MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-293M20
Chromosome	X (Build37)
Map Location	97,004,454 - 97,215,766
singlet/doublet	doublet
Overlap gene	EG620592, Eda
Upstream gene	Ophn1, Yipf6, LOC100042932, Stard8, LOC436219, Efnb1, Pja1, LOC100042947, Pcna-ps1
Downstream gene	Dgat2l4, Otud6a, Igbp1, LOC668257, Dgat2l3, LOC620734, P2ry4, Arr3, Pdzd11, Kif4, Gdpd2, Dlg3, Tex11
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ophn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94190 MGI:2151070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yipf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77929 MGI:1925179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins pseudo : _no_value

name	Stard8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236920 MGI:2448556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins pseudo : _no_value

name	Efnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13641 MGI:102708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pja1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18744 MGI:1101765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Pcna-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18539 MGI:97504
definition	note : proliferating cell nuclear antigen pseudogene 1 pseudo : _no_value

name	EG620592 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620592 MGI:3648377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13607 MGI:1195272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgat2l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245532 MGI:3045345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otud6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408193 MGI:3644685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins

name	Igbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18518 MGI:1346500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	Dgat2l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245533 MGI:3588200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620734 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	P2ry4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57385 MGI:1926594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170735 MGI:2159617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72621 MGI:1919871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16571 MGI:108389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71584 MGI:1918834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53310 MGI:1888986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83558 MGI:1933237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ophn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345123 GeneID:94190 MGI:2151070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oligophrenin 1 transcript_id : NM_052976.3

name	Yipf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253919 GeneID:77929 MGI:1925179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 domain family, member 6 transcript_id : NM_207633.2

name	Stard8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39841034 GeneID:236920 MGI:2448556
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : START domain containing 8 transcript_id : NM_199018.1

name	Efnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802568 GeneID:13641 MGI:102708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin B1 transcript_id : NM_010110.3

name	Pja1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133505553 GeneID:18744 MGI:1101765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : praja1, RING-H2 motif containing transcript_id : NM_008853.3

name	Pja1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506755 GeneID:18744 MGI:1101765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : praja1, RING-H2 motif containing transcript_id : NM_001083110.1

name	LOC100042947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271833 GeneID:100042947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to ribosomal protein L37 transcript_id : XM_001478804.1

name	EG620592 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486868 GeneID:620592 MGI:3648377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG620592 transcript_id : NM_001081283.1

name	Eda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893370 GeneID:13607 MGI:1195272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectodysplasin-A transcript_id : NM_010099.2

name	Dgat2l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355955 GeneID:245532 MGI:3045345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 2-like 4 transcript_id : NM_177746.3

name	Otud6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51772234 GeneID:408193 MGI:3644685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins product : OTU domain containing 6A transcript_id : XM_486733.1

name	Igbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51479180 GeneID:18518 MGI:1346500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin (CD79A) binding protein 1 transcript_id : NM_008784.2

name	LOC668257 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407683 GeneID:668257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to diacylglycerol O-acyltransferase 2-like 6 (Dgat2l6) transcript_id : XM_001000486.1

name	Dgat2l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487272 GeneID:245533 MGI:3588200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 2-like 3 transcript_id : NM_001081136.1

name	P2ry4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801981 GeneID:57385 MGI:1926594
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrimidinergic receptor P2Y, G-protein coupled, 4 transcript_id : NM_020621.3

name	Arr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131025 GeneID:170735 MGI:2159617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin 3, retinal transcript_id : NM_133205.2

name	Pdzd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348947 GeneID:72621 MGI:1919871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 11 transcript_id : NM_028303.2

name	Kif4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680567 GeneID:16571 MGI:108389
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 4 transcript_id : NM_008446.1

name	Gdpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980660 GeneID:71584 MGI:1918834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerophosphodiester phosphodiesterase domain containing 2 transcript_id : NM_023608.2

name	Dlg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131177 GeneID:53310 MGI:1888986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large homolog 3 (Drosophila) transcript_id : NM_016747.2

