MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-319G22
Chromosome	X (Build37)
Map Location	69,528,066 - 69,529,248
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Mtm1, Mtmr1, Cd99l2, LOC667017, Hmgb3, LOC100040549, Gpr50, LOC654357, 2610030H06Rik, Gm1141, Prrg3, Fate1, Cnga2, Magea4, Gabre
Downstream gene	Magea10, Gabra3, Gabrq, Magea9, Cetn2, Nsdhl, Zfp185, Pnma5, LOC628237, Pnma3, Xlr4a, Xlr3a, Xlr5d, MGC106740, DXBay18, LOC627081, 4930408F14Rik, EG574437, Xlr4b, F8a, Xlr4c, Xlr3b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mtm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17772 MGI:1099452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53332 MGI:1858271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd99l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Hmgb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Gpr50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14765 MGI:1333877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC654357 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654357
definition	note : ribosomal protein L30 pseudogene pseudo : _no_value

name	2610030H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67048 MGI:1914298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1141 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382221 MGI:2685987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prrg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208748 MGI:2685214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fate1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77905 MGI:1925155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Cnga2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12789 MGI:108040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17140 MGI:1333839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabre (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14404 MGI:1330235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236852 MGI:3588211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 48 Proteins

name	Gabra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14396 MGI:95615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabrq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57249 MGI:1888498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195772 MGI:1350986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cetn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26370 MGI:1347085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsdhl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18194 MGI:1099438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22673 MGI:108095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnma5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385377 MGI:2180566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 6 Proteins

name	LOC628237 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628237
definition	note : paraneoplastic antigen MA3 pseudogene pseudo : _no_value

name	Pnma3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245468 MGI:2180565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434794 MGI:3574098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22445 MGI:109506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574438 MGI:3574110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	MGC106740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:574404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	DXBay18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574405 MGI:99870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein

name	4930408F14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74851 MGI:1922101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins

name	EG574437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574437 MGI:3646893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27083 MGI:1350975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14070 MGI:95474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72891 MGI:3574099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22446 MGI:109505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802570 GeneID:17772 MGI:1099452
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked myotubular myopathy gene 1 transcript_id : NM_019926.2

name	Mtmr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57528446 GeneID:53332 MGI:1858271
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 1 transcript_id : NM_016985.2

name	Cd99l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129961 GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd99 antigen-like 2 transcript_id : NM_138309.2

name	Hmgb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892877 GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group box 3 transcript_id : NM_008253.3

name	LOC100040549 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271688 GeneID:100040549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001474894.1

name	Gpr50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754059 GeneID:14765 MGI:1333877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein-coupled receptor 50 transcript_id : NM_010340.1

name	2610030H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486866 GeneID:67048 MGI:1914298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610030H06 gene transcript_id : NM_001081356.1

name	Gm1141 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387299 GeneID:382221 MGI:2685987
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1141, (NCBI) transcript_id : NM_001033470.2

name	Prrg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487490 GeneID:208748 MGI:2685214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) transcript_id : NM_001081135.1

name	Cnga2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982858 GeneID:12789 MGI:108040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclic nucleotide gated channel alpha 2 transcript_id : NM_007724.2

name	Magea4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9937975 GeneID:17140 MGI:1333839
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 4 transcript_id : NM_020280.1

name	Gabre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145508 GeneID:14404 MGI:1330235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-A) receptor, subunit epsilon transcript_id : NM_017369.2

name	Magea10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271690 GeneID:236852 MGI:3588211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 48 Proteins product : melanoma antigen family A, 10 transcript_id : XM_001474626.1

name	Gabra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382325 GeneID:14396 MGI:95615
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 3 transcript_id : NM_008067.3

name	Gabrq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048421 GeneID:57249 MGI:1888498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-A) receptor, subunit theta transcript_id : NM_020488.1

name	Magea9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469504 GeneID:195772 MGI:1350986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 9 transcript_id : NM_181855.1

name	Cetn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368991 GeneID:26370 MGI:1347085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrin 2 transcript_id : NM_019405.6

name	Nsdhl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982436 GeneID:18194 MGI:1099438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAD(P) dependent steroid dehydrogenase-like transcript_id : NM_010941.3

name	Zfp185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31544060 GeneID:22673 MGI:108095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 185 transcript_id : NM_009549.2

