MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-282G17
Chromosome	X (Build37)
Map Location	144,766,818 - 144,849,928
singlet/doublet	doublet
Overlap gene	LOC100039545
Upstream gene	Il13ra2, V1rb10, Lrch2, LOC100039462, LOC666789, LOC434863, EG623995, EG624023, LOC666184, LOC100039511, LOC666812, LOC100039519, LOC434864, EG624096
Downstream gene	LOC666837, LOC100039553, LOC100034729, LOC666861, EG666864, LOC434866, EG666868, EG624260, LOC434865, EG624310, Ott, LOC666888, LOC100039598, LOC100039890, LOC100039612, EG666923, EG624378
Link	Open Mouse BAC browser

Click to get alignment info.

name	Il13ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16165 MGI:1277954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113867 MGI:2148521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210297 MGI:2147870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC666789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC434863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 9 Proteins

name	EG623995 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623995 MGI:3642951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG624023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 15 ESTs, 4 Proteins

name	LOC100039511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC666812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624096 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624096 MGI:3643280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins pseudo : _no_value

name	LOC666837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666837
definition	note : lysyl-tRNA synthetase pseudogene pseudo : _no_value

name	LOC100039553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100034729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666864 MGI:3648921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 8 Proteins

name	EG666868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666868 MGI:3644011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG624260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624260 MGI:3646683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 16 ESTs, 4 Proteins

name	EG624310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ott (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18422 MGI:107573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 15 ESTs, 9 Proteins

name	LOC100039612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG666923 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666923 MGI:3645202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG624378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624378 MGI:3644585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Il13ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345552 GeneID:16165 MGI:1277954
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 13 receptor, alpha 2 transcript_id : NM_008356.2

name	V1rb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118200340 GeneID:113867 MGI:2148521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B10 transcript_id : NM_053240.2

name	Lrch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487174 GeneID:210297 MGI:2147870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeats and calponin homology (CH) domain containing 2 transcript_id : NM_001081173.1

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408343 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 17 ESTs, 5 Proteins product : ovary testis transcribed-like, transcript variant 1 transcript_id : XM_486785.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272432 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 1 Protein product : ovary testis transcribed-like, transcript variant 3 transcript_id : XM_897719.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272434 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : ovary testis transcribed-like transcript_id : XM_001473108.1

name	EG624023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272425 GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624023 transcript_id : XM_888549.3

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408346 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 4 transcript_id : XM_982169.1

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408350 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 2 transcript_id : XM_982089.1

name	LOC434864 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:126032330 GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001081648.1

name	LOC100034729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:131887312 GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001082966.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272441 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_001487784.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272443 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 3 transcript_id : XM_001487786.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272445 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_001487787.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272447 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 2 transcript_id : XM_001487785.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272451 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 5 transcript_id : XM_001487788.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272449 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 6 transcript_id : XM_001487789.1

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408362 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_486789.4

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408364 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_897890.2

name	EG624310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272430 GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624310 transcript_id : XM_888852.2

name	Ott (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859585 GeneID:18422 MGI:107573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed transcript_id : NM_011022.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272457 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 5 Proteins product : similar to ovary testis transcribed, transcript variant 1 transcript_id : XM_001473712.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272459 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 4 Proteins product : similar to ovary testis transcribed, transcript variant 2 transcript_id : XM_001473728.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272461 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs, 1 Protein product : similar to ovary testis transcribed, transcript variant 3 transcript_id : XM_001473747.1

name	Il13ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680405 CCDS:CCDS30460.1 GeneID:16165 MGI:1277954
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 product : interleukin 13 receptor, alpha 2 protein_id : NP_032382.1

name	V1rb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118200341 GeneID:113867 MGI:2148521
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B10 protein_id : NP_444470.2

name	Lrch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487175 GeneID:210297 MGI:2147870
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine-rich repeats and calponin homology (CH) domain containing 2 protein_id : NP_001074642.1

