MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-288P03
Chromosome	X (Build37)
Map Location	34,924,016 - 34,924,842
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG621901, Pgrmc1, B230333C21Rik, LOC621983, Slc25a43, Slc25a5, C330007P06Rik, Ube2a, Nkrf, Sept6, Ankrd58, Rpl39, Upf3b, 2610020O08Rik, Akap14, Ndufa1, Rnf113a1, Gm9, Rhox1, Rhox2, Rhox3, Rhox4a, LOC100039913, Rhox4b, LOC100039948, Rhox4c, EG434760, LOC546295
Downstream gene	Rhox4d, LOC100040016, Rhox4e, LOC100040043, LOC621852, Rhox4h, LOC546294, EG621903, EG434766, Rhox4g, EG434758, LOC622301, EG622311, Rhox6, Rhox7, Rhox8, LOC436198, Rhox9, LOC100039620, 4930525M21Rik, 4930430D24Rik, Rhox10, Rhox11, Rhox12, 1700123J19Rik, Zbtb33, 6430550H21Rik, EG665331, Atp1b4, Gm40, EG227112, Lamp2, LOC100040971, EG665352, LOC670495, Cul4b
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG621901 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621901 MGI:3644556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pgrmc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53328 MGI:1858305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230333C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338351 MGI:2443758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 514 ESTs, 10 Proteins pseudo : _no_value

name	Slc25a43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194744 MGI:2684854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins

name	Slc25a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11740 MGI:1353496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330007P06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77644 MGI:1924894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 231 ESTs, 4 Proteins

name	Ube2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22209 MGI:102959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkrf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77286 MGI:1924536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56526 MGI:1888939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245381 MGI:3045274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67248 MGI:1914498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upf3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68134 MGI:1915384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610020O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67050 MGI:1914300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434756 MGI:3618288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54405 MGI:1929511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf113a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69942 MGI:1917192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194854 MGI:2684855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385343 MGI:3580237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75199 MGI:1922449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382209 MGI:2676626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664609 MGI:3580240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039913 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039913
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 8 ESTs, 9 Proteins

name	Rhox4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57737 MGI:1930129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 8 ESTs, 9 Proteins

name	Rhox4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434759 MGI:3613386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434760 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434760 MGI:3648779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	Rhox4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664610 MGI:3613388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040016 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 8 ESTs, 6 Proteins

name	Rhox4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194856 MGI:3613390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040043 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 4 ESTs, 8 Proteins

name	LOC621852 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox4h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636177 MGI:3613392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 7 Proteins

name	EG621903 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621903 MGI:3645894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 81 ESTs, 2 Proteins

name	EG434766 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434766 MGI:3648776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 8 Proteins

name	Rhox4g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664608 MGI:3613394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434758 MGI:3704137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 3 ESTs, 8 Proteins

name	LOC622301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 5 ESTs, 5 Proteins

name	EG622311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622311 MGI:3646282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Rhox6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19202 MGI:1202888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547168 MGI:3580246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434768 MGI:3579898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436198
definition	gene_synonym : Rhox7-like note : reproductive homeobox 7 pseudogene pseudo : _no_value

name	Rhox9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104384 MGI:1890128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039620 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039620
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	4930525M21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436199 MGI:3588262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	4930430D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194735 MGI:3588265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434769 MGI:3580249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194738 MGI:2681831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382282 MGI:2685994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700123J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73614 MGI:1920864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	Zbtb33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56805 MGI:1927290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	6430550H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245386 MGI:3045722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665331 MGI:3643148
definition	note : predicted gene, EG665331 pseudo : _no_value

name	Atp1b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67821 MGI:1915071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194740 MGI:2684886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG227112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227112 MGI:3644655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 272 ESTs, 5 Proteins

name	Lamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16784 MGI:96748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG665352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665352 MGI:3644312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC670495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cul4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72584 MGI:1919834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621901 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407282 GeneID:621901 MGI:3644556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG621901 transcript_id : XM_896717.2

name	Pgrmc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131178 GeneID:53328 MGI:1858305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progesterone receptor membrane component 1 transcript_id : NM_016783.3

name	B230333C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432545 GeneID:338351 MGI:2443758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230333C21 gene transcript_id : NM_001081956.1

name	Slc25a43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407274 GeneID:194744 MGI:2684854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins product : solute carrier family 25, member 43, transcript variant 1 transcript_id : XM_110743.5

name	Slc25a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360208 GeneID:11740 MGI:1353496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5 transcript_id : NM_007451.3

name	C330007P06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271496 GeneID:77644 MGI:1924894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 230 ESTs, 4 Proteins product : RIKEN cDNA C330007P06 gene, transcript variant 2 transcript_id : XM_895881.3

name	Ube2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130597 GeneID:22209 MGI:102959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2A, RAD6 homolog (S. cerevisiae) transcript_id : NM_019668.3

