MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-062A13
Chromosome	X (Build37)
Map Location	132,278,430 - 132,279,212
singlet/doublet	singlet
Overlap gene	Gprasp1
Upstream gene	LOC100040520, Armcx6, Armcx3, Armcx2, LOC637800, LOC100040987, Nxf2, B930008K04Rik, EG621246, LOC100040635, Tceal6, EG621322, Pramel3, EG621352, EG331529, EG621380, EG666040, EG666045, AV320801, EG621467, Nxf7, 4930534P07Rik, 1700008I05Rik, 1700129I15Rik
Downstream gene	Gprasp2, Bhlhb9, LOC100041110, 2900062L11Rik, 6530401D17Rik, Bex2, Nxf3, Bex4, Tceal8, Tceal5, Bex1, LOC100040972, Wbp5, Ngfrap1, LOC666180, LOC237048, LOC666196, Kir3dl2, LOC100041079, Kir3dl1, Tceal3, Tceal1, Morf4l2, BC065397
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040520 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Armcx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278097 MGI:2147993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armcx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71703 MGI:1918953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armcx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67416 MGI:1914666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC637800 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	LOC100040987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nxf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83454 MGI:1933192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930008K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215693 MGI:2442284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621246 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621246 MGI:3645256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040635 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins

name	Tceal6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66104 MGI:1923939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621322 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621322 MGI:3643636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Pramel3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83565 MGI:1890657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621352 MGI:3647031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG331529 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331529 MGI:3647038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621380 MGI:3648721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG666040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666040 MGI:3648697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins

name	EG666045 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666045 MGI:3648700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	AV320801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331531 MGI:3035227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins

name	EG621467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621467 MGI:3643481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Nxf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170722 MGI:2159343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930534P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75829 MGI:1923079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins

name	1700008I05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71841 MGI:1919091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700129I15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78478 MGI:1925728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprasp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67298 MGI:1917418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Gprasp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 58 ESTs, 3 Proteins

name	Bhlhb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70237 MGI:1917487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	2900062L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76976 MGI:1924226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	6530401D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76219 MGI:1923469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Bex2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12069 MGI:1338017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nxf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245610 MGI:2685230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bex4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406217 MGI:3606746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceal8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66684 MGI:1913934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceal5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331532 MGI:3036236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bex1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19716 MGI:1328321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Wbp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22381 MGI:109567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngfrap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12070 MGI:1338016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	LOC237048 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:237048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666196 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 ESTs, 7 Proteins pseudo : _no_value

name	Kir3dl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245615 MGI:3612791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein

name	Kir3dl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245616 MGI:2652397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:594844 MGI:1913354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237052 MGI:2385317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morf4l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56397 MGI:1927167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC065397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436230 MGI:3584520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040520 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272253 GeneID:100040520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040520 transcript_id : XM_001474152.1

name	Armcx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090482 GeneID:278097 MGI:2147993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 6 transcript_id : NM_001007578.1

name	Armcx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311832 GeneID:71703 MGI:1918953
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 3 transcript_id : NM_027870.1

name	Armcx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372774 GeneID:67416 MGI:1914666
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 2 transcript_id : NM_026139.3

name	Nxf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13752590 GeneID:83454 MGI:1933192
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 2 transcript_id : NM_031259.1

name	B930008K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185886 GeneID:215693 MGI:2442284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930008K04 gene transcript_id : NM_175446.3

name	LOC100040635 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272260 GeneID:100040635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins product : similar to AV320801 protein transcript_id : XM_001474398.1

name	Tceal6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377046 GeneID:66104 MGI:1923939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 6 transcript_id : NM_025355.3

name	EG621322 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83003999 GeneID:621322 MGI:3643636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621322 transcript_id : XM_885719.1

name	Pramel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878222 GeneID:83565 MGI:1890657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma-like 3 transcript_id : NM_031390.1

name	EG621352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408263 GeneID:621352 MGI:3647031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621352 transcript_id : XM_885753.2

name	EG331529 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354224 GeneID:331529 MGI:3647038
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG331529 transcript_id : NM_183320.2

name	EG621380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83004003 GeneID:621380 MGI:3648721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621380 transcript_id : XM_885786.1

name	EG666040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408265 GeneID:666040 MGI:3648697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins product : predicted gene, EG666040 transcript_id : XM_981153.1

name	EG666045 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408267 GeneID:666045 MGI:3648700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666045 transcript_id : XM_981193.1