name	Pnma5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271693 GeneID:385377 MGI:2180566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 6 Proteins product : paraneoplastic antigen family 5 transcript_id : XM_001474772.1

name	Pnma3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346627 GeneID:245468 MGI:2180565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paraneoplastic antigen MA3 transcript_id : NM_153169.1

name	Xlr4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032322 GeneID:434794 MGI:3574098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 4A transcript_id : NM_001081642.1

name	Xlr3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756016 GeneID:22445 MGI:109506
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 3A transcript_id : NM_011726.1

name	Xlr5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865916 GeneID:574438 MGI:3574110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 5D transcript_id : NM_001045539.1

name	MGC106740 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:85701573 GeneID:574404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC574404 transcript_id : NM_001025383.1

name	DXBay18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373043 GeneID:574405 MGI:99870
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr X, Baylor 18 transcript_id : NM_001025384.2

name	LOC627081 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271695 GeneID:627081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein product : X-linked lymphocyte-regulated 5-like, transcript variant 1 transcript_id : XM_890434.3

name	LOC627081 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407513 GeneID:627081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 1 Protein product : X-linked lymphocyte-regulated 5-like, transcript variant 2 transcript_id : XM_899015.2

name	4930408F14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407538 GeneID:74851 MGI:1922101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : RIKEN cDNA 4930408F14 gene transcript_id : XM_356334.3

name	EG574437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032308 GeneID:574437 MGI:3646893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574437 transcript_id : NM_001081643.1

name	Xlr4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226210 GeneID:27083 MGI:1350975
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 4B transcript_id : NM_021365.2

name	F8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801707 GeneID:14070 MGI:95474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : factor 8-associated gene A transcript_id : NM_007978.3

name	Xlr4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226239 GeneID:72891 MGI:3574099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 4C transcript_id : NM_183094.3

name	Xlr3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756018 GeneID:22446 MGI:109505
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 3B transcript_id : NM_011727.1

name	Mtm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910456 CCDS:CCDS30177.1 GeneID:17772 MGI:1099452
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0046716 - muscle maintenance [Evidence IMP]; GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myotubularin protein_id : NP_064310.1

name	Mtmr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393794 CCDS:CCDS30178.1 GeneID:53332 MGI:1858271
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004438 - phosphatidylinositol-3-phosphatase activity [Evidence IDA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : myotubularin-related protein 1 protein_id : NP_058681.1

name	Cd99l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489963 CCDS:CCDS30179.1 GeneID:171486 MGI:2177151
definition	codon_start : 1 note : MIC2 like-1; MIC2 (monoclonal Imperial Cancer Research Fund 2)-like 1 product : Cd99 antigen-like 2 protein_id : NP_612182.1

name	Hmgb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680231 CCDS:CCDS30180.1 GeneID:15354 MGI:1098219
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006323 - DNA packaging [Evidence IEA]; GO:0045578 - negative regulation of B cell differentiation [Evidence IDA]; GO:0045638 - negative regulation of myeloid cell differentiation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : high-mobility group protein 4; high mobilty group protein 2A product : high mobility group box 3 protein_id : NP_032279.1

name	LOC100040549 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271689 GeneID:100040549
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474944.1

name	Gpr50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754060 CCDS:CCDS30181.1 GeneID:14765 MGI:1333877
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein-coupled receptor 50 protein_id : NP_034470.1

name	2610030H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486867 GeneID:67048 MGI:1914298
definition	codon_start : 1 note : RNA binding protein-like product : hypothetical protein LOC67048 protein_id : NP_001074825.1

name	Gm1141 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701991 CCDS:CCDS30182.1 GeneID:382221 MGI:2685987
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC382221 protein_id : NP_001028642.1

name	Prrg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487491 GeneID:208748 MGI:2685214
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : transmembrane gamma-carboxyglutamic acid protein 3 product : proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) protein_id : NP_001074604.1

name	Cnga2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982859 CCDS:CCDS30184.1 GeneID:12789 MGI:108040
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : cyclic nucleotide gated channel 4 product : cyclic nucleotide gated channel alpha 2 protein_id : NP_031750.2

name	Magea4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937976 CCDS:CCDS30185.1 GeneID:17140 MGI:1333839
definition	codon_start : 1 exception : mismatches in translation product : melanoma antigen family A, 4 protein_id : NP_064676.1