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772467 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 1 protein_id : XP_486785.1

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272433 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 3 protein_id : XP_902812.3

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272435 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 protein_id : XP_001473158.1

name	EG624023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272426 GeneID:624023 MGI:3644694
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893642.3

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408347 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 4 protein_id : XP_987263.1

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408351 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 2 protein_id : XP_987183.1

name	LOC434864 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:126032331 GeneID:434864
definition	codon_start : 1 product : hypothetical protein LOC434864 protein_id : NP_001075117.1

name	LOC100034729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:131887313 GeneID:100034729
definition	codon_start : 1 product : hypothetical protein LOC100034729 protein_id : NP_001076435.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272442 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001487834.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272446 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001487837.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272444 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001487836.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272448 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001487835.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272452 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_001487838.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272450 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 6 protein_id : XP_001487839.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772471 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 1 protein_id : XP_486789.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408365 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 4 protein_id : XP_902983.2

name	EG624310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272431 GeneID:624310 MGI:3644796
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893945.2

name	Ott (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859586 GeneID:18422 MGI:107573
definition	codon_start : 1 product : ovary testis transcribed protein_id : NP_035152.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272458 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473762.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272462 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001473797.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272460 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473778.1

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 1 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 2 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 3 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 4 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 5 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 1 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 2 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 3 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 4 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 5 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 7 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 2 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 2 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 3 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 4 pseudo : _no_value

name	LOC666812 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666812
definition	number : 1 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 2 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 1 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 2 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 1 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 2 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 1 pseudo : _no_value

name	LOC666861 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666861
definition	number : 1 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 2 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 1 pseudo : _no_value

name	EG666868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666868
definition	number : 1 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 2 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 1 pseudo : _no_value

name	LOC666888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666888
definition	number : 1 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 2 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 2 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 3 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 4 pseudo : _no_value

name	EG666923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666923
definition	number : 1 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 2 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 1 pseudo : _no_value

name	LOC100039545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272427 GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins product : similar to Ott protein pseudo : _no_value transcript_id : XR_031018.1

