MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-343F19
Chromosome	X (Build37)
Map Location	76,736,414 - 76,737,511
singlet/doublet	singlet
Overlap gene	EG636104
Upstream gene	Prrg1, LOC667679, LOC667684, 4921509A18Rik, LOC667700, EG546337, EG629116, LOC636082, EG667736, LOC100041373
Downstream gene	2410003J06Rik, LOC667749, LOC211702, LOC667755, LOC211705, LOC654474, LOC629153, LOC546338
Link	Open Mouse BAC browser

Click to get alignment info.

name	Prrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 3 Proteins

name	LOC667679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 21 Proteins pseudo : _no_value

name	LOC667684 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667684
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	4921509A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70864 MGI:1918114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 2 Proteins

name	LOC667700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG546337 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546337 MGI:3648845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 6 Proteins

name	EG629116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629116 MGI:3644407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 619 ESTs, 7 Proteins

name	LOC636082 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	EG667736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100041373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG636104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	2410003J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 44 ESTs, 18 Proteins

name	LOC667749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC211702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC667755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	LOC211705 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins pseudo : _no_value

name	LOC654474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654474
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	LOC629153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC546338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546338
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271775 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 6 transcript_id : XM_900528.3

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271774 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 1 transcript_id : XM_621045.4

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271773 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 5 transcript_id : XM_900525.3

name	4921509A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407597 GeneID:70864 MGI:1918114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 2 Proteins product : RIKEN cDNA 4921509A18 gene transcript_id : XM_135940.5

name	EG546337 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271779 GeneID:546337 MGI:3648845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 3 Proteins product : predicted gene, EG546337, transcript variant 1 transcript_id : XM_621046.4

name	EG629116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271780 GeneID:629116 MGI:3644407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 619 ESTs, 7 Proteins product : predicted gene, EG629116 transcript_id : XM_893941.3

name	LOC636082 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271717 GeneID:636082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : hypothetical LOC636082 transcript_id : XM_001476250.1

name	EG667736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271782 GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG667736 transcript_id : XM_992119.2

name	LOC100041373 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271719 GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100041373 transcript_id : XM_001476267.1

name	EG636104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271721 GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG636104 transcript_id : XM_001476286.1

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271784 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 1 transcript_id : XM_135953.7

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407568 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 42 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 2 transcript_id : XM_893039.2

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746591 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 1 protein_id : XP_621045.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001561 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 5 protein_id : XP_905618.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001563 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 6 protein_id : XP_905621.1

name	4921509A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984438 GeneID:70864 MGI:1918114
definition	codon_start : 1 product : hypothetical protein LOC70864 protein_id : XP_135940.1

name	EG546337 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001566 GeneID:546337 MGI:3648845
definition	codon_start : 1 product : similar to conserved nuclear protein Nhn1 isoform 1 protein_id : XP_621046.2

name	EG629116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271781 GeneID:629116 MGI:3644407
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899034.2

name	LOC636082 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271718 GeneID:636082
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476300.1

name	EG667736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271783 GeneID:667736 MGI:3643055
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997213.2

name	LOC100041373 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271720 GeneID:100041373
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476317.1

name	EG636104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271722 GeneID:636104 MGI:3645063
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476336.1

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984446 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 1 protein_id : XP_135953.1

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001575 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 2 protein_id : XP_898132.1

name	LOC667684 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667684
definition	number : 2 pseudo : _no_value

name	LOC667684 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667684
definition	number : 1 pseudo : _no_value

name	LOC667700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667700
definition	number : 1 pseudo : _no_value

name	LOC667749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667749
definition	number : 1 pseudo : _no_value

name	LOC211702 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211702
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 2 pseudo : _no_value

name	LOC629153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629153
definition	number : 1 pseudo : _no_value

name	LOC667679 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271776 GeneID:667679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 21 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_033334.1

name	LOC211705 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271723 GeneID:211705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins product : similar to prohibitin pseudo : _no_value transcript_id : XR_032681.1