name	Nkrf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78191783 GeneID:77286 MGI:1924536
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NF-kappaB repressing factor transcript_id : NM_029891.2

name	Sept6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382370 GeneID:56526 MGI:1888939
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 6 transcript_id : NM_019942.3

name	Ankrd58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372809 GeneID:245381 MGI:3045274
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 58 transcript_id : NM_173779.3

name	Rpl39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385551 GeneID:67248 MGI:1914498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L39 transcript_id : NM_026055.1

name	Upf3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801318 GeneID:68134 MGI:1915384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UPF3 regulator of nonsense transcripts homolog B (yeast) transcript_id : NM_026573.2

name	2610020O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802718 GeneID:67050 MGI:1914300
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610020O08 gene transcript_id : NM_025937.3

name	Akap14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366588 GeneID:434756 MGI:3618288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 14 transcript_id : NM_001033785.2

name	Ndufa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110556627 GeneID:54405 MGI:1929511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 transcript_id : NM_019443.2

name	Rnf113a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943839 GeneID:69942 MGI:1917192
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 113A1 transcript_id : NM_153503.1

name	Gm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387066 GeneID:194854 MGI:2684855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 9, (NCBI) transcript_id : NM_001033234.2

name	Rhox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311557 GeneID:385343 MGI:3580237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 1 transcript_id : NM_001025084.2

name	Rhox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598897 GeneID:75199 MGI:1922449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 2 transcript_id : NM_029203.2

name	Rhox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73088779 GeneID:382209 MGI:2676626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 3 transcript_id : NM_194063.2

name	Rhox4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242155 GeneID:664609 MGI:3580240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 4A transcript_id : NM_001039688.1

name	LOC100039913 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271497 GeneID:100039913
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 1 transcript_id : XM_001474057.1

name	LOC100039913 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271499 GeneID:100039913
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 7 ESTs, 9 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 2 transcript_id : XM_001474076.1

name	Rhox4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242132 GeneID:57737 MGI:1930129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 4B transcript_id : NM_021300.2

name	LOC100039948 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271501 GeneID:100039948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 1 transcript_id : XM_001474133.1

name	LOC100039948 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271503 GeneID:100039948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 7 ESTs, 9 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 2 transcript_id : XM_001474151.1

name	Rhox4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242149 GeneID:434759 MGI:3613386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 4C transcript_id : NM_001039689.1

name	EG434760 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133779005 GeneID:434760 MGI:3648779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434760 transcript_id : NM_001081669.2

name	Rhox4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242161 GeneID:664610 MGI:3613388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 4D transcript_id : NM_001039695.1

name	LOC100040016 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271506 GeneID:100040016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 1 transcript_id : XM_001474270.1

name	LOC100040016 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271508 GeneID:100040016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 7 ESTs, 6 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 2 transcript_id : XM_001474291.1

name	Rhox4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242131 GeneID:194856 MGI:3613390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 4E transcript_id : NM_201236.3

name	LOC100040043 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271512 GeneID:100040043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 3 ESTs, 8 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 2 transcript_id : XM_001474397.1

name	LOC100040043 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271510 GeneID:100040043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to reproductive homeobox on X chromosome 2, transcript variant 1 transcript_id : XM_001474373.1

name	LOC621852 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:91598659 GeneID:621852
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to similar to testis expressed homeobox 2 transcript_id : NM_001040089.1

name	Rhox4h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242159 GeneID:636177 MGI:3613392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 4H transcript_id : NM_001039696.1

name	LOC546294 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407302 GeneID:546294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 7 Proteins product : similar to testis expressed homeobox 2, transcript variant 2 transcript_id : XM_976278.1

name	EG621903 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271514 GeneID:621903 MGI:3645894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 81 ESTs, 2 Proteins product : predicted gene, EG621903 transcript_id : XM_885629.3

name	EG434766 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407309 GeneID:434766 MGI:3648776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 8 Proteins product : predicted gene, EG434766 transcript_id : XM_486662.3

name	Rhox4g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242157 GeneID:664608 MGI:3613394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 4G transcript_id : NM_001039698.1

name	EG434758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271517 GeneID:434758 MGI:3704137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 8 Proteins product : predicted gene, EG434758, transcript variant 2 transcript_id : XM_885355.3

name	EG434758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271515 GeneID:434758 MGI:3704137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG434758 transcript_id : XM_001474585.1

name	LOC622301 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271518 GeneID:622301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 5 ESTs, 5 Proteins product : similar to reproductive homeobox on X chromosome 2 transcript_id : XM_886726.3

name	EG622311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271493 GeneID:622311 MGI:3646282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG622311 transcript_id : XM_886739.2

name	Rhox6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679512 GeneID:19202 MGI:1202888
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 6 transcript_id : NM_008955.1

name	Rhox7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480151 GeneID:547168 MGI:3580246
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 7 transcript_id : NM_001025086.1