name	AV320801 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408269 GeneID:331531 MGI:3035227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins product : expressed sequence AV320801 transcript_id : XM_284742.5

name	Nxf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794231 GeneID:170722 MGI:2159343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 7 transcript_id : NM_130888.1

name	4930534P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408271 GeneID:75829 MGI:1923079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins product : RIKEN cDNA 4930534P07 gene transcript_id : XM_136073.3

name	1700008I05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802960 GeneID:71841 MGI:1919091
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700008I05 gene transcript_id : NM_027952.2

name	1700129I15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158706 GeneID:78478 MGI:1925728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700129I15 gene transcript_id : NM_030106.2

name	Gprasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53729354 GeneID:67298 MGI:1917418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor associated sorting protein 1 transcript_id : NM_001005385.1

name	Gprasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53729356 GeneID:67298 MGI:1917418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor associated sorting protein 1 transcript_id : NM_026081.5

name	Gprasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53729357 GeneID:67298 MGI:1917418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor associated sorting protein 1 transcript_id : NM_001004359.2

name	Gprasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408272 GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 58 ESTs, 3 Proteins product : G protein-coupled receptor associated sorting protein 2, transcript variant 1 transcript_id : XM_142154.6

name	Gprasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272267 GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 3 Proteins product : G protein-coupled receptor associated sorting protein 2 transcript_id : XM_001474818.1

name	Gprasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272265 GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 3 Proteins product : G protein-coupled receptor associated sorting protein 2 transcript_id : XM_001474790.1

name	Bhlhb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37718978 GeneID:70237 MGI:1917487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic helix-loop-helix domain containing, class B9 transcript_id : NM_198161.1

name	Bex2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753183 GeneID:12069 MGI:1338017
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain expressed X-linked 2 transcript_id : NM_009749.1

name	Nxf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366895 GeneID:245610 MGI:2685230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 3 transcript_id : NM_001024141.2

name	Bex4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059052 GeneID:406217 MGI:3606746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain expressed gene 4 transcript_id : NM_212457.1

name	Tceal8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981214 GeneID:66684 MGI:1913934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 8 transcript_id : NM_025703.2

name	Tceal5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559433 GeneID:331532 MGI:3036236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 5 transcript_id : NM_177919.1

name	Bex1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059481 GeneID:19716 MGI:1328321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain expressed gene 1 transcript_id : NM_009052.2

name	LOC100040972 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272272 GeneID:100040972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040972 transcript_id : XM_001474960.1

name	Wbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374169 GeneID:22381 MGI:109567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 5 transcript_id : NM_011712.2

name	Ngfrap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753185 GeneID:12070 MGI:1338016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nerve growth factor receptor (TNFRSF16) associated protein 1 transcript_id : NM_009750.1

name	Kir3dl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343130 GeneID:245615 MGI:3612791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 transcript_id : NM_177748.2

name	LOC100041079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272277 GeneID:100041079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein product : hypothetical protein LOC100041079 transcript_id : XM_001475075.1

name	Kir3dl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490383 GeneID:245616 MGI:2652397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 transcript_id : NM_177749.3

name	Tceal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71533183 GeneID:594844 MGI:1913354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 3 transcript_id : NM_001029978.1

name	Tceal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122806 GeneID:237052 MGI:2385317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 1 transcript_id : NM_146236.1

name	Morf4l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054116 GeneID:56397 MGI:1927167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mortality factor 4 like 2 transcript_id : NM_019768.3

name	BC065397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376761 GeneID:436230 MGI:3584520
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC065397 transcript_id : NM_001033001.2

name	LOC100040520 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272254 GeneID:100040520
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474202.1

name	Armcx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090483 CCDS:CCDS30399.1 GeneID:278097 MGI:2147993
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : armadillo repeat containing, X-linked 6 protein_id : NP_001007579.1

name	Armcx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311833 CCDS:CCDS30400.1 GeneID:71703 MGI:1918953
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : armadillo repeat containing, X-linked 3 protein_id : NP_082146.1

name	Armcx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981055 CCDS:CCDS30401.1 GeneID:67416 MGI:1914666
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : armadillo repeat containing, X-linked 2 protein_id : NP_080415.2

name	Nxf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752591 GeneID:83454 MGI:1933192
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IPI]; GO:0006405 - RNA export from nucleus [Evidence IDA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nuclear RNA export factor 2 protein_id : NP_112549.1

name	B930008K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185887 GeneID:215693 MGI:2442284
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger, matrin type 1 protein_id : NP_780655.2