clone name	MSMg01-348E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-282G17.b	B6Ng01-282G17.g
ACC	GA081640	GA081641
length	1,082	1,110
definition	B6Ng01-282G17.b	B6Ng01-282G17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(144,766,818 - 144,767,926)	(144,848,810 - 144,849,928)
sequence	gaattccacataaactgaagactgccactttgaaatgctgagtatagata gaatggacaatcactcttgtatagcattcagtgagacaagcagacaacgt tagagtgttgaaatactaagtcatttttcaaaacaaggcctatcttttaa aaactgtttctaaaagatactgaattcactgctgaaaatatggaaaataa attttctcaaaataatacacaggacacagacgtgacagtaggggaagaaa tggccattttttcagacaaagattttcagcaaatcatcctctacttcatc tggtaagtgaacactaagggttaacagaaatcaagagtctgagatgtaac atagttcttttagagatgagtgtgtttgtttctttgaagacaaggtctta caagttcaatagtacaaggtagtatattacttactatgtagcctaggttg gtaaagaatttctgatgttcatcctgtctcaatcttccagtgatgaaact aagagaaggtgttatatgttaggtatcataattacttttctttgtaaaaa aacactatgatcaaggcagtgtacaaaaggaagagggtcagaaaccttga tcatcatggggtgggcagtgtattgcagcaggaggaaggccccttcaact atttcaggaaacattttattttttattttaatcattgggaattttgaatt tataaggtacaaaaatagatagtttgtgattgtcattaattgtaaatatt attctcattttgtcctcttataaatttttatcttaagctatagtataaaa atagtttactaccctcaaaaactaatggtatgaaccagaaatctggagta gagagataccctagtatttaaaagtgcttgctagtgttccagatgaccca agttcagctctcaacacccacatcagtggtcctataacttaaatgcagtt tcagggctttaacccctctctggtttctgtagcacacacacatgggcata tctccataacaccccataacccacctccaccacgctcgcctctcacccac caacctataccataaaatcacgtgaagataga	gaattcacaatgactggcaatatgcacagggcctgcacaggttcaagcta gatcaagtcccagcactgaatctgataaatggacagagacttccactgtt aaccaagaagctacgtgtaattgctatccacttcaaaggcaaaatccgtt ttctataacagaaactcaataaattcattaaccacagatcagggcatgtc ccaaacactgaagtagattactaactcaaagtgaataaaataaagtgaaa tctgttgttaaagaagaatgttttggggatggagcatgtagattagttgg tagagttcatgcctagccaacatcaagccctggtttgatcctaaacactg cataaactagctgtgcctagaaccctgttcctggtaagtggaggctatct tgtgatattgagactgtctacagaaaaagttaatggcattatcttcacta ttacagtatgtgggggacacggatgaatgcctgtgctgtaaccaacaccc cttcattttatcacatgaagcccaattttggctccactagttttgctttt gtgacatgttttagtcactatattacctactaagtaaatccttatttatc tgagtacatcctaatctttgtgttgttggaaatatgaccatggccttcaa ctttcatttactatgaaaatgccaagtttttttttttctaaaacaatttt tctgatctgtgaatagcattcacaagatgctatggtctcttcttcactgg ctgtggctacatatagatgtaatggatcaggctgcagtaattaccttgag gtcatgagaaagaaaaccctgaggacaaaactgataacacaagcagagca gacacattgaaaagaccttgtacttgctttattctctgagacactacaac atatcaaaccaaaaactccaaagtgtgtcctgccttaggagttgtaggga caaagatggatcagagacaaagaaatagctgaccaatgaccagcccaaat tgagactcaccatgacagaaccaatccctgaactatatgaatactatgtt atgcatgtaggcaagggcatagcataactgtctcttggaagctctcactc agcagctgac
quality values	Open. Hide. 58 20 24 32 62 62 39 22 51 35 62 62 62 62 62 62 62 49 62 62 47 47 62 62 62 47 51 59 62 62 62 44 44 56 45 46 43 40 59 59 62 59 62 54 59 59 62 54 62 62 62 62 62 59 62 62 59 59 62 54 49 42 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 54 54 59 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 59 62 62 49 62 59 62 62 62 62 62 62 54 54 54 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 54 58 58 54 58 58 54 48 58 49 58 54 58 58 58 58 58 58 58 52 54 52 54 58 58 42 58 58 58 52 58 41 58 54 48 58 58 52 58 52 39 22 41 52 54 58 37 46 54 52 54 54 52 54 58 58 58 58 52 58 58 58 54 52 52 54 58 54 49 42 58 58 49 51 47 54 49 35 58 49 33 58 58 52 33 51 32 47 22 38 47 51 50 32 50 51 42 40 54 58 50 49 50 27 58 48 39 44 50 39 49 58 58 53 53 