clone name	MSMg01-396I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-327O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208G11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-343F19.b	B6Ng01-343F19.g
ACC	GA126159	GA126160
length	1,093	1,104
definition	B6Ng01-343F19.b	B6Ng01-343F19.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttaaaggtttagctctgaggcccattttttaatggggttattt gattttctggagtccaccttcttgagttctttatatatattggatattat tcccctatctgatttaggataggtaaagatcctttcccaatctgttggtg gcctttttgtcttattgatggtgtcttttaccttgcggaagctttgcaat tttatgaggtcccatttgtagattctcgatcttacagcacaagccatttc tgttctattcacgaattttccccctgtacccatatcttcgaggctttccc ctactttatcctctataagtttcagtgtctctggttttatgtggagttcc ttgattcacttagatttgaccttagtacaaggagataggaatggttcaat tagcattcttctacatgttaaccaccagttgtgccagcatcatttgttga aaatgttgtcttttttccactggatggttttagctcccttgtcaaagatc aagtgaccataagtgtgtgggttcatttctgagtcttcaattctattgca ttgatgtacctgtctgttgctgtaccagtaccatgcagtttttatcacaa ttgctctgtagtacagctctgagatcaggcatggtgtttcccccagaggt tcttttattgttgagaatagtttttgctatcctaggtttttcgttatttc agatgaatttgcaaattgccctttctaattcgttgaagaattgagttggg attttgatgcggatctcattgaatctgtagattgcttttggcaagatagc catttttactatattgaacctaccaatccatgagaatgggagatctttcc atcttctgagatcttccttaatttctttcttcagagacttgaagttctta tcatacagatctttcacttccttagttagagtcacaccaaggtattttct attatttgtaactattgagaaaggtgttgtttccctaatttcttctaagc ctgtttatccctttgtgtacagaaaggccaatgacttgtttggagttaat tttaatatccaagctacttacgtgaagttgctatatcacgtgc	gaattctcatgatgtgaaaacaaaatgaacaacattgtacatgcctttct ctgcagacattctgactctctagatgctattttcttggtgcttaacaatc tgttagctttgagagaagaagcttttaaggatggaggtatttcctcttct atttctgattgagagagtggtggtgactttagaccagataatggcagcat gccaatatctacttcattaactggaaactttcgttccctattttaaaaaa tgatgatatgatattattcatgactaatttgactaattacatattatata ttattataattaccattattaacaataatatcatcaataacactaaaaat aatgagtaattaaggaattcttcagaaaatacagttgtaaatacaaatat ccttcatgggaaaccttatagcctaatctatatctatttacctgaattgg tatactaatctgcagaaggttttcttccactatatggcctcaactcttct taaacacctcacagaagaagttatagccaaacctatatcattgtcacact caaagggcagatgacagccactgaggggtttggagtaaagtaaaatgtat ctttggttcaagatggaaacaatgattgatgtcatttatgttcaaaagaa tcttgccatcaaactaagtacacacttgatctgaaatacattaagtcttc ccctgatgtatgtactctgattccaacatcctagacagcattgtcttggt agcatgattttgctgaaaggaccctgatatagttgtctcttgtgaggcta tgccagtgcctggcaaatatagaagtggatggtcacagtcagctattgga tggaacaaagggcccccaatggaggagctagagaaagtacccaaggagct aaaggggtctgcaacctctataggtggaacacaatatgaactaaccagta cccccagagctcatgtctctagctgcatatgtagcagaagatggccttag tcgttcatcatgggagagagtcccttgtccatcgccaaactttatattgt cccaagtacaaggggaatgcctaggtcagaaagtggtgaagtgggctggg tagg
quality values	Open. Hide. 49 29 26 35 58 54 49 58 54 58 58 47 62 41 15 62 62 47 47 62 62 62 62 62 62 49 47 43 56 47 37 38 49 56 62 62 47 62 62 59 62 62 62 59 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 47 58 58 54 58 48 54 58 58 54 58 54 58 58 58 58 53 52 58 52 54 52 41 58 58 58 58 58 58 54 58 58 54 58 42 54 54 54 54 58 58 58 54 58 58 45 27 42 39 48 54 47 58 50 41 51 58 58 51 58 50 58 50 58 49 18 49 58 52 34 45 13 38 47 50 50 53 58 58 50 42 40 50 54 32 58 34 51 35 58 42 40 49 38 41 58 58 58 51 51 37 51 40 52 51 58 50 53 34 49 