name	Tex11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878210 GeneID:83558 MGI:1933237
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 11 transcript_id : NM_031384.1

name	Ophn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16418475 CCDS:CCDS30295.1 GeneID:94190 MGI:2151070
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : oligophrenin 1 protein_id : NP_443208.1

name	Yipf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519049 CCDS:CCDS30296.1 GeneID:77929 MGI:1925179
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Yip1 domain family, member 6 protein_id : NP_997516.1

name	Stard8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841035 CCDS:CCDS30297.1 GeneID:236920 MGI:2448556
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : START domain containing 8 protein_id : NP_950183.1

name	Efnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753726 CCDS:CCDS30298.1 GeneID:13641 MGI:102708
definition	GO_component : GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046875 - ephrin receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007411 - axon guidance [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0009880 - embryonic pattern specification [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0042102 - positive regulation of T cell proliferation [Evidence IDA] codon_start : 1 note : Cek ligand; Cek5 ligand product : ephrin B1 protein_id : NP_034240.1

name	Pja1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50284539 GeneID:18744 MGI:1101765
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; E3 ubiquitin-protein ligase product : praja1 isoform 2 protein_id : NP_032879.2

name	Pja1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133506756 GeneID:18744 MGI:1101765
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; E3 ubiquitin-protein ligase product : praja1 isoform 1 protein_id : NP_001076579.1

name	LOC100042947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271834 GeneID:100042947
definition	codon_start : 1 product : similar to ribosomal protein L37 protein_id : XP_001478854.1

name	EG620592 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486869 GeneID:620592 MGI:3648377
definition	codon_start : 1 note : likely orthologue of H. sapiens transmembrane protein 28 (TMEM28) product : predicted gene, EG620592 protein_id : NP_001074752.1

name	Eda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753712 CCDS:CCDS30299.1 GeneID:13607 MGI:1195272
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0043473 - pigmentation [Evidence IMP]; GO:0042346 - positive regulation of NF-kappaB import into nucleus [Evidence IDA]; GO:0007431 - salivary gland development [Evidence IDA] codon_start : 1 product : ectodysplasin-A protein_id : NP_034229.1

name	Dgat2l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355956 CCDS:CCDS30300.1 GeneID:245532 MGI:3045345
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0047196 - long-chain-alcohol O-fatty-acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0010025 - wax biosynthesis [Evidence IDA] codon_start : 1 product : wax synthase protein_id : NP_808414.2

name	Otud6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772235 GeneID:408193 MGI:3644685
definition	codon_start : 1 product : Hin-6 protease protein_id : XP_486733.1

name	Igbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51479181 CCDS:CCDS30302.1 GeneID:18518 MGI:1346500
definition	GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0009966 - regulation of signal transduction [Evidence IEA]; GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : phosphoprotein, component, 52 kDa; alpha 4 product : immunoglobulin (CD79A) binding protein 1 protein_id : NP_032810.2

name	LOC668257 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407684 GeneID:668257
definition	codon_start : 1 product : similar to diacylglycerol O-acyltransferase 2-like 6 (Dgat2l6) protein_id : XP_001000486.1

name	Dgat2l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487273 GeneID:245533 MGI:3588200
definition	codon_start : 1 product : diacylglycerol O-acyltransferase 2-like 3 protein_id : NP_001074605.1

name	P2ry4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181172 CCDS:CCDS30303.1 GeneID:57385 MGI:1926594
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0019103 - pyrimidine nucleotide binding [Evidence IC]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0045030 - UTP-activated nucleotide receptor activity [Evidence IDA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0030321 - transepithelial chloride transport [Evidence IDA] codon_start : 1 note : P2Y4 receptor; pyrimidinergic receptor P2Y, G-protein coupled, 4 (P2ry4) product : purinergic receptor P2Y, G-protein coupled, 4 protein_id : NP_065646.1