50 58 58 58 58 39 50 40 58 58 49 40 53 53 52 39 50 54 58 49 51 58 25 23 58 58 58 39 39 37 40 58 49 39 52 50 50 29 51 21 39 58 38 58 58 58 41 58 41 54 39 39 52 49 41 54 51 54 45 54 53 32 52 54 38 44 40 49 51 45 49 49 54 54 35 53 49 54 53 52 42 49 50 37 49 52 52 41 38 52 54 54 54 51 37 41 53 45 53 35 42 42 45 40 54 51 42 54 54 54 45 52 42 53 32 35 40 45 32 47 33 32 42 45 31 32 45 36 34 52 52 49 51 52 52 37 52 49 32 31 31 32 36 26 33 33 41 42 31 51 47 46 30 36 33 18 41 31 46 40 31 39 38 43 42 37 16 18 27 21 46 47 31 31 43 38 43 46 28 21 31 42 30 46 25 46 32 31 23 28 27 41 23 23 32 31 27 37 27 47 31 37 48 46 37 31 31 31 31 28 31 37 31 28 31 35 36 41 21 25 23 27 25 20 35 29 31 42 22 41 25 21 25 31 33 23 37 33 32 31 31 29 31 32 21 25 31 17 12 12 11 8 17 23 32 20 23 27 33 28 11 22 22 22 31 32 30 12 21 29 24 17 24 48 28 30 32 27 31 20 32 43 24 14 16 10 47 19 14 18 47 25 9 12 21 21 21 13 6 11 3 9 21 15 14 3 32 9 19 11 27 18 30 10 27 11 14 3 10 15 21 15 19 17 26 24 19 14 5 16 9 32 8 17 19 16 13 4 15 5 3 3 4 3 3 4 7 2 24 9 13 3 13 5 7 22 7 2 5 3 1 2 2 1 5 3 3 4 3 3 11 3 3 11 5 23 7 7 5 2 4 14 11 3 3 3 7 9 4 10 4 5 7 4 3 3 17 28 18 6 12 6 13 17 8 8 9 7 5 16 8 16 4 5	Open. Hide. 62 47 39 47 62 47 42 62 62 62 62 62 44 44 56 37 37 29 38 56 62 62 59 62 62 62 62 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 54 54 62 62 62 62 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 59 59 62 54 62 59 62 59 59 59 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 47 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 34 34 62 58 58 54 58 58 58 54 54 58 58 54 54 58 58 58 58 58 54 58 58 54 58 54 58 58 58 58 58 58 54 58 58 58 50 58 58 58 58 58 58 58 58 49 39 58 58 58 58 58 54 58 54 52 52 58 58 58 58 58 58 58 58 58 58 52 54 58 58 58 54 49 54 58 58 58 58 58 58 58 58 58 58 58 51 58 54 54 58 58 58 54 54 53 58 54 53 54 51 58 58 58 46 58 42 42 47 58 50 54 54 54 51 58 53 53 58 58 58 49 49 40 51 51 32 49 58 50 51 58 51 44 48 43 51 51 33 42 46 52 49 58 50 48 51 51 46 53 46 50 54 58 58 42 37 51 58 44 40 50 37 52 50 52 53 58 58 43 41 51 31 44 44 50 52 53 58 58 58 58 58 58 58 58 58 43 40 39 29 54 54 32 40 40 44 53 54 54 49 44 52 52 40 42 27 40 41 50 30 50 51 28 34 39 47 35 18 47 50 37 31 41 21 52 42 53 32 53 40 45 37 42 53 53 37 45 33 35 37 39 42 52 45 40 32 35 32 46 54 32 45 47 37 53 39 27 41 31 53 33 52 32 45 40 32 45 35 53 43 45 28 26 49 16 32 26 22 25 14 38 23 52 32 32 31 26 32 31 39 32 42 33 27 23 38 33 29 23 15 33 28 31 31 31 45 42 21 51 51 43 28 35 51 45 30 24 40 43 31 31 15 8 37 22 13 28 51 46 31 25 31 42 31 29 23 27 30 24 42 30 26 31 31 30 26 31 7 32 30 13 32 15 25 40 14 34 31 31 33 46 46 37 26 25 16 28 31 36 37 21 24 27 31 30 31 31 31 47 34 25 24 32 25 27 29 26 25 43 21 26 22 23 29 32 31 30 21 17 20 23 37 31 32 29 25 44 17 5 6 31 41 44 44 31 27 32 17 24 19 44 32 27 29 38 24 31 19 12 17 31 37 21 17 10 19 9 25 15 31 19 27 29 31 21 18 25 39 23 21 12 6 34 25 7 15 18 22 26 22 32 18 22 18 33 10 14 8 19 34 11 33 13 47 15 22 15 19 28 33 32 34 14 22 9 13 7 20 26 11 18 14 7 13 8 12 11 11 10 17 11 17 15 8 28 24 27 11 13 7 13 10 19 22 27 8 14 6 20 21 13 21 14 6 14 18 28 16 24 21 28 33 14 28 16 19 14 5 11 10 8 7 12 21 15 16 15 12 20 9 20 15 17 17 20 16 16 19 15 11 16 11 9 4 13 16 9 2 3 17 10 8 14 4 9 7 17 13 13 7 9 18 11 9 9 7 5 5 5 1 3 1 7 5 9 19 5 11 4 20 4 6 6 11 13 17 6 5 4 7