name	LOC100040635 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272261 GeneID:100040635
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474448.1

name	Tceal6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981279 CCDS:CCDS30402.1 GeneID:66104 MGI:1923939
definition	codon_start : 1 note : novel protein similar to transcription elongation factor A (SII)-like 5 Tceal5 product : transcription elongation factor A (SII)-like 6 protein_id : NP_079631.2

name	EG621322 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004000 GeneID:621322 MGI:3643636
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890812.1

name	Pramel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878223 CCDS:CCDS30403.1 GeneID:83565 MGI:1890657
definition	codon_start : 1 product : preferentially expressed antigen in melanoma-like 3 protein_id : NP_113567.1

name	EG621352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408264 GeneID:621352 MGI:3647031
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890846.2

name	EG331529 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304008 GeneID:331529 MGI:3647038
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC331529 protein_id : NP_899143.1

name	EG621380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004004 GeneID:621380 MGI:3648721
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890879.1

name	EG666040 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408266 GeneID:666040 MGI:3648697
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986247.1

name	EG666045 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408268 GeneID:666045 MGI:3648700
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986287.1

name	AV320801 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772414 GeneID:331531 MGI:3035227
definition	codon_start : 1 product : hypothetical protein LOC331531 protein_id : XP_284742.2

name	Nxf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794232 CCDS:CCDS30406.1 GeneID:170722 MGI:2159343
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nuclear export factor a; nuclear RNA export factor 6 product : nuclear RNA export factor 7 isoform 2 protein_id : NP_570958.1

name	4930534P07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004011 GeneID:75829 MGI:1923079
definition	codon_start : 1 product : hypothetical protein LOC75829 protein_id : XP_136073.2

name	1700008I05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274121 GeneID:71841 MGI:1919091
definition	codon_start : 1 exception : mismatches in translation note : t-complex 11 product : t-complex 11 protein protein_id : NP_082228.1

name	1700129I15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274119 GeneID:78478 MGI:1925728
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : novel protein similar to thymosin, beta (Tmsb) product : thymosin beta-like protein 1 protein_id : NP_084382.1

name	Gprasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51988908 CCDS:CCDS30409.1 GeneID:67298 MGI:1917418
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : G protein-coupled receptor associated sorting protein 1 protein_id : NP_001004359.1

name	Gprasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53729355 CCDS:CCDS30409.1 GeneID:67298 MGI:1917418
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : G protein-coupled receptor associated sorting protein 1 protein_id : NP_001005385.1

name	Gprasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51988906 CCDS:CCDS30409.1 GeneID:67298 MGI:1917418
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : G protein-coupled receptor associated sorting protein 1 protein_id : NP_080357.4

name	Gprasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272266 GeneID:245607 MGI:2442071
definition	codon_start : 1 product : similar to G-protein coupled receptor-associated sorting protein 2 (GASP-2) protein_id : XP_001474840.1

name	Gprasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272268 GeneID:245607 MGI:2442071
definition	codon_start : 1 product : similar to G-protein coupled receptor-associated sorting protein 2 (GASP-2) protein_id : XP_001474868.1

name	Gprasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20985637 GeneID:245607 MGI:2442071
definition	codon_start : 1 product : similar to G-protein coupled receptor-associated sorting protein 2 (GASP-2) isoform 1 protein_id : XP_142154.1

name	Bhlhb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718979 CCDS:CCDS30410.1 GeneID:70237 MGI:1917487
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : basic helix-loop-helix domain containing, class B9 protein_id : NP_937804.1

name	Bex2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753184 CCDS:CCDS30413.1 GeneID:12069 MGI:1338017
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : brain expressed X-linked 2 protein_id : NP_033879.1

name	Nxf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66571305 GeneID:245610 MGI:2685230
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IPI]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nuclear RNA export factor 3 protein_id : NP_001019312.1

name	Bex4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059053 CCDS:CCDS30414.1 GeneID:406217 MGI:3606746
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : brain expressed, X-linked 4; brain expressed X-linked 4 product : Bex4 protein protein_id : NP_997622.1

name	Tceal8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981215 CCDS:CCDS30415.1 GeneID:66684 MGI:1913934
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription elongation factor A (SII)-like 8 protein_id : NP_079979.2

name	Tceal5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559434 CCDS:CCDS30416.1 GeneID:331532 MGI:3036236
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription elongation factor A (SII)-like 5 protein_id : NP_808587.1