name	Arr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875352 GeneID:170735 MGI:2159617
definition	GO_component : GO:0001750 - photoreceptor outer segment [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0002046 - opsin binding [Evidence IDA]; GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0006897 - endocytosis [Evidence IDA]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IDA] [Evidence IGI]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : retinal cone arrestin 3 product : arrestin 3, retinal protein_id : NP_573468.1

name	Pdzd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312244 CCDS:CCDS30304.1 GeneID:72621 MGI:1919871
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : PDZ domain containing 11 protein_id : NP_082579.1

name	Kif4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680568 CCDS:CCDS30305.1 GeneID:16571 MGI:108389
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : mismatches in translation note : kinesin heavy chain member 4; N-5 kinesin product : kinesin family member 4 protein_id : NP_032472.1

name	Gdpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963749 CCDS:CCDS30306.1 GeneID:71584 MGI:1918834
definition	codon_start : 1 note : osteoblast differentiation promoting factor; glycerophosphodiester phosphodiesterase 3 product : osteoblast differentiation promoting factor protein protein_id : NP_076097.1

name	Dlg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949129 CCDS:CCDS30307.1 GeneID:53310 MGI:1888986
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : discs large homolog 3 product : synapse-associated protein 102 protein_id : NP_058027.1

name	Tex11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878211 CCDS:CCDS30308.1 GeneID:83558 MGI:1933237
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : testis expressed gene 11 protein_id : NP_113561.1

name	LOC620734 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620734
definition	number : 1 pseudo : _no_value

name	LOC620734 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620734
definition	number : 2 pseudo : _no_value

name	LOC620734 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620734
definition	number : 3 pseudo : _no_value

name	LOC100042932 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271832 GeneID:100042932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins product : similar to protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) pseudo : _no_value transcript_id : XR_033864.1

name	LOC436219 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271797 GeneID:436219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_033477.1