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_144766818_144767926
seq2: B6Ng01-282G17.b_48_1129

seq1  GAATTCCACATAAACTGAAGACTGCCACTTTGAAATGCTGAGTATAGATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACATAAACTGAAGACTGCCACTTTGAAATGCTGAGTATAGATA  50

seq1  GAATGGACAATCACTCTTGTATAGCATTCAGTGAGACAAGCAGACAACGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGGACAATCACTCTTGTATAGCATTCAGTGAGACAAGCAGACAACGT  100

seq1  TAGAGTGTTGAAATACTAAGTCATTTTTCAAAACAAGGCCTATCTTTTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGTGTTGAAATACTAAGTCATTTTTCAAAACAAGGCCTATCTTTTAA  150

seq1  AAACTGTTTCTAAAAGATACTGAATTCACTGCTGAAAATATGGAAAATAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGTTTCTAAAAGATACTGAATTCACTGCTGAAAATATGGAAAATAA  200

seq1  ATTTTCTCAAAATAATACACAGGACACAGACGTGACAGTAGGGGAAGAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCTCAAAATAATACACAGGACACAGACGTGACAGTAGGGGAAGAAA  250

seq1  TGGCCATTTTTTCAGACAAAGATTTTCAGCAAATCATCCTCTACTTCATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCATTTTTTCAGACAAAGATTTTCAGCAAATCATCCTCTACTTCATC  300

seq1  TGGTAAGTGAACACTAAGGGTTAACAGAAATCAAGAGTCTGAGATGTAAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAAGTGAACACTAAGGGTTAACAGAAATCAAGAGTCTGAGATGTAAC  350

seq1  ATAGTTCTTTTAGAGATGAGTGTGTTTGTTTCTTTGAAGACAAGGTCTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTTCTTTTAGAGATGAGTGTGTTTGTTTCTTTGAAGACAAGGTCTTA  400

seq1  CAAGTTCAATAGTACAAGGTAGTATATTACTTACTATGTAGCCTAGGTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTTCAATAGTACAAGGTAGTATATTACTTACTATGTAGCCTAGGTTG  450

seq1  GTAAAGAATTTCTGATGTTCATCCTGTCTCAATCTTCCAGTGATGAAACT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAGAATTTCTGATGTTCATCCTGTCTCAATCTTCCAGTGATGAAACT  500

seq1  AAGAGAAGGTGTTATATGTTAGGTATCATAATTACTTTTCTTTGTAAAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAAGGTGTTATATGTTAGGTATCATAATTACTTTTCTTTGTAAAAA  550

seq1  AACACTATGATCAAGGCAGTGTACAAAAGGAAGAGGGTCAGAAACCTTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACTATGATCAAGGCAGTGTACAAAAGGAAGAGGGTCAGAAACCTTGA  600

seq1  TCATCATGGGGTGGGCAGTGTATTGCAGCAGGAGGAAGGCCCCTTCAACT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCATGGGGTGGGCAGTGTATTGCAGCAGGAGGAAGGCCCCTTCAACT  650

seq1  ATTTCAGGAAACATTTTATTTTTTATTTTAATCATTGGGAATTTTGAATT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCAGGAAACATTTTATTTTTTATTTTAATCATTGGGAATTTTGAATT  700

seq1  TATAAGGTACAAAAATAGATAGTTTGTGATTGTCATTAATTGTAAATATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAGGTACAAAAATAGATAGTTTGTGATTGTCATTAATTGTAAATATT  750