name	Bex1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059482 CCDS:CCDS30417.1 GeneID:19716 MGI:1328321
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045665 - negative regulation of neuron differentiation [Evidence ISS]; GO:0048011 - nerve growth factor receptor signaling pathway [Evidence ISS]; GO:0007399 - nervous system development [Evidence IEA]; GO:0002052 - positive regulation of neuroblast proliferation [Evidence ISS] codon_start : 1 note : reduced expression 3 product : brain expressed, X-linked 1 protein_id : NP_033078.2

name	LOC100040972 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272273 GeneID:100040972
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475010.1

name	Wbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468951 CCDS:CCDS30418.1 GeneID:22381 MGI:109567
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0050699 - WW domain binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WW domain binding protein 5 protein_id : NP_035842.1

name	Ngfrap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753186 CCDS:CCDS30419.1 GeneID:12070 MGI:1338016
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005123 - death receptor binding [Evidence IPI]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0008625 - induction of apoptosis via death domain receptors [Evidence IPI] codon_start : 1 note : p75NTR-associated Cell Death Executor; brain expressed X-linked 3; granule cell antiserum positive 27 product : nerve growth factor receptor (TNFRSF16) associated protein 1 protein_id : NP_033880.1

name	Kir3dl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244534 GeneID:245615 MGI:3612791
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : KIR-like receptor 2; killer cell immunoglobulin-like receptor three domains long cytoplasmic tail 2 product : killer immunoglobulin-like receptor-like 2 protein_id : NP_808416.1

name	LOC100041079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272278 GeneID:100041079
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475125.1

name	Kir3dl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490384 GeneID:245616 MGI:2652397
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : killer cell immunoglobulin-like receptor Kir3dl1; killer immunoglobulin receptor-like protein 1; KIR-like receptor 1 product : killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 protein_id : NP_808417.2

name	Tceal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71533184 CCDS:CCDS30420.1 GeneID:594844 MGI:1913354
definition	codon_start : 1 exception : mismatches in translation product : transcription elongation factor A (SII)-like 3 protein_id : NP_001025149.1

name	Tceal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122807 CCDS:CCDS30421.1 GeneID:237052 MGI:2385317
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription elongation factor A (SII)-like 1 protein_id : NP_666348.1

name	Morf4l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50054117 CCDS:CCDS30422.1 GeneID:56397 MGI:1927167
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MORF-related gene X product : mortality factor 4 like 2 protein_id : NP_062742.3

name	BC065397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701590 GeneID:436230 MGI:3584520
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC436230 protein_id : NP_001028173.1

name	LOC100040987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040987
definition	number : 2 pseudo : _no_value

name	LOC100040987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040987
definition	number : 1 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 3 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 2 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 1 pseudo : _no_value

name	EG621467 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621467
definition	number : 1 pseudo : _no_value

name	EG621467 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621467
definition	number : 2 pseudo : _no_value

name	EG621467 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621467
definition	number : 3 pseudo : _no_value

name	LOC100041110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041110
definition	number : 1 pseudo : _no_value

name	LOC100041110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041110
definition	number : 2 pseudo : _no_value

name	LOC100041110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041110
definition	number : 3 pseudo : _no_value

name	LOC237048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:237048
definition	number : 1 pseudo : _no_value

name	LOC637800 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272274 GeneID:637800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to hCG2016250 pseudo : _no_value transcript_id : XR_032324.1

name	2900062L11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272235 GeneID:76976 MGI:1924226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900062L11 gene pseudo : _no_value transcript_id : XR_035168.1

name	6530401D17Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272236 GeneID:76219 MGI:1923469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6530401D17 gene pseudo : _no_value transcript_id : XR_035169.1

name	LOC666180 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272275 GeneID:666180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to RIKEN cDNA 5730427N09 gene pseudo : _no_value transcript_id : XR_032038.1

name	LOC666196 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272276 GeneID:666196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 ESTs, 7 Proteins product : similar to Btf3 protein pseudo : _no_value transcript_id : XR_032046.1