32 58 58 58 40 39 41 58 46 41 48 49 58 52 50 40 54 31 40 58 39 37 58 58 50 52 50 58 31 49 53 51 50 58 50 41 58 49 39 28 31 53 49 54 42 31 39 58 50 58 58 32 58 42 37 46 50 58 39 43 54 35 54 39 21 20 54 54 41 38 41 32 49 50 44 32 39 39 45 49 39 31 39 49 51 29 44 40 37 39 49 32 39 20 18 12 25 53 37 47 51 49 42 42 44 26 40 53 33 41 28 45 40 19 15 31 33 54 54 54 45 34 40 32 33 42 30 29 32 36 42 42 34 33 32 33 46 41 33 33 37 36 31 31 31 52 53 19 40 12 21 45 46 32 38 22 33 17 32 32 51 52 21 47 18 28 32 28 53 40 35 36 53 26 30 26 26 21 33 25 31 46 12 9 26 41 51 29 27 29 46 23 35 23 33 31 25 18 35 19 24 24 18 34 30 32 30 21 38 25 34 38 43 32 31 29 32 36 25 31 30 24 18 11 10 27 46 25 25 17 15 20 26 24 43 23 29 27 31 38 18 23 31 31 20 25 14 10 6 5 26 26 21 16 10 27 30 36 31 46 48 24 26 21 31 8 29 20 26 23 25 39 15 30 22 31 21 26 8 24 20 24 21 22 44 14 24 24 6 7 11 21 14 5 20 9 12 27 20 8 8 21 11 29 30 15 16 6 19 10 25 21 27 22 23 33 32 13 27 19 19 17 17 22 9 17 24 11 7 6 6 4 5 7 6 7 33 15 7 4 4 5 13 8 6 25 9 30 31 24 8 8 9 36 28 10 9 21 16 22 21 17 17 21 36 36 9 7 9 7 5 8 15 25 6 5 8 11 15 11 7 13 11 5 12 7 7 10 5 5 8 13 7 7 5 9 4 9 11 10 8 5 8 18 6 6 5	Open. Hide. 62 47 56 47 62 62 62 47 47 51 38 29 35 43 35 50 59 62 62 62 62 51 62 62 62 46 62 62 62 62 62 62 59 59 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 54 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 54 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 58 58 54 54 54 58 48 54 52 44 52 54 54 58 58 58 58 54 58 58 58 54 54 54 58 54 58 58 58 54 58 58 58 49 58 58 58 49 54 47 58 45 42 58 54 58 38 41 58 58 58 42 38 58 58 54 54 58 58 58 58 58 52 49 58 58 58 54 52 58 58 58 54 46 58 53 51 58 53 58 58 58 58 51 49 58 49 51 58 53 54 33 58 44 58 58 47 50 46 51 51 58 42 33 51 58 47 38 58 52 50 35 51 58 54 50 53 58 51 49 50 32 58 49 39 32 58 35 39 53 53 52 58 31 43 34 51 50 52 58 54 50 49 46 49 32 53 45 53 52 50 50 51 58 51 46 39 50 52 51 49 52 58 31 37 39 49 32 51 52 49 49 40 36 53 52 41 31 44 31 26 31 46 39 39 53 42 52 52 51 40 39 41 51 53 53 51 49 37 50 30 50 29 38 38 31 52 39 47 41 49 28 31 26 39 33 35 41 53 53 49 42 45 39 46 54 26 37 38 31 44 27 41 45 29 22 54 54 47 38 40 53 40 53 54 45 26 42 25 10 27 42 42 41 34 31 29 42 37 35 53 53 52 32 31 33 32 33 42 38 32 32 53 32 53 28 40 31 29 34 31 27 21 33 31 34 31 34 32 30 40 31 36 51 40 29 26 31 31 24 43 46 27 25 51 31 33 30 31 37 25 34 33 30 24 31 28 39 28 28 31 43 36 31 11 11 24 8 18 33 25 25 27 27 27 42 41 24 46 35 30 40 40 40 26 24 16 23 28 24 40 20 20 31 7 28 31 28 25 29 20 33 46 38 31 31 27 30 23 29 19 30 25 30 31 20 28 31 13 46 17 25 46 33 26 24 32 32 31 21 7 29 21 24 5 6 29 28 31 25 21 25 22 24 31 29 31 17 36 15 7 24 31 32 34 29 17 25 21 36 21 16 10 17 26 32 27 29 29 31 29 27 30 22 16 30 8 23 32 23 24 28 32 31 32 32 25 32 18 15 15 14 14 23 13 29 14 27 32 23 24 28 32 21 9 33 24 14 22 10 9 24 9 16 11 6 7 6 9 27 20 21 8 14 9 28 17 9 10 3 16 5 6 3 7 6 8 7 7 12 27 14 11 8 13 3 15 20 16 9 5 5 8 7 13 30 15 24 26 29 22 8 12 9 10 9 13 5 13 27 20 4 5 3 9 10 25 10 9 28 30 40 11 11 20 16 13 14 18 8 6 15 14 8 12 23 10 18 23 10 3 7 6 8 7 10 11 18 5 16 19 21 18 4 11 12 22 7 2 3 6 10