clone name	MSMg01-158D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187D23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-276H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-293M20.b	B6Ng01-293M20.g
ACC	GA090092	GA090093
length	1,156	1,086
definition	B6Ng01-293M20.b	B6Ng01-293M20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(97,214,617 - 97,215,766)	(97,004,454 - 97,005,533)
sequence	gaattcctcagcgtgccttctctggaaaaaaatggaaagccatactgtgg aatgagacaaaagcaaagctattggggaaacacaagatgacatgtagcca aaggtcacccaagactgtagagcctttcagagccttgaatacatgaatgc agattttactgtcatattgacaggatctagaatcaccatggaagcaactc tctgttcatgtctgtgagggagtttccagatttagttaatcaaggtgtga ggacccaccttaactgctggtgacactatcccatgagccaggatccagga gtgaataagaaggcaaagatgcaacagccttcatctctccctgcttcttg accatggatgtactgttaccagcttcctcactgtcctactgctttgtgat aaatttgaaggattattggtcacatcactccactccatgtgccaaaattt atttcagttgggaaaaggggcacatatctgaagacatttacattatttag ataatgggttgttggttttttttaaggaaggaaggtttattttgctcata gtttgggggcacattccatctcatttctctcatagatttgtgtactcaca atagctgtgataggacagttagaagatataagcagttgatcctaaaattt ttccctggagtccattaaagtcagaaacaaaaatcaaatacaagatggtg aagaatagtgatctaacagtaaggctacttttcattgggaatatttaagc ttgaagtgtagtaaaaatgatgatattcacaagactgtctagccatattc aaagacagtgaaaatattataaagctattctttggcttctctaaaacaat gtctttgttatactaaattattcttctaactttttttgctactcatcctt tattcccagctgatattatataacttctagatttgcttgtctgtcacccc tatcctatgtagattttatagctattggcacatttgtaatttacattaat attatattgtttctataatttttactctttttcattctttgtctgatatt caacaaattgattcactgaagatgccactttcaccaatatccctacatgt cttctttcattattcagcataagtcactgaatcttacctttataagacat tcgcaa	gaattccatcctcctctgatacacctgaagggtaagtaatttcttgggga agaagatgagggcagttacctgtgctagcttgtttagctataaaatcaaa agacttggctgtttaaactctacaaatgagctaaagtccaaaagcacttt tgaactgggaaaagttcaaaggagagctaagtcttcagaacaggaagaaa agggctgctaactgagatacctgagccccaaacatcatctccagaggcca catagccaaggcaataaacttgtcaacataggagtttagatcagcaaagg agggtttcaagtctcagagacatggcctgtgcaagtctcacatgagtttc ctccttaagtttcctgatcatgtgccagattcaaaccaattcaagagacc tcctggcttccatacagtgggctcaggtattcagtcctttcctattctcc ttaaagctgctggtaacaacccatccctttgggtgtgtacaactctcctt tgaattagagtgagataaagccagcctaacatacttcccattgataaatc taaagaccttcatcataaaaaggaagctactgaccaccaggaaagcaaaa aagaacagaagtcactaaataaaaatattgcatttactaggtttcatgga ttgttatactggaatgactatacaatagcaaagacccatcttccaaagtc ttcagagagctggcatttagaaccggtctcctagagggacactggaagct catttagtgttactttcttccactatccttatcttaaagatggaggttgt tttcccctaatatacaatatataatgcactcttctcaccccaatatacat ttataatcctcccaaaccagacctaaagcaaagatgtgctggcctccatt ctttgcagaggaaatctagatctgtgaggatatttgcactgggtgctgaa aagaagcactcagccaccaagcttcagctatacaatagaacattgtcccc tctagggagtttcttcccaggcagaagattcagacttaataacctgcctg tgaattgtgtcttcaagcaacagacagccacagaaa
quality values	Open. Hide. 58 29 22 28 58 58 58 58 37 28 52 58 58 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 27 26 38 20 21 20 21 21 21 21 21 46 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 43 50 48 32 48 50 54 62 62 59 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 56 62 62 46 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 41 38 38 58 54 54 58 58 58 58 58 52 58 49 52 54 54 54 54 58 54 58 58 58 58 58 52 54 58 54 54 58 52 41 37 58 54 54 54 49 54 54 58 54 58 54 58 54 41 54 58 49 54 54 58 58 58 54 54 52 52 48 48 52 47 48 28 54 47 54 52 54 58 58 58 58 42 40 54 47 44 48 47 49 48 50 49 54 50 58 58 50 51 27 41 38 54 54 52 54 52 53 54 58 58 49 48 47 47 50 52 58 58 49 39 58 58 48 50 52 42 42 50 51 49 51 40 52 31 40 36 49 50 30 58 49 51 53 