clone name	MSMg01-426J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-170D18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-082H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-485E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153K09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187L07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330C10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264D10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-062A13.T7 (MSMg01no062_a13.b1)	MSMg01-062A13.TJ (MSMg01no062_a13.g1)
ACC	AG288103	AG288104
length	1,160	1,211
length of high quality (start - end)	763 (89 - 851)	695 (123 - 817)
definition	CHROMAT_FILE: MSMg01no062_a13.b1 PHD_FILE: MSMg01no062_a13.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:05:12 2005	CHROMAT_FILE: MSMg01no062_a13.g1 PHD_FILE: MSMg01no062_a13.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:05:12 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CCCTTTTTTTTTNTTAGCAATGGGCGCTNXXXXXXXXXXXXXXXXXXXXX XXCGCGGAATTCTTTACCAAACAAGTATCCGTTATACAGCAAGCATTTAT TCCGTAATTACTGTTTCCTACATTATACTCAGTAGTGCCGCCCTCATGTT TGTGGATTTCCATTGATAGACACATCCGGAGGGTTGTATAACTTGGCTGT TGTGAATGTTTGTAAAATAACTGAATGTGAAGCTAGGAGATAATGAGAAG GCAATTGTCCAGATTCGAGGATTAGTGTGAAGACAGACAAGGATCACTGA GACTAGAATGTCACATCCTTCTGTTTTGTCAGTTTCTGTGGATTCACTTA GGAGTCTTGGTCTAACTCTAGAGATAGATGCAGGATGGGAACATCTTCCT TTAATCCCCTCTTCCCTGTCCTGCTCTAACACTTCATTATCAACCGATTT TTCAACTAAGGGATTACCGAAACAGTCACTCAAGAAGACAATGGAGGGCC CCAAGGGAGGAGGAGGAAGAGGAGGAGGAACAGCTTTGAAGCTGGTTAAT GGAAGGAGAGGAAGACCAGGAAGGGAAAAGCTAGACAAGCTTCTCTGAGA AGGCAAGAATAAGGGCCAGGAACCAAGGTCTGTATCCCAAGAGCTGAGTT TCTCTGTCCTCTTTATCTATCTATAGGTTTGCCAGATCTGCTGCAGGGCT TGTCGCCAGTGGAAACAGAGAAAGGAGGAAACAATCCCTTGGCAAGAGCG CAGGTTAGTATGAACGTGGGGACTCCTCGAGTAAGACCTATAGTATGGAA CAGTAAAGATTTGGTTGGCTCCAGCCTAGGTCAGCAGATAGCCTCGGAAT TTTGCAGCCTCTCGTGTCCATCCAGCTTTCCTATTCTTTCTGCCCTTATT GGTGTCTGCAAAGACAAATTGGTAGCACATGAAGGTATAGACAGTGGGTG AACTGAAAGGAAGAATTGGGTCCTTGTCTCCTTCTTTCCCCTAGAAAAAC TGAATTTCCTATTTTAAATATTTCTCCGGGGGTTATTCCCCTGAAAAAAA AAAACAATTTTGTTAAAAAAATTATATTCCCCTTTTTTTTTTCTTCCTCC CTATATGTCACTTTTTTGGTAAAAAATTCTTATGTCCCTTCTAAAGGGTT GTAAAAAACC	NCCCATTCTTTTTTTTNAGATGGGAGGCTGGGGXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXCCTTTAAGACAGCCAGGGCTAC ACAGAGAAACCCTGGTCTCGAAAAAACAAAAAAAAAACACCCCAACTAAC AAAAAAAAACAAAAAACAAAAAACAAAAAAAAAAAAGAAAGAAAGAAAGA AAGAAAAAAAATTGAACTTACTCTCGAGGATAAGTGAAAGTGAAAGGGGA AAAATTCCAAGCAAATGGAACCAAGAAGCAAGCTGGTGTCACATATCTTA ATATCTGACAAAATAGAATTCATACTATAATTAATCAAGAGATAAAGTAG AACACATCATTCTAACCAAGGGAACATTCTGCCAAGAAGGTATTATAGTC CTAAGGATATATACACCAAATTCTGGTGCACCCAATTTCATTTTTAAAAA AAATCACATGCTATTATTGGTATTAAATATACAGAGTAAGTCTAGCTCAG TAATAGTAGGTACTGACAGTACCTCACTTTCTTCAATAGATAAGTCATCT GGACAAAATATAAATAGTAGAATTAAGTGACACCATACATTAAATGAATC TAATACGTATCAAACAGAATATTTCACCTAAACATCAAAGAATATATATT CTACTCAGTAACTCATGTAAGCTGCTCTAAAATGAGACCATATCCTGAGA CACAAAACAACTCTCATCAAATCCAGAAAAATTGAAATAACCATGAATAC TATCTGACCAGAACGCAATGAAGCTTAAGATAAACAGTAAATGAATCTAG TAATTACATAAATTCATAGATATTAAATGACACATTACTTAATGATGAAT AGGTCTAANAAGAAAACAAGAAATGTATTTAAAATTTCCCAGGATTATGT GAAAATGAAACTGGAGGGAGTGGCTCTAAGGCTAAGGTCCTGTTTCCCAA TTGGTTCTTGAATCATCAATAAAGATGCTATCAGCCCGTGAGCTGGGTTA GAAAAAGCAGGACTTCCTGGTCCCTGAAGGCAAGCTAACAACTGCAGGGA AAAAGGGAAATTTTCCCCAAGCTTTGGAAAGAAAAAAAGGGGATGACTCC TGAAAAATTTAGCCCAAAAAGGGCAAAGACCCTTTTCCCCATGGGGGAAT TATAAAAGGCAACCCAATTGTAGGGCCAAATTTATGGGGCCGAACAAAAA AAAAGGGGCAT
