 62 54 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 49 54 62 59 62 62 62 62 62 59 62 59 59 62 59 62 62 42 54 62 62 62 62 62 42 62 62 62 59 59 59 62 62 62 59 62 62 62 59 62 62 62 42 42 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 38 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 43 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 54 54 58 58 54 58 58 58 54 58 58 58 58 45 41 58 58 58 58 58 58 58 47 46 58 58 58 58 58 58 54 52 54 42 52 58 58 58 54 58 54 58 39 54 58 54 54 52 45 58 52 49 52 47 58 54 54 58 54 37 58 58 58 39 58 35 54 58 51 51 58 53 54 53 58 51 42 58 51 51 41 58 50 58 58 54 58 39 58 42 26 58 32 58 58 46 58 46 38 58 45 42 54 53 50 35 58 51 46 49 53 53 58 58 47 27 58 58 51 50 52 53 50 52 34 35 40 44 58 48 37 54 53 52 52 52 51 51 50 43 37 51 50 50 58 49 46 39 28 58 58 58 49 39 39 49 50 51 39 47 50 53 53 41 49 39 52 51 58 31 58 49 50 52 51 58 39 37 50 58 42 53 58 58 37 51 37 50 51 29 24 41 43 40 49 54 29 53 53 39 28 39 34 39 35 37 52 54 49 34 40 29 52 38 33 30 40 40 39 33 51 34 35 31 53 39 38 32 35 31 54 27 14 21 37 33 26 46 33 38 31 52 38 42 33 30 44 44 26 54 31 53 40 54 40 47 39 52 40 54 54 29 39 37 54 40 33 29 54 51 33 41 40 33 32 32 32 41 31 37 31 49 49 32 40 30 31 51 52 53 40 36 33 28 32 33 51 41 46 40 22 32 45 31 47 33 29 40 22 22 18 35 30 23 51 46 46 25 51 35 8 51 30 25 38 28 30 32 38 21 31 31 31 31 42 29 31 19 51 31 14 18 9 29 31 28 48 42 31 48 42 31 30 31 38 38 31 28 31 38 26 31 31 14 12 48 48 31 22 31 27 43 32 34 48 46 33 21 14 46 31 27 18 32 26 30 25 31 31 31 32 16 16 7 15 31 31 31 19 21 31 21 29 19 41 46 47 25 9 14 31 31 28 25 16 10 30 31 24 18 13 22 23 14 13 32 43 38 19 15 11 11 31 16 12 15 34 31 27 16 9 6 9 24 38 30 14 25 29 19 38 31 21 10 20 29 23 28 39 36 48 16 15 32 27 31 20 14 14 15 5 15 27 25 17 7 19 17 12 21 17 8 32 15 27 15 13 4 4 16 16 18 8 6 22 6 10 9 6 7 13 27 7 5 13 15 12 7 15 20 27 17 14 20 24 20 24 24 12 13 15 12 7 25 4 12 18 22 18 3 3 5 5 11 5 6 5 16 16 16 28 19 11 28 14 7 8 13 16 15 21 3 5 13 27 9 11 11 7 7 11 4 4 3 5 6 7 16 9 17 12 11 8 14 28 17 5 5 6 6 14

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_25751010_25752114
seq2: B6Ng01-275M11.g_69_1172 (reverse)

seq1  AACA-CCCTTGACC-TAAGAATAAGAAAATTAAGTAACTTTAGTCAATAG  48
      |||| ||||||||| || ||||||||||||  ||||||||||||||||||
seq2  AACACCCCTTGACCTTAGGAATAAGAAAAT--AGTAACTTTAGTCAATAG  48

seq1  ATATTACGCTTCTTATTAGATTCAAGGCTCACTAC-ACAGGAGAGTAACC  97
      | | ||||| || |||||||||||||||||||||| |||||||||| |||
seq2  AAAATACGC-TCCTATTAGATTCAAGGCTCACTACAACAGGAGAGT-ACC  96

seq1  ATGCTCATTAATGCAAAATTGATCAAAAAGCAATAGCTCAGGGT-GTGAT  146
      |||||||||||||| ||||||||||||||||||||||||||||| |||||
seq2  ATGCTCATTAATGC-AAATTGATCAAAAAGCAATAGCTCAGGGTGGTGAT  145