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_76736414_76737511
seq2: B6Ng01-343F19.g_67_1170

seq1  GAATTCTCATGATGTGAAAACAAAATGAACAACATTGTACATGCCTTTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCATGATGTGAAAACAAAATGAACAACATTGTACATGCCTTTCT  50

seq1  CTGCAGACATTCTGACTCTCTAGATGCTATTTTCTTGGTGCTTAACAATC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCAGACATTCTGACTCTCTAGATGCTATTTTCTTGGTGCTTAACAATC  100

seq1  TGTTAGCTTTGAGAGAAGAAGCTTTTAAGGATGGAGGTATTTCCTCTTCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAGCTTTGAGAGAAGAAGCTTTTAAGGATGGAGGTATTTCCTCTTCT  150

seq1  ATTTCTGATTGAGAGAGTGGTGGTGACTTTAGACCAGATAATGGCAGCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTGATTGAGAGAGTGGTGGTGACTTTAGACCAGATAATGGCAGCAT  200

seq1  GCCAATATCTACTTCATTAACTGGAAACTTTCGTTCCCTATTTTAAAAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAATATCTACTTCATTAACTGGAAACTTTCGTTCCCTATTTTAAAAAA  250

seq1  TGATGATATGATATTATTCATGACTAATTTGACTAATTACATATTATATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGATATGATATTATTCATGACTAATTTGACTAATTACATATTATATA  300

seq1  TTATTATAATTACCATTATTAACAATAATATCATCAATAACACTAAAAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTATAATTACCATTATTAACAATAATATCATCAATAACACTAAAAAT  350

seq1  AATGAGTAATTAAGGAATTCTTCAGAAAATACAGTTGTAAATACAAATAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAGTAATTAAGGAATTCTTCAGAAAATACAGTTGTAAATACAAATAT  400

seq1  CCTTCATGGGAAACCTTATAGCCTAATCTATATCTATTTACCTGAATTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCATGGGAAACCTTATAGCCTAATCTATATCTATTTACCTGAATTGG  450

seq1  TATACTAATCTGCAGAAGGTTTTCTTCCACTATATGGCCTCAACTCTTCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATACTAATCTGCAGAAGGTTTTCTTCCACTATATGGCCTCAACTCTTCT  500

seq1  TAAACACCTCACAGAAGAAGTTATAGCCAAACCTATATCATTGTCACACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACACCTCACAGAAGAAGTTATAGCCAAACCTATATCATTGTCACACT  550

seq1  CAAAGGGCAGATGACAGCCACTGAGGGGTTTGGAGTAAAGTAAAATGTAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGGGCAGATGACAGCCACTGAGGGGTTTGGAGTAAAGTAAAATGTAT  600

seq1  CTTTGGTTCAAGATGGAAACAATGATTGATGTCATTTATGTTCAAAAGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGGTTCAAGATGGAAACAATGATTGATGTCATTTATGTTCAAAAGAA  650

seq1  TCTTGCCATCAAACTAAGTACACACTTGATCTGAAATACATTAAGTCTTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCCATCAAACTAAGTACACACTTGATCTGAAATACATTAAGTCTTC  700

seq1  CCCTGATGTATGTACTCTGATTCCAACATCCTAGACAGCATTGTCTTGGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGATGTATGTACTCTGATTCCAACATCCTAGACAGCATTGTCTTGGT  750

seq1  AGCATGATTTTGCTGAAAGGACCCTGATATAGTTGTCTCTTGTGAGGCTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATGATTTTGCTGAAAGGACCCTGATATAGTTGTCTCTTGTGAGGCTA  800

seq1  TGCCAGTGCCTGGCAAATATAGAAGTGGATGGTCACAGTCAGCTATTGGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAGTGCCTGGCAAATATAGAAGTGGATGGTCACAGTCAGCTATTGGA  850

seq1  TGGAACAAAGGGCCCCCAATGGAGGAGCTAGAGAAAGTACCCAAGGAGCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAACAAAGGGCCCCCAATGGAGGAGCTAGAGAAAGTACCCAAGGAGCT  900

seq1  AAAGGGGTCTGCAACC-CTATAGGTGGAACAACAATATGAACTAACCAGT  949
      |||||||||||||||| ||||||||||||| |||||||||||||||||||
seq2  AAAGGGGTCTGCAACCTCTATAGGTGGAAC-ACAATATGAACTAACCAGT  949

seq1  ACCCCCAGAGCTCATGTCTCTAGCTGCATATGTAGCAGAAGATGGCC-TA  998
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  ACCCCCAGAGCTCATGTCTCTAGCTGCATATGTAGCAGAAGATGGCCTTA  999

seq1  GTCGTCCATCATTGGGAAGAGAGGTCCCTTGGCCA-CG-CAAACTTTATA  1046
      ||||| ||||||  || ||||| |||||||| ||| || |||||||||||
seq2  GTCGTTCATCAT--GGGAGAGA-GTCCCTTGTCCATCGCCAAACTTTATA  1046

seq1  T--GCCCCAGTAC-AGGGGAATGCCAGGGTCAAGAAGTG--GGAGTGGG-  1090
      |   ||| ||||| |||||||||||  |||||  |||||  | |||||| 
seq2  TTGTCCCAAGTACAAGGGGAATGCCTAGGTCAGAAAGTGGTGAAGTGGGC  1096

seq1  TGGGTAGG  1098
      ||||||||
seq2  TGGGTAGG  1104

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information