name	Gabre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145509 CCDS:CCDS30186.1 GeneID:14404 MGI:1330235
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004890 - GABA-A receptor activity [Evidence IEA] [Evidence ISS]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence ISS]; GO:0007214 - gamma-aminobutyric acid signaling pathway [Evidence ISS] codon_start : 1 product : gamma-aminobutyric acid (GABA-A) receptor, subunit epsilon protein_id : NP_059065.2

name	Magea10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271691 GeneID:236852 MGI:3588211
definition	codon_start : 1 product : similar to melanoma antigen family A, 10 protein_id : XP_001474676.1

name	Gabra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560695 CCDS:CCDS30187.1 GeneID:14396 MGI:95615
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0004890 - GABA-A receptor activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0007214 - gamma-aminobutyric acid signaling pathway [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 3 protein_id : NP_032093.2

name	Gabrq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048422 CCDS:CCDS30188.1 GeneID:57249 MGI:1888498
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0004890 - GABA-A receptor activity [Evidence ISS] [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence ISS]; GO:0007214 - gamma-aminobutyric acid signaling pathway [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gamma-aminobutyric acid (GABA) A receptor, theta; gamma-aminobutyric acid (GABA-A) receptor, theta product : gamma-aminobutyric acid (GABA-A) receptor, subunit theta protein_id : NP_065234.1

name	Magea9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469505 CCDS:CCDS30189.1 GeneID:195772 MGI:1350986
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : melanoma antigen family A, 9 protein_id : NP_862903.1

name	Cetn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10257421 GeneID:26370 MGI:1347085
definition	GO_component : GO:0005814 - centriole [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : caltractin, 20 kDa calcium binding protein product : centrin 2 protein_id : NP_062278.2

name	Nsdhl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982437 CCDS:CCDS30190.1 GeneID:18194 MGI:1099438
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003854 - 3-beta-hydroxy-delta5-steroid dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004769 - steroid delta-isomerase activity [Evidence IEA]; GO:0047012 - sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008203 - cholesterol metabolism [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 note : striated; bare patches product : NAD(P) dependent steroid dehydrogenase-like protein_id : NP_035071.3

name	Zfp185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31544061 CCDS:CCDS30191.1 GeneID:22673 MGI:108095
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 185 protein_id : NP_033575.2

name	Pnma5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271694 GeneID:385377 MGI:2180566
definition	codon_start : 1 product : similar to paraneoplastic antigen family 5 protein_id : XP_001474822.1

name	Pnma3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346628 CCDS:CCDS30192.1 GeneID:245468 MGI:2180565
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : paraneoplastic antigen MA3 protein_id : NP_694809.1

name	Xlr4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032323 GeneID:434794 MGI:3574098
definition	codon_start : 1 product : X-linked lymphocyte-regulated 4A protein_id : NP_001075111.1

name	Xlr3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756017 GeneID:22445 MGI:109506
definition	codon_start : 1 note : X-linked B-cell surface antigen 3a; X-linked lymphocyte regulated 3 product : X-linked lymphocyte-regulated 3a protein_id : NP_035856.1

name	Xlr5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865917 CCDS:CCDS30194.1 GeneID:574438 MGI:3574110
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : X-linked lymphocyte-regulated 5D protein_id : NP_001039004.1

name	MGC106740 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85701574 GeneID:574404
definition	codon_start : 1 product : hypothetical protein LOC574404 protein_id : NP_001020554.1

name	DXBay18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701580 GeneID:574405 MGI:99870
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC574405 protein_id : NP_001020555.1

name	LOC627081 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83001386 GeneID:627081
definition	codon_start : 1 product : hypothetical protein LOC627081 isoform 1 protein_id : XP_895527.1

name	LOC627081 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83001388 GeneID:627081
definition	codon_start : 1 product : hypothetical protein LOC627081 isoform 2 protein_id : XP_904108.1

name	4930408F14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086399 GeneID:74851 MGI:1922101
definition	codon_start : 1 product : hypothetical protein LOC74851 protein_id : XP_356334.1

name	EG574437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032309 GeneID:574437 MGI:3646893
definition	codon_start : 1 note : X-linked lymphocyte regulated product : hypothetical protein LOC574437 protein_id : NP_001075112.1

name	Xlr4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226211 GeneID:27083 MGI:1350975
definition	codon_start : 1 note : X-linked lymphocyte regulated gene 4 product : X-linked lymphocyte-regulated 4B protein_id : NP_067340.2