quality values	Open. Hide. 13 13 11 11 8 8 8 8 8 8 9 3 0 3 9 8 7 3 6 8 6 8 8 9 9 10 9 3 0 3 9 13 17 19 8 8 8 10 12 12 13 14 28 29 31 34 34 36 47 47 47 53 53 47 53 50 50 50 43 43 43 42 36 36 36 38 36 47 44 44 39 37 28 25 21 21 10 10 8 8 8 9 6 6 6 6 8 8 15 24 37 37 39 44 44 53 53 53 53 53 53 50 50 50 50 50 47 53 47 47 47 47 53 50 50 42 30 31 16 16 11 12 12 27 27 36 36 36 36 41 33 33 33 33 30 21 21 8 6 6 6 6 8 17 22 33 33 33 33 33 44 50 50 57 59 59 57 57 57 53 53 53 57 57 53 53 53 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 54 54 54 57 57 57 57 68 68 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 68 68 68 68 68 57 68 57 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 43 52 62 62 62 62 68 68 68 68 68 68 68 68 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 52 52 52 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 59 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 59 59 59 59 57 68 57 57 57 57 57 57 57 68 57 57 57 57 57 57 57 57 57 57 57 52 57 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 57 57 59 59 68 59 59 59 59 44 44 44 57 57 57 57 57 57 57 57 57 68 57 57 57 57 54 54 54 57 57 57 57 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 59 57 57 57 57 57 57 57 57 54 54 54 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 47 44 41 41 37 37 41 43 59 59 47 47 47 48 59 48 48 48 48 48 48 57 59 57 46 46 46 46 43 43 43 42 47 42 59 59 48 48 48 48 48 41 47 59 43 44 44 43 36 28 32 31 32 39 41 44 47 59 59 41 48 48 48 41 40 37 37 37 37 37 32 37 39 39 44 59 59 35 37 28 37 43 48 47 41 37 37 37 37 28 26 20 24 19 17 20 30 34 37 30 30 28 30 30 20 20 32 30 41 41 43 43 47 47 41 41 39 39 37 35 29 31 31 32 37 30 34 28 34 28 39 39 32 27 24 12 12 11 15 18 27 23 30 23 23 19 26 17 21 16 20 25 31 28 22 28 19 19 9 10 11 13 13 14 25 14 11 13 8 8 8 17 19 41 28 20 19 22 22 20 22 24 15 16 26 26 28 22 31 37 34 34 28 14 13 8 8 8 19 17 32 31 25 27 27 27 24 23 24 15 16 11 19 19 18 15 9 9 9 15 19 32 20 10 9 8 8 13 8 10 13 17 23 11 11 11 11 13 18 13 13 8 8 10 8 8 8 10 10 17 10 10 8 8 8 8 12 15 9 8 10 10 10 10 16 14 9 9 11 8 8 8 8 7 7 8 8 8 8 10 10 14 11 8 8 8 8 9 9 11 10 10 8 8 10 8 12 11 9 10 7 7 7 8 6 8 6 6 11 8 9 9 21 14 10 12 11 8 8 8 8 13 15 15 8 8 6 6 8 8 8 8 8 8 10 8 9 12 9 9 9 9 9 10 10 10 10 8 8 8 8 8 8 9 10 11 17 18 16 13 15 14 12 12 11 12 10 10 6 6 6 6 6 6 7 13 10 9 7 7 7 8 7 8 10 18 18 14 14 12 14 18 16 19 19 20 20 15 10 6 6 6 6 8 8 8 9 15 10 10 8 8 8 8 8 8 8 8 8 9 10 17 16 19 6 6 6 6 8 8 19 14 10 10 8 6 6 6 11 8 6 6 11 11 12 11 11 11 11 11 12 8 8 8 8 6 6 6 6 8 6 6 12 15 10 12 12 12	Open. Hide. 0 3 11 11 12 11 11 11 10 16 16 14 19 13 10 3 0 3 9 8 6 7 6 6 6 6 6 8 6 6 6 6 10 10 9 7 6 6 6 8 7 12 18 19 17 8 9 11 23 19 28 22 22 28 29 29 24 24 24 37 37 35 35 35 36 36 36 36 44 44 39 37 42 43 27 13 8 8 