name	Rhox8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598892 GeneID:434768 MGI:3579898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 8 transcript_id : NM_001004193.2

name	Rhox9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963858 GeneID:104384 MGI:1890128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 9 transcript_id : NM_023894.1

name	LOC100039620 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271519 GeneID:100039620
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to reproductive homeobox on X chromosome 11 transcript_id : XM_001473213.1

name	4930525M21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407316 GeneID:436199 MGI:3588262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : RIKEN cDNA 4930525M21 gene transcript_id : XM_975819.1

name	4930430D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803081 GeneID:194735 MGI:3588265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930430D24 gene transcript_id : NM_001034856.2

name	Rhox10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206460 GeneID:434769 MGI:3580249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 10 transcript_id : NM_001024850.2

name	Rhox11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206457 GeneID:194738 MGI:2681831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 11 transcript_id : NM_198598.2

name	Rhox12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206459 GeneID:382282 MGI:2685994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 12 transcript_id : NM_001025083.2

name	1700123J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271546 GeneID:73614 MGI:1920864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA 1700123J19 gene transcript_id : XM_976021.2

name	Zbtb33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118442831 GeneID:56805 MGI:1927290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 33 transcript_id : NM_020256.2

name	Zbtb33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118442829 GeneID:56805 MGI:1927290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 33 transcript_id : NM_001079513.1

name	6430550H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254260 GeneID:245386 MGI:3045722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430550H21 gene transcript_id : NM_172930.2

name	Atp1b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130945 GeneID:67821 MGI:1915071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, (Na+)/K+ transporting, beta 4 polypeptide transcript_id : NM_133690.2

name	Gm40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271548 GeneID:194740 MGI:2684886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : gene model 40, (NCBI) transcript_id : XM_111896.2

name	EG227112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407323 GeneID:227112 MGI:3644655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 272 ESTs, 5 Proteins product : predicted gene, EG227112 transcript_id : XM_887151.2

name	Lamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63054836 GeneID:16784 MGI:96748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated membrane protein 2 transcript_id : NM_001017959.1

name	Lamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63054835 GeneID:16784 MGI:96748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated membrane protein 2 transcript_id : NM_010685.3

name	LOC100040971 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271550 GeneID:100040971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040971 transcript_id : XM_001475716.1

name	Cul4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345589 GeneID:72584 MGI:1919834
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cullin 4B transcript_id : NM_028288.4

name	EG621901 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407283 GeneID:621901 MGI:3644556
definition	codon_start : 1 product : similar to Novel transcript protein_id : XP_901810.2

name	Pgrmc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980806 CCDS:CCDS30060.1 GeneID:53328 MGI:1858305
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] codon_start : 1 product : progesterone receptor membrane component protein_id : NP_058063.2

name	B230333C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432546 GeneID:338351 MGI:2443758
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Talia protein_id : NP_001075425.1

name	Slc25a43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086109 GeneID:194744 MGI:2684854
definition	codon_start : 1 product : similar to novel mitochondrial carrier domain-containing protein isoform 1 protein_id : XP_110743.3

name	Slc25a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094075 CCDS:CCDS30062.1 GeneID:11740 MGI:1353496
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : adenine nucleotide translocator 2, fibroblast; adenine nucleotide translocase product : solute carrier family 25, member 5 protein_id : NP_031477.1

name	C330007P06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000747 GeneID:77644 MGI:1924894
definition	codon_start : 1 product : hypothetical protein LOC77644 isoform 2 protein_id : XP_900974.1

name	Ube2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790041 CCDS:CCDS30064.1 GeneID:22209 MGI:102959
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006464 - protein modification [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin-conjugating enzyme HR6A; ubiquitin-conjugating enzyme E2A (RAD6 homolog) product : ubiquitin-conjugating enzyme E2A, RAD6 homolog protein_id : NP_062642.1

name	Nkrf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78191784 CCDS:CCDS30065.1 GeneID:77286 MGI:1924536
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : NF-kappaB repressing factor protein_id : NP_084167.2

name	Sept6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560370 CCDS:CCDS30066.1 GeneID:56526 MGI:1888939
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : septin 6 protein_id : NP_064326.2

name	Ankrd58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424651 CCDS:CCDS30067.1 GeneID:245381 MGI:3045274
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : ankyrin repeat domain 58 protein_id : NP_776140.1

name	Rpl39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385552 GeneID:67248 MGI:1914498
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L39 protein_id : NP_080331.1

name	Upf3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74959788 CCDS:CCDS30068.1 GeneID:68134 MGI:1915384
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003729 - mRNA binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006986 - response to unfolded protein [Evidence ISS] codon_start : 1 note : hUPF3B product : UPF3 regulator of nonsense transcripts homolog B protein_id : NP_080849.1