name	F8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921576 GeneID:14070 MGI:95474
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : Factor VIII associated protein product : factor 8-associated gene A protein_id : NP_032004.2

name	Xlr4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226240 GeneID:72891 MGI:3574099
definition	codon_start : 1 product : X-linked lymphocyte-regulated 4C protein_id : NP_898917.2

name	Xlr3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756019 CCDS:CCDS30197.1 GeneID:22446 MGI:109505
definition	codon_start : 1 exception : mismatches in translation note : X-linked B-cell surface antigen 3b product : X-linked lymphocyte-regulated 3b protein_id : NP_035857.1

name	LOC667017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667017
definition	number : 1 pseudo : _no_value

name	Fate1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:116089270 GeneID:77905 MGI:1925155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetal and adult testis expressed 1 pseudo : _no_value transcript_id : NR_003243.1

clone name	MSMg01-048O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428A10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-492C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121E20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-319G22.b	B6Ng01-319G22.g
ACC	GA109065	GA109066
length	1,164	668
definition	B6Ng01-319G22.b	B6Ng01-319G22.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttggttacagccagtttgaatggctacttgtgacaaagactgtg gaaagaacttttatgtcaggagaaggttcaagctggtttcaccaaatctt tactgctccattatagcccatcatactaggctcttcaagaggaaaatctt cactattgtggcgccagttgtccagacaggggagacattcaactatctcc attattcctctgagccctttcaatttcatacagtgcactagccctattaa ttaggaactgagttccaactgatatgaattcatgatgtatcagaaaagtt aaatcacttgttaattacaaagatatagctacaccaaaagtacctatttg cctgctgagtacaaactcacgtcgtttgatttgacagcaaagcttccatc tgagcagcctcttgcagcacctcagagcacttgatcaggctcaaccctct caattgttactactgatcagcagctgggcccacaggcattatgaactcag caactgagtttccatagctctaggaggaaaaggatttttcattaagtata tttgaccggggaaccaggaaaaagtgatccttctggcaatgtagacaaga aactcccacctatggtccttaacattcacagtaaggaagcatggcttgtg agagcagggaagaaaaatatagactcttcaatgtgaccaccgagctttac ctttacctggaaacctctctgcttaagatgtagttgacacatctttttgt ttccatgagacattttggaaatgtcttccttaaggctgacagcttttctg agttaatcaagatcagaagtcctgtcccctgaacttcagctctggaaaat aggcaagccagtaaaccatacagaatatttggtgcaaagtcctgcagctc cgaaagatgagtcatctgcttttaccaccacttgaaataaacgatatggc ttggcagcctctgtatattatagcctgtcattttaccttttctcctgctc tctttattccacattggatatagatggcaaaagtggttcagactgatggc tctactttttttactacccagaagctcacaggagttcaagatgctctgca cctgatcagaatcagttgccagtatctctgcataagtcttggcctaaatc gacattttcaactt	gaattcaaagctaacctgggtgaaatgggaccatacacacatatatacat acatacatacatacatacatacatacacacacatatacatacatacatac acacatatacatacatacatacacacacatatacatacatacatacatac atacatacatacatacatatatactggcttcagtccttgtgatagtttgt atgagatgacccccaaattcatgtacatttaaattcttggtccccatttg gtaggcttgtttggagagggttaatatgtgtggccttgctggaggaagtc tatcactggaatgagttttgaaatttccaaagctatgtgctgtttctaga gttctctctcaactccctgtttgtagtttgagatatgaacacatagctga tgtcctatttccatgtctgactcctgccatgcttccctttcatgatggtt atggactttcattcctttggaatcataaagtcaaataaactcttccttca acaaactgacttgttgccctggttattgtggttctgaccttggctttctc cctcagggtgtccagactgttacaaactaagcaggaaaggatgaatctga gtctggaacaggtaggccagcaggatccaggttcagcagtgagtgccagg gtgtggggtgggagggtt