seq1  AGGACATAGGGGAGAACCTACTGTTATTATTTTACCTATATGTATACAGT  196
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AGGACATA-GGGAGAACCTACTGTTATTATTTTACCTATATGTATACAGT  194

seq1  ATCAATAAATCCCCACATCAAAATGCATCATGCATATTTGGGTAATATTT  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAATAAATCCCCACATCAAAATGCATCATGCATATTTGGGTAATATTT  244

seq1  AGCAGTAATATGAA-CCTAATTTTATTATTTGAAGCAAAACATATATAAA  295
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AGCAGTAATATGAACCCTAATTTTATTATTTGAAGCAAAACATATATAAA  294

seq1  TAGAAAATGTTATATAATTTGAAATAAAAGATACATAAACAATTGCATAC  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAAATGTTATATAATTTGAAATAAAAGATACATAAACAATTGCATAC  344

seq1  ATTGGTTTAATAAGTCAATTCAAACTGTAAAGTTCTAATTAAACTGTACA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGTTTAATAAGTCAATTCAAACTGTAAAGTTCTAATTAAACTGTACA  394

seq1  TGCTCATTTACTTATAGCTTATTTGAGGTATAGGTTTTTATGAAGTTAGT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCATTTACTTATAGCTTATTTGAGGTATAGGTTTTTATGAAGTTAGT  444

seq1  AGTGAGATTTCTTATGACTTTTGCAGATATCCTTAGTTTATCTTACCTTC  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAGATTTCTTATGACTTTTGCAGATATCCTTAGTTTATCTTACCTTC  494

seq1  TTCCCTATTCCTTCTACATTAATCTTTCTCATTAGCACCTGACTCTCCAA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCTATTCCTTCTACATTAATCTTTCTCATTAGCACCTGACTCTCCAA  544

seq1  AGTGTCTCCAGAAATTATGACAATCACAATTATTCATGCTGCCATCAGTA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTCTCCAGAAATTATGACAATCACAATTATTCATGCTGCCATCAGTA  594

seq1  GCCATATTGAAACCCACATTTCATGTTGCTTCTGAAGATATTGTTAATGT  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATATTGAAACCCACATTTCATGTTGCTTCTGAAGATATTGTTAATGT  644

seq1  CAAGGATCCCAGAAACCATCAGAATTTACAGTGAACTTCACAGTCAGTAC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGATCCCAGAAACCATCAGAATTTACAGTGAACTTCACAGTCAGTAC  694

seq1  TGTTCCCTCAGGTCATGTTGAGTTAAATGTTCTGAGATATGTTTTGTCGA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCCCTCAGGTCATGTTGAGTTAAATGTTCTGAGATATGTTTTGTCGA  744

seq1  GGTCACATATATACTGGCAACAGACAATGTATGGCCAAGATACTTTAGGC  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCACATATATACTGGCAACAGACAATGTATGGCCAAGATACTTTAGGC  794

seq1  CTTTAGCAGCAATCATGTCAGTGATCCGTGCTGCATTATGGGACCAAATT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGCAGCAATCATGTCAGTGATCCGTGCTGCATTATGGGACCAAATT  844

seq1  AATATGACAGTCTTGTACTGCATTAGAATAATTACTGATGTCAATTATGT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATGACAGTCTTGTACTGCATTAGAATAATTACTGATGTCAATTATGT  894

seq1  ATAATTCTGCCACATTCATGATAAGTGTTCTGCCATTTATAAACATTTTT  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATTCTGCCACATTCATGATAAGTGTTCTGCCATTTATAAACATTTTT  944

seq1  ATGTCCATTTTCATTCTTTCACTAGACAAGAGGTTTCAGTCATAGTCATA  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCCATTTTCATTCTTTCACTAGACAAGAGGTTTCAGTCATAGTCATA  994

seq1  CCAGCTGAATGCTGTCACCAGTAACAAGATAGAGTCTATTTTTAATATTT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCTGAATGCTGTCACCAGTAACAAGATAGAGTCTATTTTTAATATTT  1044

seq1  CTGATGGAGATCATGGTGATGACTATGATCTGTACTGCTTCTGGAGAAAC  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATGGAGATCATGGTGATGACTATGATCTGTACTGCTTCTGGAGAAAC  1094

seq1  TGCTGAATTC  1105
      ||||||||||
seq2  TGCTGAATTC  1104

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information