name	2610020O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541903 CCDS:CCDS30069.1 GeneID:67050 MGI:1914300
definition	codon_start : 1 exception : mismatches in translation product : nuclear NF-kappaB activating protein protein_id : NP_080213.2

name	Akap14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702101 CCDS:CCDS30070.1 GeneID:434756 MGI:3618288
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 note : A-kinase anchor protein 28 product : A kinase (PRKA) anchor protein 14 protein_id : NP_001028957.1

name	Ndufa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506911 GeneID:54405 MGI:1929511
definition	EC_number : 1.6.99.3 GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : NADH ubiquinone oxidoreductase subunit MWFE; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE); NADH dehydrogenase 1 alpha subcomplex, 1 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 protein_id : NP_062316.1

name	Rnf113a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943840 CCDS:CCDS30072.1 GeneID:69942 MGI:1917192
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 113A1 protein_id : NP_705723.1

name	Gm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701742 CCDS:CCDS30073.1 GeneID:194854 MGI:2684855
definition	codon_start : 1 product : hypothetical protein LOC194854 protein_id : NP_001028406.1

name	Rhox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115311558 GeneID:385343 MGI:3580237
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : reproductive homeobox on X chromosome 1 product : reproductive homeobox on chromosome X, 1 protein_id : NP_001020255.2

name	Rhox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386376 CCDS:CCDS30075.1 GeneID:75199 MGI:1922449
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : reproductive homeobox on X chromosome, 2 product : reproductive homeobox on X chromosome 2 protein_id : NP_083479.1

name	Rhox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73088780 CCDS:CCDS30076.1 GeneID:382209 MGI:2676626
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : testis expressed homeobox 2; reproductive homeobox on X chromosome, 3 product : reproductive homeobox 3 protein_id : NP_918952.2

name	Rhox4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89242156 GeneID:664609 MGI:3580240
definition	GO_function : GO:0003677 - DNA binding [Evidence ISS] codon_start : 1 product : reproductive homeobox 4A protein_id : NP_001034777.1

name	LOC100039913 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271498 GeneID:100039913
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474107.1

name	LOC100039913 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271500 GeneID:100039913
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474126.1

name	Rhox4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946596 CCDS:CCDS30077.1 GeneID:57737 MGI:1930129
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] codon_start : 1 note : homeobox protein EHOX; reproductive homeobox on X chromosome 4; ES cell derived homeobox; ES cell derived homeobox containing product : reproductive homeobox 4B protein_id : NP_067275.1

name	LOC100039948 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271502 GeneID:100039948
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474183.1

name	LOC100039948 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271504 GeneID:100039948
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474201.1

name	Rhox4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89242150 GeneID:434759 MGI:3613386
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : reproductive homeobox 4C protein_id : NP_001034778.1

name	EG434760 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133779006 GeneID:434760 MGI:3648779
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC434760 protein_id : NP_001075138.2

name	Rhox4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89242162 GeneID:664610 MGI:3613388
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : novel protein similar to reproductive homeobox 4 Rhox4 product : reproductive homeobox 4D protein_id : NP_001034784.1

name	LOC100040016 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271507 GeneID:100040016
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474320.1

name	LOC100040016 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271509 GeneID:100040016
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474341.1

name	Rhox4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955889 CCDS:CCDS30078.1 GeneID:194856 MGI:3613390
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : EHOX-like product : reproductive homeobox 4E protein_id : NP_957688.2

name	LOC100040043 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271511 GeneID:100040043
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474423.1

name	LOC100040043 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271513 GeneID:100040043
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474447.1

name	LOC621852 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:91598660 GeneID:621852
definition	codon_start : 1 exception : mismatches in translation product : similar to similar to testis expressed homeobox 2 protein_id : NP_001035178.1

name	Rhox4h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89242160 GeneID:636177 MGI:3613392
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : reproductive homeobox 4H protein_id : NP_001034785.1

name	LOC546294 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407303 GeneID:546294
definition	codon_start : 1 product : similar to reproductive homeobox on X chromosome 3 isoform 2 protein_id : XP_981372.1

name	EG621903 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000828 GeneID:621903 MGI:3645894
definition	codon_start : 1 product : similar to PGC7 protein_id : XP_890722.1

name	EG434766 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407310 GeneID:434766 MGI:3648776
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486662.2

name	Rhox4g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89242158 GeneID:664608 MGI:3613394
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : reproductive homeobox 4G protein_id : NP_001034787.1

name	EG434758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271516 GeneID:434758 MGI:3704137
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474635.1

name	EG434758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407312 GeneID:434758 MGI:3704137
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_890448.2

name	LOC622301 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407314 GeneID:622301
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891819.2

name	EG622311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271494 GeneID:622311 MGI:3646282
definition	codon_start : 1 product : similar to reproductive homeobox on X chromosome 7 protein_id : XP_891832.2