quality values	Open. Hide. 49 25 33 26 58 58 49 58 62 49 62 42 42 52 28 62 62 47 41 62 62 62 62 62 49 62 47 62 54 56 62 56 44 56 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 59 62 62 54 62 62 59 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 59 62 62 62 62 62 62 49 42 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 49 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 56 56 62 56 62 62 62 62 62 43 54 56 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 52 52 62 46 34 46 62 62 62 48 62 62 62 62 52 48 54 62 54 54 58 52 58 58 58 58 58 54 58 58 54 58 58 58 58 54 52 52 52 52 54 52 53 58 54 54 58 58 58 58 58 58 58 58 58 58 52 52 54 52 52 39 52 58 54 54 58 54 54 52 44 48 54 58 52 52 58 58 58 54 54 58 45 37 58 58 49 49 58 38 58 37 35 58 58 58 58 49 50 58 58 58 58 58 58 51 58 53 58 58 51 49 44 19 31 48 51 58 54 58 48 22 38 50 49 58 58 58 58 58 46 51 58 58 49 49 53 53 49 49 53 54 58 58 42 44 44 50 58 52 54 50 46 50 50 58 50 58 44 43 42 51 50 41 41 44 39 41 44 54 50 58 54 42 50 43 44 50 41 44 44 52 51 51 49 50 50 52 53 39 51 50 50 58 49 54 40 51 33 38 54 54 40 54 54 54 44 46 44 37 54 27 50 50 32 49 54 54 51 37 54 54 54 54 29 40 41 41 47 47 49 29 51 42 47 42 34 26 53 45 54 30 44 33 34 44 40 53 44 39 37 33 41 39 54 44 37 41 25 42 45 47 31 18 35 44 51 22 44 51 30 14 40 42 32 34 52 32 53 40 34 41 31 45 32 37 24 53 32 53 40 53 36 40 41 19 29 36 26 53 45 52 53 52 49 47 37 29 52 35 23 30 25 35 43 51 32 37 31 35 32 51 51 30 29 32 41 46 30 31 45 31 39 43 32 29 33 34 40 34 37 28 46 14 30 31 31 24 31 34 36 31 46 46 31 31 31 28 42 15 31 30 22 27 31 29 22 29 24 27 32 35 32 28 46 32 23 37 30 35 27 33 23 32 31 31 19 25 31 27 22 28 31 35 30 6 7 9 23 27 32 35 31 31 48 46 27 28 31 9 44 27 32 31 32 36 29 30 32 31 33 28 22 14 15 26 38 31 30 27 22 31 33 22 30 26 47 25 33 35 17 29 21 26 36 18 18 32 28 22 31 32 25 31 27 27 32 18 26 10 18 43 5 4 4 15 33 28 15 31 34 27 30 21 26 33 20 32 47 43 23 27 28 17 20 12 21 16 24 18 23 21 23 48 30 21 19 43 30 21 17 33 8 24 14 26 23 31 24 14 13 26 19 20 14 18 12 28 9 5 7 9 27 19 12 9 21 12 3 11 10 17 9 5 7 6 19 11 15 34 34 14 16 14 21 17 28 34 12 24 20 7 18 11 28 19 11 9 6 15 10 34 22 13 6 20 11 15 15 13 15 7 9 10 17 5 7 4 9 13 8 10 9 11 17 8 15 26 24 21 13 6 10 9 3 5 6 10 4 3 2 6 23 10 8 5 13 11 8 9 14 8 10 3 5 28 28 30 30 16 18 9 11 10 16 23 8 5 7 25 23 12 7 7 13 7 3 4 14 5 9 4 6 5 19 8 14 9 25 6 8 23 5 5 3 6 6 4 22 23 10 2 1 1 2 7 9 15 11 20 15 23 4 3 7 4 3 3 2 1 2 2 7 7 8 6 5 11 7 4 6 7 8 4 3 5 4 8 5 13 4 4 11 12 3 4 6 1 2 1 8 5 2 18 26 13 7 21 16 4 7 7	Open. Hide. 54 59 62 59 54 59 39 59 62 62 59 54 38 43 56 59 49 42 49 54 62 62 59 62 62 59 62 54 49 54 59 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 54 42 42 42 42 42 54 54 54 54 42 54 54 54 42 42 54 62 62 54 62 54 54 62 42 42 42 38 54 48 59 51 56 33 42 35 62 59 62 54 62 62 59 43 35 33 43 49 62 62 62 59 62 56 56 56 56 48 54 48 56 59 62 56 56 48 59 59 59 49 54 56 59 59 59 59 59 51 56 46 54 59 62 56 62 59 62 56 62 56 59 59 59 51 59 59 62 59 62 59 62 48 59 56 54 56 59 56 59 46 59 56 62 59 59 56 42 48 59 59 62 62 59 59 59 59 62 59 59 62 56 59 56 51 59 59 59 59 59 59 59 62 59 62 62 59 62 62 62 62 54 54 56 56 62 36 59 46 43 54 62 56 54 54 62 56 59 62 59 59 62 50 54 54 56 56 62 56 62 62 62 62 62 59 62 59 56 54 56 62 62 59 59 56 59 59 59 56 56 56 62 59 59 62 56 62 59 62 62 62 56 59 59 59 59 62 59 59 51 59 38 48 50 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 59 62 62 59 62 51 62 62 62 56 59 59 59 59 59 59 56 59 59 62 56 59 62 62 62 62 59 62 51 51 50 50 59 59 62 62 62 59 59 59 59 59 59 51 59 59 59 56 46 59 59 56 56 59 59 59 59 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 59 62 62 59 62 62 62 62 62 59 62 62 59 59 62 51 62 59 59 59 62 62 62 62 62 62 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 49 49 56 56 51 51 50 56 62 62 62 62 56 62 62 62 62 62 56 56 62 62 62 62 56 56 56 56 56 56 62 56 56 56 56 56 56 62 56 56 56 62 56 56 56 62 62 62 62 62 62 56 56 56 56 56 56 62 62 62 56 62 62 49 46 52 52 52 54 62 62 62 62 62 62 62 62 54 62 62 52 52 52 52 52 52 48 54 52 52 54 52 46 44 54 52 52 52 49 42 54 54 54 46 52 54 52 54 54 47 58 58 58 58 58 54 54 54 54 54 54 52 54 54 48 54 54 54 58 58 58 58 54 40 58 58 52 51 51 50 48 46 50 58 46 58 58 52 47 50 51 49 50 48 50 51 50 50 48 51 58 26 58 54 58 58 50 58 39 35 58 58 53 53 54 58 49 58 25 58 53 58 58 58 51 58 40 53 40 58 42 53 33 58 50 44 50 52 58 53 35 58 28 24 44 43 51 40 44 51 58 50 50 35 58 58 45 58 58 54 32 44 22 25 54 51 54 54 54 44 54 42 54 46 54 54 31 44 44 44 51 32 44 27 20 18