45 47 50 54 50 48 46 22 37 49 58 51 53 39 30 49 50 46 50 52 35 53 49 53 39 50 58 19 49 50 58 39 38 37 52 53 42 52 54 29 39 40 50 52 39 52 36 40 52 39 41 35 44 21 53 32 39 50 58 58 40 30 27 51 47 49 54 28 39 33 37 39 52 51 30 19 51 31 44 39 51 52 41 46 32 26 53 32 52 32 39 37 54 54 54 16 21 51 37 31 29 49 31 30 20 54 31 36 42 26 39 40 35 29 40 53 30 38 32 32 24 22 9 12 34 31 37 31 33 10 54 12 19 38 17 31 26 16 31 30 54 54 40 26 32 46 16 29 26 26 52 15 16 41 32 35 42 21 32 19 47 35 35 32 31 20 22 27 21 21 31 32 47 47 27 31 25 33 31 33 21 9 5 32 19 38 20 29 29 26 34 35 32 26 46 7 31 36 43 33 13 31 14 32 30 26 23 31 11 15 46 46 51 51 51 33 31 24 25 29 41 28 30 26 36 21 34 18 47 31 16 21 34 31 46 30 36 30 29 21 17 12 10 10 20 30 12 14 30 18 36 21 25 31 21 26 14 32 15 21 14 48 19 31 31 18 25 32 20 26 29 31 22 36 21 9 48 41 30 31 30 21 14 25 10 27 20 22 12 31 18 48 11 39 41 16 32 24 15 23 36 20 13 13 23 14 24 5 13 19 21 23 41 7 25 6 6 18 26 36 13 7 6 12 31 38 31 18 21 26 29 8 16 10 24 36 44 38 14 48 20 8 6 24 13 14 12 16 36 36 39 8 9 24 17 10 10 32 31 30 7 8 19 9 11 14 24 25 18 18 11 12 5 12 14 7 17 8 32 11 22 18 10 21 37 33 12 7 16 13 8 3 6 5 10 17 8 5 15 7 13 15 8 17 15 9 19 14 47 7 8 6 6 4 11 5 4 3 3 4 23 11 5 3 3 9 6 7 8 16 4 5 27 5 34 9 15 6 20 14 24 14 4 4 9 7 21 9 4 15 18 5 12 5 5 7 11 16 5 7 8 16 10 7 5 6 4 3 9 14 7 5 6 8 7 8 7 14 15 12 2 3 6 13 26	Open. Hide. 62 35 39 41 62 62 39 21 62 56 50 27 26 32 27 27 22 24 25 34 38 56 44 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 43 49 62 62 62 62 62 62 62 62 59 62 59 62 62 40 54 46 43 42 28 49 56 51 62 62 62 62 62 62 54 62 59 59 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 54 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 52 62 62 62 62 47 62 62 62 62 62 46 34 62 62 62 62 62 62 62 62 45 54 58 54 58 58 58 54 54 50 58 58 58 52 54 58 54 58 58 58 54 54 58 52 54 58 54 54 54 58 54 58 47 58 58 58 58 45 52 54 58 58 58 58 54 54 58 52 52 54 52 52 52 58 58 53 58 52 54 54 54 58 47 58 54 54 54 51 54 47 52 52 50 50 50 47 43 41 29 40 48 38 37 26 40 58 48 47 50 47 50 40 58 49 49 58 32 58 49 51 41 42 49 43 46 58 54 46 41 58 51 58 50 49 39 58 58 58 42 52 53 39 51 58 49 50 58 54 58 46 50 49 51 37 58 49 58 41 40 39 53 58 44 37 37 41 58 30 58 46 53 50 58 54 58 49 51 58 37 51 41 39 53 52 51 42 53 32 58 51 51 39 53 53 58 39 29 46 24 31 41 37 58 47 49 51 39 52 32 58 41 38 42 39 39 53 37 40 34 54 24 50 29 35 52 33 54 30 22 29 54 39 37 32 54 31 23 22 19 54 41 45 42 26 35 45 38 37 46 20 54 44 23 21 37 42 35 37 34 25 32 30 45 42 42 37 36 54 40 45 40 32 54 40 32 26 32 40 54 39 40 27 31 21 27 30 34 30 40 39 35 33 31 33 35 31 34 31 41 47 51 32 19 52 23 22 15 33 21 34 18 31 51 16 49 49 16 16 47 40 40 17 27 41 25 30 42 28 30 16 51 24 30 30 31 31 51 45 25 51 29 30 30 31 37 15 31 31 30 31 24 31 46 41 25 18 16 32 19 31 30 30 27 25 47 32 31 30 26 22 31 31 27 25 31 46 27 19 46 28 31 38 30 13 28 12 32 37 31 47 18 13 31 31 46 30 13 27 24 43 34 34 31 28 32 21 16 31 27 21 31 31 30 35 31 33 48 38 31 25 11 6 38 13 18 33 41 21 31 27 27 21 10 7 14 19 32 30 24 25 26 14 33 24 18 19 31 41 26 26 31 24 22 23 31 48 37 16 28 21 24 21 33 48 48 17 14 26 44 15 19 17 33 29 21 24 23 14 11 5 7 15 24 23 10 20 10 26 14 21 32 32 9 5 4 5 7 7 7 10 5 5 5 21 11 11 24 16 15 7 5 25 30 12 10 15 19 6 13 22 11 32 8 18 30 11 12 5 14 14 29 15 5 7 7 16 7 5 23 28 6 30 5 7 8 14 11 23 6 18 18 10 20 26 18 23 11 13 5 6 8 13 11 9 11 16 24 15 8 7 6 5 15 8 6 7 9 5 16 14 25 24 10 14 17 9 8 5 3 9 10 13 6 5 14 13 5 15 27 18

