MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-099F11
Chromosome	X (Build37)
Map Location	67,833,026 - 67,833,384
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Aff2, EG666577, 1700020N15Rik, Ids, 1110012L19Rik, 4930567H17Rik, LOC100040304, LOC628002, LOC628012, BC023829, EG547447, LOC666981, LOC100040409, LOC628053
Downstream gene	LOC100040432, EG280121, LOC666993, Ppia-psx_466.1, EG628080, G630014P10Rik, LOC667013, Mtm1, Mtmr1, Cd99l2, LOC667017, Hmgb3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aff2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14266 MGI:1202294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666577 MGI:3644930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1891 ESTs, 7 Proteins

name	1700020N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ids (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15931 MGI:96417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	1110012L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930567H17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC628002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins pseudo : _no_value

name	LOC628012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	BC023829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC666981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins pseudo : _no_value

name	LOC100040409 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC628053 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG280121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC666993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppia-psx_466.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606531
definition	note : peptidylprolyl isomerase A pseudogene x_466.1 pseudo : _no_value

name	EG628080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628080 MGI:3649029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	G630014P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333639 MGI:3045303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667013 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 217 ESTs, 11 Proteins pseudo : _no_value

name	Mtm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17772 MGI:1099452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53332 MGI:1858271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd99l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Hmgb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aff2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351744 GeneID:14266 MGI:1202294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AF4/FMR2 family, member 2 transcript_id : NM_008032.2

name	EG666577 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271677 GeneID:666577 MGI:3644930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1891 ESTs, 7 Proteins product : predicted gene, EG666577 transcript_id : XM_984280.2

name	1700020N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271679 GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700020N15 gene transcript_id : XM_001473869.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781803 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038990.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781805 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038991.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781811 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_010498.2

name	1110012L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803513 GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012L19 gene transcript_id : NM_026787.2

name	4930567H17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368528 GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930567H17 gene transcript_id : NM_001033807.2

name	LOC100040304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271675 GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to syndecan-1 transcript_id : XM_001474469.1

name	LOC628012 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271681 GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : hypothetical LOC628012 transcript_id : XM_001474528.1

name	BC023829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131123 GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023829 transcript_id : NM_001033328.2

name	EG547447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001530 GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG547447 transcript_id : XM_892770.1

name	LOC100040409 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271684 GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to syndecan-1 transcript_id : XM_001474636.1

name	LOC628053 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:125490330 GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC628053 transcript_id : NM_001081476.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001321 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG280121, transcript variant 3 transcript_id : XM_898689.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407488 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG280121, transcript variant 1 transcript_id : XM_207492.5

name	EG628080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407533 GeneID:628080 MGI:3649029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG628080 transcript_id : XM_900336.2

name	G630014P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486842 GeneID:333639 MGI:3045303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA G630014P10 gene transcript_id : NM_001081354.1

name	Mtm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802570 GeneID:17772 MGI:1099452
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked myotubular myopathy gene 1 transcript_id : NM_019926.2

name	Mtmr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57528446 GeneID:53332 MGI:1858271
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 1 transcript_id : NM_016985.2

name	Cd99l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129961 GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd99 antigen-like 2 transcript_id : NM_138309.2

name	Hmgb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892877 GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group box 3 transcript_id : NM_008253.3

name	Aff2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679819 CCDS:CCDS30173.1 GeneID:14266 MGI:1202294
definition	GO_process : GO:0007611 - learning and/or memory [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Ox19 homolog; fragile X mental retardation 2 homolog; fragile X mental retardation protein 2 homolog product : AF4/FMR2 family, member 2 protein_id : NP_032058.1

name	EG666577 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271678 GeneID:666577 MGI:3644930
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989374.2

name	1700020N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271680 GeneID:75509 MGI:1922759
definition	codon_start : 1 product : hypothetical protein LOC75509 protein_id : XP_001473919.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781812 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform a protein_id : NP_034628.2