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_69528066_69529248
seq2: B6Ng01-319G22.b_49_1212 (reverse)

seq1  AAGTTGAAAATGGTAATTTA-GCCAAGAACTATAGCAAGAGATAACTGGG  49
      ||||||||||||   ||||| |||||||  ||| || |||||| |||  |
seq2  AAGTTGAAAATGTCGATTTAGGCCAAGACTTAT-GC-AGAGAT-ACT--G  45

seq1  GCAACTTGATCTGGCCAGGGTGCAGGAGGCATCTTGGACTCCTGTTGGGC  99
      ||||||   ||||  || |||||||   |||||||| ||||||| || ||
seq2  GCAACTGATTCTGATCA-GGTGCAG--AGCATCTTGAACTCCTG-TGAGC  91

seq1  TTTCTGGGTAGTTAAAAAAAGGTAGAGCAATCAGTTCTGAAACCACTTTT  149
       |||||||||||  |||||| ||||||| ||||| |||| ||||||||||
seq2  -TTCTGGGTAGT--AAAAAAAGTAGAGCCATCAG-TCTG-AACCACTTTT  136

seq1  GCCATCTATAATTCCAATGTGGAATAAAGAGAGCAGGAG-AAAGGTAAAA  198
      ||||||||||  ||||||||||||||||||||||||||| ||||||||||
seq2  GCCATCTATA--TCCAATGTGGAATAAAGAGAGCAGGAGAAAAGGTAAAA  184

seq1  TGACAAGGCTATTAATATACAAGAGGCTGCCAAGCCATTATCGTTTATTT  248
      |||| |||||| |||||||| |||||||||||||||| ||||||||||||
seq2  TGAC-AGGCTA-TAATATAC-AGAGGCTGCCAAGCCA-TATCGTTTATTT  230

seq1  CAAGTGGTGGTAAAAGCAGATGACTCATCCTTCGGAGCTGCAGGACTTTG  298
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  CAAGTGGTGGTAAAAGCAGATGACTCATCTTTCGGAGCTGCAGGACTTTG  280