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_97214617_97215766
seq2: B6Ng01-293M20.b_52_1207 (reverse)

seq1  TTGCGGAAATG-CTTATAAAGGT-AGA-TCAGTGAC-TATGCTGAATAAG  46
      |||||  |||| ||||||||||| ||| |||||||| |||||||||||| 
seq2  TTGCG--AATGTCTTATAAAGGTAAGATTCAGTGACTTATGCTGAATAAT  48

seq1  GAAGGAGGACATGGAGGGATATT-GTGAAAGTGGCATC-TCAGTGAAATT  94
      ||| || |||||| ||||||||| |||||||||||||| |||||| ||| 
seq2  GAAAGAAGACATGTAGGGATATTGGTGAAAGTGGCATCTTCAGTG-AATC  97

seq1  CATTTGTTGAATATCAGACAAAGAATTGAAAAGAGTAAAAATTATAGAAA  144
       |||||||||||||||||||||||||  ||||||||||||||||||||||
seq2  AATTTGTTGAATATCAGACAAAGAATGAAAAAGAGTAAAAATTATAGAAA  147

seq1  CAAATATAATATTAATGTTAAATACCAATGTGCCAATAGCTATAAAATTC  194
      | |||||||||||||||| || ||| ||||||||||||||||||||| ||
seq2  C-AATATAATATTAATGTAAATTACAAATGTGCCAATAGCTATAAAA-TC  195

seq1  TACATAGGATA-GGGTGACAGACAAGCAAATCTAGAAGTTATATAATATC  243
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  TACATAGGATAGGGGTGACAGACAAGCAAATCTAGAAGTTATATAATATC  245

seq1  AGCTGGGAATAAAGGATGAGTAGC-AAAAAAGTTAGAAGAATAA-TTAGT  291
      |||||||||||||||||||||||| ||||||||||||||||||| |||||
seq2  AGCTGGGAATAAAGGATGAGTAGCAAAAAAAGTTAGAAGAATAATTTAGT  295

seq1  ATAACAAAGACATTGTTTTAGAGAAGCCAAAGAATAGC-TTATAATATTT  340
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  ATAACAAAGACATTGTTTTAGAGAAGCCAAAGAATAGCTTTATAATATTT  345

seq1  TCACTGTC-TTGAATATGGCTAGACAGTCTTGTGAATATCATCATTTTTA  389
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  TCACTGTCTTTGAATATGGCTAGACAGTCTTGTGAATATCATCATTTTTA  395

seq1  CTACACTTCAAGCTTAAATATTCCCAATGAAAAGTAGCCTTACTGTTAGA  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACACTTCAAGCTTAAATATTCCCAATGAAAAGTAGCCTTACTGTTAGA  445

seq1  TCACTATTCTTCACCATCTTGTATTTGATTTTTGTTTCTGACTTTAATGG  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTATTCTTCACCATCTTGTATTTGATTTTTGTTTCTGACTTTAATGG  495

seq1  ACTCCAGGGAAAAATTTTAGGATCAACTGCTTATATCTTCTAACTGTCCT  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCAGGGAAAAATTTTAGGATCAACTGCTTATATCTTCTAACTGTCCT  545

seq1  ATCACAGCTATTGTGAGTACACAAATCTATGAGAGAAATGAGATGGAATG  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACAGCTATTGTGAGTACACAAATCTATGAGAGAAATGAGATGGAATG  595

seq1  TGCCCCCAAACTATGAGCAAAATAAACCTTCCTTCCTTAAAAAAAACCAA  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCCCAAACTATGAGCAAAATAAACCTTCCTTCCTTAAAAAAAACCAA  645