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781804 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034079.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781806 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 3; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034080.1

name	1110012L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312070 CCDS:CCDS30174.1 GeneID:68618 MGI:1915868
definition	codon_start : 1 product : hypothetical protein LOC68618 protein_id : NP_081063.1

name	4930567H17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702147 GeneID:619303 MGI:3588249
definition	codon_start : 1 product : hypothetical protein LOC619303 protein_id : NP_001028979.1

name	LOC100040304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271676 GeneID:100040304
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474519.1

name	LOC628012 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271682 GeneID:628012
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474578.1

name	BC023829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701820 CCDS:CCDS30176.1 GeneID:236848 MGI:2448555
definition	codon_start : 1 note : ee3 product : cDNA sequence BC023829 protein_id : NP_001028500.1

name	EG547447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001531 GeneID:547447 MGI:3643766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897863.1

name	LOC100040409 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271685 GeneID:100040409
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474686.1

name	LOC628053 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:125490331 GeneID:628053
definition	codon_start : 1 product : hypothetical LOC628053 protein_id : NP_001074945.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001322 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 3 protein_id : XP_903782.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086394 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 1 protein_id : XP_207492.3

name	EG628080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407534 GeneID:628080 MGI:3649029
definition	codon_start : 1 product : hypothetical protein protein_id : XP_905429.2

name	G630014P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486843 GeneID:333639 MGI:3045303
definition	codon_start : 1 product : hypothetical protein LOC333639 protein_id : NP_001074823.1

name	Mtm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910456 CCDS:CCDS30177.1 GeneID:17772 MGI:1099452
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0046716 - muscle maintenance [Evidence IMP]; GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myotubularin protein_id : NP_064310.1

name	Mtmr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393794 CCDS:CCDS30178.1 GeneID:53332 MGI:1858271
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004438 - phosphatidylinositol-3-phosphatase activity [Evidence IDA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : myotubularin-related protein 1 protein_id : NP_058681.1

name	Cd99l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489963 CCDS:CCDS30179.1 GeneID:171486 MGI:2177151
definition	codon_start : 1 note : MIC2 like-1; MIC2 (monoclonal Imperial Cancer Research Fund 2)-like 1 product : Cd99 antigen-like 2 protein_id : NP_612182.1

name	Hmgb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680231 CCDS:CCDS30180.1 GeneID:15354 MGI:1098219
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006323 - DNA packaging [Evidence IEA]; GO:0045578 - negative regulation of B cell differentiation [Evidence IDA]; GO:0045638 - negative regulation of myeloid cell differentiation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : high-mobility group protein 4; high mobilty group protein 2A product : high mobility group box 3 protein_id : NP_032279.1

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 2 pseudo : _no_value

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 1 pseudo : _no_value

name	LOC666993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666993
definition	number : 1 pseudo : _no_value

name	LOC667017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667017
definition	number : 1 pseudo : _no_value

name	LOC628002 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271683 GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035666.1

name	LOC666981 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271686 GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035667.1

name	LOC667013 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271687 GeneID:667013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 217 ESTs, 11 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_031583.1