name	Rhox6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679513 CCDS:CCDS30080.1 GeneID:19202 MGI:1202888
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : placenta specific homeobox 1 product : reproductive homeobox on X chromosome, 6 protein_id : NP_032981.1

name	Rhox7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480152 CCDS:CCDS30081.1 GeneID:547168 MGI:3580246
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : reproductive homeobox on X chromosome 7 product : reproductive homeobox on chromosome X, 7 protein_id : NP_001020257.1

name	Rhox8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921377 CCDS:CCDS30082.1 GeneID:434768 MGI:3579898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : homeoprotein TOX product : reproductive homeobox on X chromosome, 8 protein_id : NP_001004193.1

name	Rhox9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963859 CCDS:CCDS30083.1 GeneID:104384 MGI:1890128
definition	GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] codon_start : 1 note : placenta specific homeobox 2 product : reproductive homeobox on X chromosome, 9 protein_id : NP_076383.1

name	LOC100039620 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271520 GeneID:100039620
definition	codon_start : 1 product : similar to reproductive homeobox on X chromosome 11 protein_id : XP_001473263.1

name	4930525M21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407317 GeneID:436199 MGI:3588262
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980913.1

name	4930430D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702197 GeneID:194735 MGI:3588265
definition	codon_start : 1 note : novel protein similar to B-cell translocation gene 1, anti-proliferative Btg1 product : hypothetical protein LOC194735 protein_id : NP_001030028.1

name	Rhox10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480140 GeneID:434769 MGI:3580249
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : reproductive homeobox on X chromosome 10 product : reproductive homeobox on chromosome X, 10 protein_id : NP_001020021.1

name	Rhox11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348444 CCDS:CCDS30086.1 GeneID:194738 MGI:2681831
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : reproductive homeobox on X chromosome, 11 protein_id : NP_941000.1

name	Rhox12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480146 CCDS:CCDS30087.1 GeneID:382282 MGI:2685994
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : reproductive homeobox on X chromosome, 12 protein_id : NP_001020254.1

name	1700123J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271547 GeneID:73614 MGI:1920864
definition	codon_start : 1 product : hypothetical protein LOC73614 protein_id : XP_981115.2

name	Zbtb33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118442830 GeneID:56805 MGI:1927290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : zinc finger transcription factor Kaiso product : kaiso protein protein_id : NP_001072981.1

name	Zbtb33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118442832 CCDS:CCDS30088.1 GeneID:56805 MGI:1927290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : zinc finger transcription factor Kaiso product : kaiso protein protein_id : NP_064652.2

name	6430550H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254261 CCDS:CCDS30089.1 GeneID:245386 MGI:3045722
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245386 protein_id : NP_766518.2

name	Atp1b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526860 CCDS:CCDS30090.1 GeneID:67821 MGI:1915071
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, Na+/K+ transporting, beta 4 polypeptide product : ATPase, (Na+)/K+ transporting, beta 4 polypeptide protein_id : NP_598451.1

name	Gm40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271549 GeneID:194740 MGI:2684886
definition	codon_start : 1 product : similar to CDNA sequence BC049702 protein_id : XP_111896.2

name	EG227112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000880 GeneID:227112 MGI:3644655
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892244.1

name	Lamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63054837 CCDS:CCDS30092.1 GeneID:16784 MGI:96748
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence ISS] [Evidence IDA]; GO:0005765 - lysosomal membrane [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0031088 - platelet dense granule membrane [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; lysosome-associated membrane protein-2; Lamp II; lysosomal membrane glycoprotein 2 product : lysosomal membrane glycoprotein 2 isoform 1 protein_id : NP_001017959.1

name	Lamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543108 CCDS:CCDS30093.1 GeneID:16784 MGI:96748
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence ISS] [Evidence IDA]; GO:0005765 - lysosomal membrane [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0031088 - platelet dense granule membrane [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; lysosome-associated membrane protein-2; Lamp II; lysosomal membrane glycoprotein 2 product : lysosomal membrane glycoprotein 2 isoform 2 protein_id : NP_034815.2

name	LOC100040971 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271551 GeneID:100040971
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475766.1

name	Cul4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29501811 GeneID:72584 MGI:1919834
definition	codon_start : 1 exception : mismatches in translation product : cullin 4B protein_id : NP_082564.2

name	EG665352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665352
definition	number : 1 pseudo : _no_value

name	LOC670495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670495
definition	number : 1 pseudo : _no_value

name	LOC670495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670495
definition	number : 2 pseudo : _no_value

name	LOC621983 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271495 GeneID:621983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 514 ESTs, 10 Proteins product : similar to Ribosomal protein L7 pseudo : _no_value transcript_id : XR_031283.1

name	LOC546295 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271505 GeneID:546295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to reproductive homeobox on X chromosome 3 pseudo : _no_value transcript_id : XR_031662.1