seq1  CAACCCATTATCTAAATAATGTAAATGTCTTCAGATATGTGCCCCTTTTC  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCCATTATCTAAATAATGTAAATGTCTTCAGATATGTGCCCCTTTTC  695

seq1  CCAACTGAAATAAATTTTGGCACATGGAGTGGAGTGATGTGACCAATAAT  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACTGAAATAAATTTTGGCACATGGAGTGGAGTGATGTGACCAATAAT  745

seq1  CCTTCAAATTTATCACAAAGCAGTAGGACAGTGAGGAAGCTGGTAACAGT  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCAAATTTATCACAAAGCAGTAGGACAGTGAGGAAGCTGGTAACAGT  795

seq1  ACATCCATGGTCAAGAAGCAGGGAGAGATGAAGGCTGTTGCATCTTTGCC  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCCATGGTCAAGAAGCAGGGAGAGATGAAGGCTGTTGCATCTTTGCC  845

seq1  TTCTTATTCACTCCTGGATCCTGGCTCATGGGATAGTGTCACCAGCAGTT  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTATTCACTCCTGGATCCTGGCTCATGGGATAGTGTCACCAGCAGTT  895

seq1  AAGGTGGGTCCTCACACCTTGATTAACTAAATCTGGAAACTCCCTCACAG  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTGGGTCCTCACACCTTGATTAACTAAATCTGGAAACTCCCTCACAG  945

seq1  ACATGAACAGAGAGTTGCTTCCATGGTGATTCTAGATCCTGTCAATATGA  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGAACAGAGAGTTGCTTCCATGGTGATTCTAGATCCTGTCAATATGA  995

seq1  CAGTAAAATCTGCATTCATGTATTCAAGGCTCTGAAAGGCTCTACAGTCT  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAAAATCTGCATTCATGTATTCAAGGCTCTGAAAGGCTCTACAGTCT  1045

seq1  TGGGTGACCTTTGGCTACATGTCATCTTGTGTTTCCCCAATAGCTTTGCT  1089
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTGACCTTTGGCTACATGTCATCTTGTGTTTCCCCAATAGCTTTGCT  1095

seq1  TTTGTCTCATTCCACAGTATGGCTTTCCATTTTTTTCCAGAGAAGGCACG  1139
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTCTCATTCCACAGTATGGCTTTCCATTTTTTTCCAGAGAAGGCACG  1145

seq1  CTGAGGAATTC  1150
      |||||||||||
seq2  CTGAGGAATTC  1156

seq1: chrX_97004454_97005533
seq2: B6Ng01-293M20.g_70_1155

seq1  GAATTCCATCCTCCTCTGATACACCTGAAGGGTAAGTAATTTCTTGGGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATCCTCCTCTGATACACCTGAAGGGTAAGTAATTTCTTGGGGA  50

seq1  AGAAGATGAGGGCAGTTACCTGTGCTAGCTTGTTTAGCTATAAAATCAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGATGAGGGCAGTTACCTGTGCTAGCTTGTTTAGCTATAAAATCAAA  100

seq1  AGACTTGGCTGTTTAAACTCTACAAATGAGCTAAAGTCCAAAAGCACTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTTGGCTGTTTAAACTCTACAAATGAGCTAAAGTCCAAAAGCACTTT  150

seq1  TGAACTGGGAAAAGTTCAAAGGAGAGCTAAGTCTTCAGAACAGGAAGAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACTGGGAAAAGTTCAAAGGAGAGCTAAGTCTTCAGAACAGGAAGAAA  200

seq1  AGGGCTGCTAACTGAGATACCTGAGCCCCAAACATCATCTCCAGAGGCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCTGCTAACTGAGATACCTGAGCCCCAAACATCATCTCCAGAGGCCA  250

seq1  CATAGCCAAGGCAATAAACTTGTCAACATAGGAGTTTAGATCAGCAAAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGCCAAGGCAATAAACTTGTCAACATAGGAGTTTAGATCAGCAAAGG  300