seq1  ATTCTCATTTTGTCCTCTTATAAATTTTTATCTTAAGCTATAGTATAAAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTCATTTTGTCCTCTTATAAATTTTTATCTTAAGCTATAGTATAAAA  800

seq1  ATAGTTTACTACCCTCAAAAACTAATGGTATGAACCAGAAATCTGGAGTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTTTACTACCCTCAAAAACTAATGGTATGAACCAGAAATCTGGAGTA  850

seq1  GAGAGATACCCTAGTATTTAAAAGTGCTTGCTAGTGTTCCAGATGACCCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGATACCCTAGTATTTAAAAGTGCTTGCTAGTGTTCCAGATGACCCA  900

seq1  AGTTCAGCTCTCAACACCCACATCAGTGGTCCTATAACTTAAATGCAGTT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAGCTCTCAACACCCACATCAGTGGTCCTATAACTTAAATGCAGTT  950

seq1  TCAAGGGCTTTAACCCCTCCTCTGGTTTCTGTAAGCACCACACACATGGG  1000
      || ||||||||||||||| ||||||||||||| |||| ||||||||| ||
seq2  TC-AGGGCTTTAACCCCT-CTCTGGTTTCTGT-AGCA-CACACACAT-GG  995

seq1  GCATAATCTCACATAAAACACACACATAAACACACACACACACACACACA  1050
      |||| ||||| ||||| ||   | ||||           || |||   ||
seq2  GCAT-ATCTC-CATAACAC---CCCATA-----------ACCCACCTCCA  1029

seq1  CACACACACACACACACACACACAAACCTATACACATTAAAAAATCACGT  1100
      | ||| | | | | | ||| ||| ||||||||| |||   ||||||||||
seq2  C-CACGCTCGC-CTCTCACCCACCAACCTATAC-CAT---AAAATCACGT  1073

seq1  GAAGATAGA  1109
      |||||||||
seq2  GAAGATAGA  1082

seq1: chrX_144848810_144849928
seq2: B6Ng01-282G17.g_65_1174 (reverse)

seq1  GTCAGCTGCTGGGTG-GAGACTCTCAGAGGACAGTTATGCTATGCCCCTG  49
      ||||||||||| ||| |||  ||  ||| |||||||||||||||||| ||
seq2  GTCAGCTGCTGAGTGAGAGCTTCCAAGA-GACAGTTATGCTATGCCCTTG  49

seq1  CCTACATGCATAACATAGTA-TCATTAATAGTTTCAGGGATTGGTTCTTG  98
      |||||||||||||||||||| ||||  |||| ||||||||||||||||  
seq2  CCTACATGCATAACATAGTATTCAT--ATAG-TTCAGGGATTGGTTCT--  94

seq1  TTCATGGGTTGAGTCTCAATTTGGGCTGGTCATTGGTCAGCTATTTCCTT  148
       ||||||  ||||||||||||||||||||||||||||||||||||| |||
seq2  GTCATGG--TGAGTCTCAATTTGGGCTGGTCATTGGTCAGCTATTT-CTT  141

seq1  TGTCTCTGATCCATCTTTGTCCCTACAACTCCTAAAGGCAGGACACACTT  198
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  TGTCTCTGATCCATCTTTGTCCCTACAACTCCT-AAGGCAGGACACACTT  190

seq1  TGGAGTTTTTGGTTTTGATATGTTGTAGTGTCTCAGAGAATAAAGCAAGT  248
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  TGGAGTTTTTGG-TTTGATATGTTGTAGTGTCTCAGAGAATAAAGCAAGT  239

seq1  ACAAGGTCTTTTCAATGTGTCTGCTCTGCTTGTGTTATCAGTTTTGTCCT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGGTCTTTTCAATGTGTCTGCTCTGCTTGTGTTATCAGTTTTGTCCT  289