clone name	MSMg01-124M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336H18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-411K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-057A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-431K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522A16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243J09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-288P03.b	B6Ng01-288P03.g
ACC	GA086477	GA086478
length	1,137	1,190
definition	B6Ng01-288P03.b	B6Ng01-288P03.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	tcatataaagaggaaaaagtccattagaacaacaccagagtcctcagtgg aaactcggaaatcctgaggaccctggcgcaatgttctaaaggatggcaac tgccagtctagactactatacccagcaaaactatacaccaaaattgtaaa agaaagaaaaaaggtcttgttacatgcatggtagaattcatgtccaccaa accagctctacagagaatattggaggcaaaatgtcagaatgaggagaaaa aatgagcatatcaattgactctatatgaacaggtgaagctatggttactg aaacacaacatgggaccacacacacacaaaacaaagaagaacaataaaac tgctgcaaacaacacacacatttcaataacacctttaacgattcatagcc ttaactactccacaaaaagacacaatttggatgaacaaattaagaaagaa actctaacttttgctgtctaaaagaaactcttcttatcttgaaggacagt gaaaggttgtgtggaaaaatattccaagcaaatgggaccaggaaacaaga acatggtcctatcctaatatctgagcaaaaatccccttgccttccaacta aaattgatcataaacaataagggagaacactttattctaagcgaaagaca ctaaacacatacactcacacacacatggataaatacaaacatgtaaacac tcatatacacacactcacactccaccttacacactcagttaaagtcacac atgcactcacactaacacccaaaacacaataacacaacacacactcactc ccacaactctctttcatgcacactcatatacatgcacacactcacacatt cacacatactcacacacttaaccattataccacacttagtagagatacac actcatacagaaatacagtaattcagtcacaaaagaacacacatggcatg cactcactaataagtggatattagcccaaaatgtttcagaatatccaaga ttcaattccacagaccatatgaagcccaaaaagaagtaagaccaaacctg tggggtgcttactactctagaaggctggaccaaaatattccacagagcaa atatggagaagaaagtatggagcaaagaggtgaaaaa	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaaat gttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgaga ttccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacag cagatgctggcgtggatgtggagaaagaggaacactcctccattgttggt gggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctc agaaaactggacatcgtactaccggaggatccagcaatacctctcctggg catatatccagaagatgccccaactggtaagaaggacacatgctccacta tgttcatagcagccttatttataatagccagaagctggaaagaacccaga tgcccctcaacagaggaatggatacagaaaatgtggtacatctacacaat ggagtactactcagctattaaaaagaatgaatttatgaaattcctagcca aatggatggacctggagggcatcatcctgagtgaggtaacacattcacaa agaaactcacacaatatgtactcactgttaagtggatattagccccaaac ctaggatacccaagatataagatataatttgctaaacacatgaaactcaa gaagattgaagactgaagtgtgggcactatgcccctccttagatttggga acaaaacacccatggaaggagttacagagacaaggtttggagctgagacg aaaggatggaccacgtagagactgccatatccagggatccaacccataat cagcatccaaacgctgacaccattgcatacactagcaagattttattgaa aggacccagatgtagctgtctcttgtgagactatgccgggcctagcaaac acagaagtggatgctcacagtcagctaatggatggatcatagggctccca atggaggagctagagaaagtagccaaggagctaaagggatctgcacccta tagtggaacaacattatgaactaaccagtacccggagctcttgacttcta gcttacatatattatcaaaagatgggccctagtcggccaatcaactgcaa gagaggccccaatgaacttggcaacctttatatgccccagttaccaggta accatcaggccaaaaaagggggaattgggtgtgtgtgtca
quality values	Open. Hide. 58 39 39 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 47 47 62 54 62 26 44 38 51 24 28 28 22 28 23 36 56 46 59 46 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 59 49 62 62 54 42 38 48 56 62 59 56 59 54 48 59 62 59 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 62 59 59 62 59 62 62 54 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 47 38 49 62 62 62 54 58 54 58 42 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 54 54 58 58 58 47 58 52 58 52 58 58 58 58 54 58 58 58 52 54 52 41 52 54 58 58 54 54 42 54 58 58 49 58 58 58 44 58 58 58 52 58 52 58 52 58 58 58 48 58 58 54 49 54 58 49 58 37 58 45 48 58 58 58 58 46 50 54 58 53 53 46 54 50 58 53 51 58 51 52 58 33 36 46 36 