8 8 9 9 8 12 11 12 11 22 23 37 43 48 48 47 50 36 36 36 38 36 57 36 47 44 41 39 33 33 33 30 24 18 9 9 9 9 17 22 13 13 15 11 12 19 28 34 44 57 50 53 59 59 59 59 59 59 30 22 12 11 11 12 15 12 15 11 11 11 23 23 47 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 59 68 59 59 59 59 59 59 59 59 59 68 68 68 68 68 68 59 59 47 57 47 57 57 57 43 43 43 57 44 48 48 57 57 48 57 57 48 48 48 59 59 57 48 48 50 57 59 59 57 57 57 59 57 57 57 59 54 54 54 59 59 57 57 57 59 57 59 57 57 54 59 59 50 43 43 38 57 57 57 57 59 59 39 39 39 59 59 59 57 57 52 52 52 52 52 52 52 57 57 57 57 57 57 57 57 57 57 57 52 57 57 57 57 57 57 57 52 57 57 57 57 59 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 43 62 43 54 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 43 44 43 52 62 62 62 62 52 62 62 62 52 52 52 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 52 62 62 62 62 62 62 62 62 43 43 43 45 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 52 43 43 59 47 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 52 59 59 68 68 68 59 59 68 68 59 59 59 59 59 59 59 59 57 57 45 57 57 57 57 59 52 52 52 59 57 57 57 57 57 57 59 57 57 57 59 57 59 43 52 57 59 57 57 59 59 59 57 57 57 57 57 57 57 57 59 59 59 59 57 54 57 57 57 57 57 57 57 57 57 57 57 57 59 59 57 57 48 48 50 59 59 59 48 48 48 57 57 57 57 57 57 57 57 59 59 59 54 54 46 47 59 57 44 44 43 43 48 57 46 46 43 47 47 59 59 48 48 48 48 48 57 59 59 57 57 54 46 46 46 46 48 48 42 54 54 59 57 54 48 48 48 43 43 43 43 43 48 57 57 59 59 59 59 39 39 39 43 43 48 47 47 59 59 41 41 41 37 37 44 59 59 59 41 41 41 39 39 39 37 34 39 41 41 41 41 41 40 48 48 48 48 48 48 48 48 48 48 48 46 47 47 47 47 41 41 32 37 41 41 39 39 40 40 39 41 37 36 32 31 31 29 22 30 17 26 24 24 22 19 32 32 46 39 39 37 39 39 35 37 41 41 37 37 25 23 11 12 12 23 25 43 41 41 46 46 46 48 29 25 11 11 11 25 21 18 18 18 18 16 19 30 28 28 34 34 40 40 40 39 59 37 41 32 28 28 18 20 28 32 39 39 31 31 37 37 37 37 37 37 23 19 3 0 3 12 12 11 12 11 15 13 9 8 6 9 9 9 15 18 37 24 22 22 28 19 19 10 10 9 14 15 19 20 19 19 18 21 15 13 11 10 10 10 15 19 30 30 37 28 28 27 14 13 13 11 11 11 22 22 22 20 17 18 8 6 6 7 7 8 10 12 11 10 10 9 14 10 9 9 9 9 12 20 31 31 26 25 11 11 10 10 10 11 13 13 9 9 9 9 9 10 16 21 17 10 9 10 10 10 11 14 19 16 15 12 17 10 10 8 10 8 9 9 9 15 12 11 18 11 9 9 9 9 10 12 10 9 8 8 6 8 8 8 9 9 7 9 8 8 8 8 9 10 12 14 15 8 8 8 8 9 10 11 12 12 9 11 8 9 8 8 8 8 9 9 10 15 9 9 9 10 10 10 12 9 9 9 9 9 10 11 14 18 18 25 16 18 12 11 11 9 10 9 9 14 13 15 8 8 8 8 10 11 13 10 10 9 15 12 9 10 12 9 9 14 16 14 20 30 23 13 13 13 11 11 11 9 9 10 8 6 6 6 6 8 10 14 13 15 15 10 8 8 8 9 9 10 14 14 15 18 18 14 12 8 8 9 15 12 10 9 9 9 11 15 10 10 10 10 10 12 10 10 9 9 9 9 8 8 9 7 7 6 8 8 10 10 9 15 13 12 12 11 11 11 11 11 15 18 23 16 16 9 9 8 8 8 8 8 9 10 10 10 14 12 12 6 6 8 8 17 18 12 9 9 8 10 8 9 9 9 9 17 21 19 19 14 14 13 10 9 9 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no062_a13.b1 MSMg01no062_a13.b1 CHROMAT_FILE:
MSMg01no062_a13.b1 PHD_FILE: MSMg01no062_a13.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:05:12 2005
         (763 letters)