seq1  AGGGTTTCAAGTCTCAGAGACATGGCCTGTGCAAGTCTCACATGAGTTTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTTTCAAGTCTCAGAGACATGGCCTGTGCAAGTCTCACATGAGTTTC  350

seq1  CTCCTTAAGTTTCCTGATCATGTGCCAGATTCAAACCAATTCAAGAGACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTAAGTTTCCTGATCATGTGCCAGATTCAAACCAATTCAAGAGACC  400

seq1  TCCTGGCTTCCATACAGTGGGCTCAGGTATTCAGTCCTTTCCTATTCTCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGCTTCCATACAGTGGGCTCAGGTATTCAGTCCTTTCCTATTCTCC  450

seq1  TTAAAGCTGCTGGTAACAACCCATCCCTTTGGGTGTGTACAACTCTCCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGCTGCTGGTAACAACCCATCCCTTTGGGTGTGTACAACTCTCCTT  500

seq1  TGAATTAGAGTGAGATAAAGCCAGCCTAACATACTTCCCATTGATAAATC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATTAGAGTGAGATAAAGCCAGCCTAACATACTTCCCATTGATAAATC  550

seq1  TAAAGACCTTCATCATAAAAAGGAAGCTACTGACCACCAGGAAAGCAAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGACCTTCATCATAAAAAGGAAGCTACTGACCACCAGGAAAGCAAAA  600

seq1  AAGAACAGAAGTCACTAAATAAAAATATTGCATTTACTAGGTTTCATGGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAACAGAAGTCACTAAATAAAAATATTGCATTTACTAGGTTTCATGGA  650

seq1  TTGTTATACTGGAATGACTATACAATAGCAAAGACCCATCTTCCAAAGTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTATACTGGAATGACTATACAATAGCAAAGACCCATCTTCCAAAGTC  700

seq1  TTCAGAGAGCTGGCATTTAGAACCGGTCTCCTAGAGGGACACTGGAAGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGAGAGCTGGCATTTAGAACCGGTCTCCTAGAGGGACACTGGAAGCT  750

seq1  CATTTAGTGTTACTTTCTTCCACTATCCTTATCTTAAAGATGGAGGTTGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTAGTGTTACTTTCTTCCACTATCCTTATCTTAAAGATGGAGGTTGT  800

seq1  TTTCCCCTAATATACAATATATAATGCACTCTTCTCACCCCAATATACAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCCCTAATATACAATATATAATGCACTCTTCTCACCCCAATATACAT  850

seq1  TTATAATCCTCCCAAACCAGACCTAAAGCAAAGATGTGCTGGCCTCCATT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAATCCTCCCAAACCAGACCTAAAGCAAAGATGTGCTGGCCTCCATT  900

seq1  CTTTGCAGAGGAAATCTAGATCTGTGAGGATATTTGCACTGGGTGCTGAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGCAGAGGAAATCTAGATCTGTGAGGATATTTGCACTGGGTGCTGAA  950

seq1  AAGAAGCACTCAGCCCACAAGCTTCAGCTATAC-ATAG-ACATTGTCCCC  998
      |||||||||||||||  |||||||||||||||| |||| |||||||||||
seq2  AAGAAGCACTCAGCCACCAAGCTTCAGCTATACAATAGAACATTGTCCCC  1000

seq1  TCTAGGGAGTTTCCTCCCA-GCAG-AGAATCAGACTTAATAACCTGCCTG  1046
      ||||||||||||| ||||| |||| ||| |||||||||||||||||||||
seq2  TCTAGGGAGTTTCTTCCCAGGCAGAAGATTCAGACTTAATAACCTGCCTG  1050

seq1  TGAA-TGTGTC-TCAAGCAACAGAACAG-CACAGAAA  1080
      |||| |||||| ||||||||||| |||| ||||||||
seq2  TGAATTGTGTCTTCAAGCAACAG-ACAGCCACAGAAA  1086

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information