21 58 44 51 52 51 41 54 48 58 49 32 58 58 58 58 58 58 58 58 58 58 58 49 58 58 39 52 37 58 58 51 50 58 58 58 58 32 50 58 51 35 42 58 58 46 49 58 58 51 43 51 54 40 50 54 53 54 51 54 51 58 58 52 54 49 51 54 58 50 31 50 43 58 58 44 50 50 50 43 51 38 51 50 50 49 58 50 50 49 33 47 49 42 42 42 50 54 40 53 49 49 49 49 54 42 30 47 44 40 32 41 44 37 31 39 54 49 27 54 54 35 47 36 49 24 36 25 30 34 44 24 45 32 42 51 40 47 37 37 40 51 44 31 22 52 51 21 54 42 36 36 21 44 40 54 37 38 39 40 54 54 32 26 17 40 52 29 45 31 35 52 34 27 31 36 40 28 40 29 53 53 45 34 52 32 42 31 47 47 40 26 32 31 34 19 18 34 31 28 45 31 31 32 41 35 38 41 26 29 31 27 43 30 33 42 42 14 9 12 30 18 30 42 34 34 19 17 42 25 31 28 30 31 42 36 31 21 36 27 38 24 31 28 29 35 23 31 21 28 31 36 31 30 28 31 24 30 33 46 30 28 25 30 32 36 32 31 32 27 31 29 27 30 35 34 33 33 31 41 46 8 8 30 30 24 19 30 32 31 20 31 31 44 31 28 31 31 24 22 28 34 34 24 32 34 33 28 7 6 34 24 24 18 25 11 7 5 8 31 32 25 31 44 21 10 41 44 21 19 33 7 44 9 24 23 17 31 19 13 9 18 21 32 17 24 13 32 15 17 32 13 12 24 16 16 7 9 15 8 11 30 11 16 17 19 24 32 31 16 20 23 19 25 20 19 37 39 37 30 12 25 29 17 20 15 11 17 28 11 13 17 28 27 8 11 19 10 5 6 33 30 18 12 18 7 16 25 27 27 13 10 11 32 6 3 9 13 15 22 6 11 15 28 11 8 19 4 13 10 21 34 11 6 7 4 27 11 8 9 11 4 12 3 4 12 16 24 9 13 12 17 18 15 10 12 7 10 8 10 21 17 5 3 6 8 14 6 7 5 11 3 7 14 8 11 7 7 9 7 9 7 20 17 15	Open. Hide. 62 49 39 41 62 62 62 47 42 62 62 62 35 33 14 28 21 27 43 51 24 31 28 43 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 48 48 46 51 56 59 59 62 62 62 62 59 54 42 54 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 49 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 56 56 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 54 45 48 58 58 58 58 58 54 54 58 58 58 48 58 58 58 58 45 41 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 42 58 52 54 58 54 54 54 52 58 58 58 54 58 54 58 58 58 58 58 51 58 58 58 51 58 54 58 46 58 58 58 58 46 50 48 43 50 51 51 58 58 58 58 58 50 58 58 58 58 49 58 42 49 58 54 54 47 49 49 49 54 50 49 51 48 44 50 52 38 58 33 49 52 47 58 43 31 58 50 58 53 49 47 58 58 51 51 31 47 53 49 58 48 58 58 54 58 41 39 58 51 50 40 54 37 58 51 51 58 58 44 58 53 53 52 52 58 49 39 39 19 50 58 58 54 50 41 41 58 58 52 58 50 53 51 50 58 58 44 47 42 53 53 50 46 50 50 51 54 51 35 30 51 51 52 37 31 51 32 54 49 49 54 52 49 40 40 28 52 54 40 53 43 53 44 39 38 37 37 51 40 39 15 54 34 32 37 47 34 47 42 45 54 37 53 38 40 45 28 49 40 54 46 47 52 51 24 43 53 37 54 22 37 23 26 54 54 33 29 53 32 31 33 52 31 26 52 40 40 32 47 42 35 53 27 29 32 35 40 23 40 27 45 37 34 22 27 25 37 53 46 19 31 30 53 25 27 34 40 41 32 41 32 35 33 31 37 31 31 23 43 31 33 21 46 33 31 31 41 31 31 43 28 18 33 30 30 36 31 31 27 24 32 31 31 30 43 31 31 28 42 25 33 32 32 24 48 48 43 34 36 42 42 35 46 16 14 16 30 13 41 26 19 19 30 31 43 31 31 30 34 43 38 31 36 31 34 30 27 31 26 32 41 18 31 23 37 32 33 31 27 31 30 41 9 7 11 34 34 28 38 31 39 20 16 17 30 23 30 34 34 22 29 34 21 34 22 31 32 22 25 24 32 32 38 32 34 33 31 38 37 19 30 25 30 34 18 17 27 19 23 32 26 21 32 32 22 48 35 20 37 24 41 28 17 17 27 21 24 7 4 10 33 14 32 32 17 19 28 17 34 48 30 22 32 22 23 33 23 22 21 16 16 32 11 21 34 18 39 16 4 32 14 14 21 27 31 23 14 31 12 21 19 14 20 31 14 43 5 9 21 21 8 23 29 10 22 13 27 24 28 27 15 13 15 15 17 18 18 11 14 9 6 12 21 16 34 21 10 13 14 7 14 28 24 10 22 22 28 16 19 8 7 26 24 22 25 12 6 5 12 7 9 5 6 8 5 3 4 7 8 27 28 28 4 6 9 8 5 27 11 8 24 11 20 20 4 2 3 14 4 7 8 7 4 7 4 5 8 8 9 2 1 4 2 8 16 8 19 7 15 6 27 13 9 6 4 8 3 2 4 19 20 14 7 5 12 15 16 4 4 17 27 11 5 7 6 7 6 14 25 13 11 12 6 4 5 6 4 4 6 22 5 1 3 2 7 5 5 4 9 2 3 3 2 3 9 16 16 16 16 15 10 24 7 22 5 3 7 4 3 5 4 7 7 17 9 12 6 11 5 3 2 3 2