>mm_chrX_132278250_132279412
          Length = 1163

 Score = 1386 bits (717), Expect = 0.0
 Identities = 757/783 (96%), Gaps = 20/783 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcaagcatttattccgtaattactgtttcctacattatactcagtagtgccgccctcatg 60
           |||||||||||||||||||||||||||||||| ||||||||||||||||| |  ||||||
Sbjct: 181 gcaagcatttattccgtaattactgtttcctaaattatactcagtagtgctgttctcatg 240

                                                                       
Query: 61  tttgtggatttccattgatagacacatccggagggttgtataacttggctgttgtgaatg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 tttgtggatttccattgatagacacatccggagggttgtataacttggctgttgtgaatg 300

                                                                       
Query: 121 tttgtaaaataactgaatgtgaagctaggagataatgagaaggcaattgtccagattcga 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 tttgtaaaataactgaatgtgaagctaggagataatgagaaggcaattgtccagattcga 360

                                                                       
Query: 181 ggattagtgtgaagacagacaaggatcactgagactagaatgtcacatccttctgttttg 240
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 361 ggattagtgtgaagacagacaaggatcactgagactagaatgtcacacccttctgttttg 420

                                                                       
Query: 241 tcagtttct--------------------gtggattcacttaggagtcttggtctaactc 280
           |||||||||                    |||||||||||||||||||||||||||||||
Sbjct: 421 tcagtttctcgatgacctctagctggtctgtggattcacttaggagtcttggtctaactc 480

                                                                       
Query: 281 tagagatagatgcaggatgggaacatcttcctttaatcccctcttccctgtcctgctcta 340
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 481 tagagatagatgcaggatgggaacatcttcctttaatcccctctttcctgtcctgctcta 540

                                                                       
Query: 341 acacttcattatcaaccgatttttcaactaagggattaccgaaacagtcactcaagaaga 400
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541 acacttcattatcaaccgatttttcaactaagggattaccgaaacagtcactcaagaaga 600

                                                                       
Query: 401 caatggagggccccaagggaggaggaggaagaggaggaggaacagctttgaagctggtta 460
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 601 caatggagggccccaagggaggaggaggaagaggaggaggaacagctttgaagctggtta 660

                                                                       
Query: 461 atggaaggagaggaagaccaggaagggaaaagctagacaagcttctctgagaaggcaaga 520
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 661 atggaaggagaggaagaccaggaagggaaaagctagacaagcttctctgagaaggcaaga 720

                                                                       
Query: 521 ataagggccaggaaccaaggtctgtatcccaagagctgagtttctctgtcctctttatct 580
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 721 ataagggccaggaaccaaggtctgtatcccaagagctgagtttctctgtcctctttatct 780

                                                                       
Query: 581 atctataggtttgccagatctgctgcagggcttgtcgccagtggaaacagagaaaggagg 640
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 781 atctataggtttgccagatctgctgcagggcttgtcgccagtggaaacagagaaaggagg 840

                                                                       
Query: 641 aaacaatcccttggcaagagcgcaggttagtatgaacgtggggactcctcgagtaagacc 700
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 841 aaacaatcccttggcaagagcgcaggttagtatgaacgtggggactcctcgagtaagacc 900

                                                                       
Query: 701 tatagtatggaacagtaaagatttggttggctccagcctaggtcagcagatagcctcgga 760
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 901 tatagtatggaacagtaaagatttggttggctccagcctaggtcagcagatagcctcgga 960

              
Query: 761 att 763
           |||
Sbjct: 961 att 963


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 39
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 763
Length of database: 1163
Length adjustment: 10
Effective length of query: 753
Effective length of database: 1153
Effective search space:   868209
Effective search space used:   868209
X1: 9 (17.8 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 9 (18.3 bits)
S2: 9 (18.1 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information