seq1  CAGGGTTTTCTTTCTCATGACCTCAAGGTAATTACTGCAGCCTGATCCAT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGTTTTCTTTCTCATGACCTCAAGGTAATTACTGCAGCCTGATCCAT  339

seq1  TACATCTATATGTAGCCACAGCCAGTGAAGAAGAGACCATAGCATCTTGT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATCTATATGTAGCCACAGCCAGTGAAGAAGAGACCATAGCATCTTGT  389

seq1  GAATGCTATTCACAGATCAGAAAAATTGTTTTAGAAAAAAAAAAACTTGG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGCTATTCACAGATCAGAAAAATTGTTTTAGAAAAAAAAAAACTTGG  439

seq1  CATTTTCATAGTAAATGAAAGTTGAAGGCCATGGTCATATTTCCAACAAC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTTCATAGTAAATGAAAGTTGAAGGCCATGGTCATATTTCCAACAAC  489

seq1  ACAAAGATTAGGATGTACTCAGATAAATAAGGATTTACTTAGTAGGTAAT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAGATTAGGATGTACTCAGATAAATAAGGATTTACTTAGTAGGTAAT  539

seq1  ATAGTGACTAAAACATGTCACAAAAGCAAAACTAGTGGAGCCAAAATTGG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTGACTAAAACATGTCACAAAAGCAAAACTAGTGGAGCCAAAATTGG  589

seq1  GCTTCATGTGATAAAATGAAGGGGTGTTGGTTACAGCACAGGCATTCATC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCATGTGATAAAATGAAGGGGTGTTGGTTACAGCACAGGCATTCATC  639

seq1  CGTGTCCCCCACATACTGTAATAGTGAAGATAATGCCATTAACTTTTTCT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGTCCCCCACATACTGTAATAGTGAAGATAATGCCATTAACTTTTTCT  689

seq1  GTAGACAGTCTCAATATCACAAGATAGCCTCCACTTACCAGGAACAGGGT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGACAGTCTCAATATCACAAGATAGCCTCCACTTACCAGGAACAGGGT  739

seq1  TCTAGGCACAGCTAGTTTATGCAGTGTTTAGGATCAAACCAGGGCTTGAT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGGCACAGCTAGTTTATGCAGTGTTTAGGATCAAACCAGGGCTTGAT  789

seq1  GTTGGCTAGGCATGAACTCTACCAACTAATCTACATGCTCCATCCCCAAA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGCTAGGCATGAACTCTACCAACTAATCTACATGCTCCATCCCCAAA  839

seq1  ACATTCTTCTTTAACAACAGATTTCACTTTATTTTATTCACTTTGAGTTA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTCTTCTTTAACAACAGATTTCACTTTATTTTATTCACTTTGAGTTA  889

seq1  GTAATCTACTTCAGTGTTTGGGACATGCCCTGATCTGTGGTTAATGAATT  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATCTACTTCAGTGTTTGGGACATGCCCTGATCTGTGGTTAATGAATT  939

seq1  TATTGAGTTTCTGTTATAGAAAACGGATTTTGCCTTTGAAGTGGATAGCA  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGAGTTTCTGTTATAGAAAACGGATTTTGCCTTTGAAGTGGATAGCA  989

seq1  ATTACACGTAGCTTCTTGGTTAACAGTGGAAGTCTCTGTCCATTTATCAG  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACACGTAGCTTCTTGGTTAACAGTGGAAGTCTCTGTCCATTTATCAG  1039

seq1  ATTCAGTGCTGGGACTTGATCTAGCTTGAACCTGTGCAGGCCCTGTGCAT  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCAGTGCTGGGACTTGATCTAGCTTGAACCTGTGCAGGCCCTGTGCAT  1089

seq1  ATTGCCAGTCATTGTGAATTC  1119
      |||||||||||||||||||||
seq2  ATTGCCAGTCATTGTGAATTC  1110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information