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_34924016_34924842
seq2: B6Ng01-288P03.b_362_1193

seq1  CAACATGGGACCACACACACACAAAACAAAGAAGAACAATAAAACTGCTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACATGGGACCACACACACACAAAACAAAGAAGAACAATAAAACTGCTG  50

seq1  CAAACAACACACACATTTCAATAACACCTTTAACGATTCATAGCCTTAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACAACACACACATTTCAATAACACCTTTAACGATTCATAGCCTTAAC  100

seq1  TACTCCACAAAAAGACACAATTTGGATGAACAAATTAAGAAAGAAACTCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTCCACAAAAAGACACAATTTGGATGAACAAATTAAGAAAGAAACTCT  150

seq1  AACTTTTGCTGTCTAAAAGAAACTCTTCTTATCTTGAAGGACAGTGAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTTGCTGTCTAAAAGAAACTCTTCTTATCTTGAAGGACAGTGAAAG  200

seq1  GTTGTGTGGAAAAATATTCCAAGCAAATGGGACCAGGAAACAAGAACATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTGTGGAAAAATATTCCAAGCAAATGGGACCAGGAAACAAGAACATG  250

seq1  GTCCTATCCTAATATCTGAGCAAAAATCCCCTTGCCTTCCAACTAAAATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTATCCTAATATCTGAGCAAAAATCCCCTTGCCTTCCAACTAAAATT  300

seq1  GATCATAAACAATAAGGGAGAACACTTTATTCTAAGCGAAAGACACTAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCATAAACAATAAGGGAGAACACTTTATTCTAAGCGAAAGACACTAAA  350

seq1  CACATACACTCACACACACATGGATAAATACAAACATGTAAACACTCATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATACACTCACACACACATGGATAAATACAAACATGTAAACACTCATA  400

seq1  TACACACACTCACACTCCACCTTACACACTCAGTTAAAGTCACACATGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACACACTCACACTCCACCTTACACACTCAGTTAAAGTCACACATGCA  450

seq1  CTCACACTAACACCCAAAACACAATAACACAACACACACTCACTCCCACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACACTAACACCCAAAACACAATAACACAACACACACTCACTCCCACA  500

seq1  ACTCTCTTTCATGCACACTCATATACATGCACACACTCACACATTCACAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTCTTTCATGCACACTCATATACATGCACACACTCACACATTCACAC  550

seq1  ATACTCACACACTTAACCATTATACCACACTTAGTAGAGATACACACTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTCACACACTTAACCATTATACCACACTTAGTAGAGATACACACTCA  600

seq1  TACAGAAATACAGTAATTCAGTCACAAAAGAACACACATGGCATGCACTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAAATACAGTAATTCAGTCACAAAAGAACACACATGGCATGCACTC  650

seq1  ACTAATAAGTGGATATTAGCCC-AAATG-TTCAGAATATCCAAGATTCAA  698
      |||||||||||||||||||||| ||||| |||||||||||||||||||||
seq2  ACTAATAAGTGGATATTAGCCCAAAATGTTTCAGAATATCCAAGATTCAA  700

seq1  TT-CACAGACCATATGAAGCCCAAAAAGAAGTAAGACCAAA-CTGT-GGG  745
      || |||||||||||||||||||||||||||||||||||||| |||| |||
seq2  TTCCACAGACCATATGAAGCCCAAAAAGAAGTAAGACCAAACCTGTGGGG  750

seq1  TGCTTTACTACTTCTTAGAAGGCT-GAACAAAATATT-CACAGGAGCAAA  793
      ||| ||||||||   ||||||||| || ||||||||| |||| |||||||
seq2  TGC-TTACTACT--CTAGAAGGCTGGACCAAAATATTCCACA-GAGCAAA  796

seq1  TATGGAG-AGAAAGTATGGAGCAGAGA-GTGAAAAA  827
      ||||||| ||||||||||||||| ||| ||||||||
seq2  TATGGAGAAGAAAGTATGGAGCAAAGAGGTGAAAAA  832

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information