seq1  CACCAAATATTCTGTATGGTTTACTGGCTTGCCTATTTTCCAGAGCCTGA  348
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  CACCAAATATTCTGTATGGTTTACTGGCTTGCCTATTTTCCAGAG-CTGA  329

seq1  AGTTCAGGGGACAGGACTTCTGATCTTGATTAACTCAGAAAAGCTGTCAG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAGGGGACAGGACTTCTGATCTTGATTAACTCAGAAAAGCTGTCAG  379

seq1  CCTTAAGGAAGACATTTCCAAAATGTCTCATGGAAACAAAAAGATGTGTC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTAAGGAAGACATTTCCAAAATGTCTCATGGAAACAAAAAGATGTGTC  429

seq1  AACTACATCTTAAGCAGAGAGGTTTCCAGGTAAAGGTAAAGCTCGGTGGT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTACATCTTAAGCAGAGAGGTTTCCAGGTAAAGGTAAAGCTCGGTGGT  479

seq1  CACATTGAAGAGTCTATATTTTTCTTCCCTGCTCTCACAAGCCATGCTTC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATTGAAGAGTCTATATTTTTCTTCCCTGCTCTCACAAGCCATGCTTC  529

seq1  CTTACTGTGAATGTTAAGGACCATAGGTGGGAGTTTCTTGTCTACATTGC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACTGTGAATGTTAAGGACCATAGGTGGGAGTTTCTTGTCTACATTGC  579

seq1  CAGAAGGATCACTTTTTCCTGGTTCCCCGGTCAAATATACTTAATGAAAA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAGGATCACTTTTTCCTGGTTCCCCGGTCAAATATACTTAATGAAAA  629

seq1  ATCCTTTTCCTCCTAGAGCTATGGAAACTCAGTTGCTGAGTTCATAATGC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTTTTCCTCCTAGAGCTATGGAAACTCAGTTGCTGAGTTCATAATGC  679

seq1  CTGTGGGCCCAGCTGCTGATCAGTAGTAACAATTGAGAGGGTTGAGCCTG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGGGCCCAGCTGCTGATCAGTAGTAACAATTGAGAGGGTTGAGCCTG  729

seq1  ATCAAGTGCTCTGAGGTGCTGCAAGAGGCTGCTCAGATGGAAGCTTTGCT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGTGCTCTGAGGTGCTGCAAGAGGCTGCTCAGATGGAAGCTTTGCT  779

seq1  GTCAAATCAAACGACGTGAGTTTGTACTCAGCAGGCAAATAGGTACTTTT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAAATCAAACGACGTGAGTTTGTACTCAGCAGGCAAATAGGTACTTTT  829

seq1  GGTGTAGCTATATCTTTGTAATTAACAAGTGATTTAACTTTTCTGATACA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTAGCTATATCTTTGTAATTAACAAGTGATTTAACTTTTCTGATACA  879

seq1  TCATGAATTCATATCAGTTGGAACTCAGTTCCTAATTAATAGGGCTAGTG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGAATTCATATCAGTTGGAACTCAGTTCCTAATTAATAGGGCTAGTG  929

seq1  CACTGTATGAAATTGAAAGGGCTCAGAGGAATAATGGAGATAGTTGAATG  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGTATGAAATTGAAAGGGCTCAGAGGAATAATGGAGATAGTTGAATG  979

seq1  TCTCCCCTGTCTGGACAACTGGCGCCACAATAGTGAAGATTTTCCTCTTG  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCCTGTCTGGACAACTGGCGCCACAATAGTGAAGATTTTCCTCTTG  1029

seq1  AAGAGCCTAGTATGATGGGCTATAATGGAGCAGTAAAGATTTGGTGAAAC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCCTAGTATGATGGGCTATAATGGAGCAGTAAAGATTTGGTGAAAC  1079

seq1  CAGCTTGAACCTTCTCCTGACATAAAAGTTCTTTCCACAGTCTTTGTCAC  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTTGAACCTTCTCCTGACATAAAAGTTCTTTCCACAGTCTTTGTCAC  1129

seq1  AAGTAGCCATTCAAACTGGCTGTAACCAAGAATTC  1183
      |||||||||||||||||||||||||||||||||||
seq2  AAGTAGCCATTCAAACTGGCTGTAACCAAGAATTC  1164

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information