clone name	MSMg01-273H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-172L20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-099F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-099F11.T7 (MSMg01no099_f11.b1)	MSMg01-099F11.TJ (MSMg01no099_f11.g1)
ACC	AG315300	AG315301
length	717	757
length of high quality (start - end)	564 (44 - 607)	363 (75 - 437)
definition	CHROMAT_FILE: MSMg01no099_f11.b1 PHD_FILE: MSMg01no099_f11.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:56:46 2005	CHROMAT_FILE: MSMg01no099_f11.g1 PHD_FILE: MSMg01no099_f11.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:56:46 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	ATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAA TTCACTCTGTATACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCT GCTTCTCAAGTGCTGGAATTAAAGGCATGTGACACCACTGCCCAGCTGCA TCTGACTCTTCCAGCTGCATGTTGCGTTTTCTGGAAAGCAGTCATGCTAG GTCCCTTTTTGTGAGTGTTCCATAGCCTCATTAATAGTGTCAGGCCTCAG GACCTCCCCTTGAACTGGATCCCACTTTGGGCCTGTTGCTGGATCTTTTA TCCTCAGGCTCCTCTCCATTTCCACTCCTGTAATTCTTTCAGACAGGAAC AATTATGGGTTAGAGGTGTGACTGTGGGGTGGCAACCCCATCCTTCACTT GATGCCCTGTCCTCTCCCCTGCTGGAGGTGGGCTCTATAAGTTTGTTCTC TCTATTATTGGGCATTCCATCTAAGGTCCCTCCCTTTGATTCCTGAGAGT CTCTCACCTCCCAGGTCTCTGGTACATTCTGGAGTAACATCCCCCCCCCA CACACACACATCCTCCCACCTCCTGAGGTTGCCTGTTTCCATTCTTTCTG CTGGCCCTCATGTCTTCAGTCTTTTTCTCTCATTGAATACCAGATCAGGT TCCACCTTGCTAGAGGCTGCCTCTTAGGCCATTGAAAAAGCCCAGCTGGA ACGGTCTCCACTCAAGT	CGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXTTTCAGAGAGGAGGTGA ACTATAGAAGGATCCCAGAAATTCTCATTGCTGTCATTTTGCTGTGTTCT CCTCTCATAGCAGAAAGAATTAACTAGTTCTCTCTCCTGTTTCAGATAAG CTATTAAATCCCATTCATAAGAGCACTATCCTTGTAATTTCCCACAAAGA CTCCACCTCTTCTGACACCATTAGGAGCTGGGATTTCAAAATATAAATTT TGTGTGGGATGCAATCATTCAAATACTGTTCTAGAATTATTTTCTAACCC TTCAAATCTTTCTGAGTATATTTTTTTTGTTCTTTTCAACCTACAGGCAA AACAGTAGCCAGATGTTTGCTCACCTTCCCTTTGGTCAGGGAGTCTGACG ACTCACAGAACTGTAATTTGTAGCTAGAGTTAATATTGAGATTCGCCTTT GAGTCTTGTTTCCCATAGTTAAAGCTTTCTTAAAGACAGTTGCAATATTT GAATTCTATCATAAGTGTTTCCCTGAATCGCGATTGCTTTCGAATATATC TTTGCACGCCACCCGCTGTACTCCTTCTATCAGATGCCTCCCTGCTTTTC CCCTCCCTTTGATCTAATCTCTCACTCTACCTTCTCTTAAGTGTACTCCC GTCCCCCTTTATTCCTCCTCCCCCCCTCTTCTTTCTAGCTTTCTTCTCCA CTTTTTCTAACCTCCCTCGCCTACCTCTTTTTACTCACGTGTCTTCTCCC GTCTCCT
quality values	Open. Hide. 6 6 6 6 15 22 44 59 37 37 37 31 31 37 37 37 37 37 41 37 44 44 48 30 28 28 25 23 22 21 11 11 11 9 11 9 11 11 11 11 19 23 24 33 28 30 37 36 36 36 35 36 36 33 33 33 59 34 30 16 12 11 11 12 17 12 12 25 25 43 47 47 47 48 48 48 48 57 57 53 47 47 47 47 47 47 47 53 53 53 53 53 47 57 57 57 57 57 68 68 68 68 68 68 50 50 50 50 50 50 59 59 59 59 59 47 47 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 57 57 68 68 68 68 68 68 57 57 57 57 59 59 59 59 57 57 57 59 59 57 57 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 68 68 59 57 57 57 57 57 57 57 62 62 62 62 62 68 68 68 62 62 62 52 52 62 62 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 44 43 39 39 47 59 62 62 62 68 62 62 62 52 52 43 43 35 29 23 29 23 39 44 39 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 43 35 35 35 43 44 31 31 31 43 43 43 43 35 35 43 59 59 43 43 41 43 43 43 62 43 52 52 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 57 57 59 59 59 59 57 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 43 38 28 17 17 23 36 44 57 52 43 43 44 43 57 43 43 43 43 52 57 59 59 59 59 54 54 54 57 57 57 57 52 43 44 32 43 43 52 57 37 37 37 57 44 57 43 52 43 52 52 57 59 59 68 59 59 57 54 50 57 48 48 47 50 44 32 32 14 14 14 24 24 39 39 44 48 47 47 47 41 41 41 36 36 20 18 19 21 40 42 68 57 38 36 26 26 30 32 37 43 30 30 17 17 8 10 8 8 12 19 28 42 46 48 54 54 57 47 47 39 37 30 40 25 28 28 28 28 28 29 25 25 25 36 34 48 59 59 48 48 46 41 41 37 37 34 30 24 18 19 17 10 13 12 17 16 19 30 30 30 32 39 36 36 43 47 48 40 37 37 37 37 37 25 17 11 11 11 21 21 26 11 12 10 12 12 19 19 16 19 19 21 19 28 24 39 37 39 32 32 37 37 37 28 28 30 26 24 16 11 11 17 18 11 10 10 12 14 10 8 6 8 10 7 9 10 11 15 11 14 12 10 13 12 12 16 11 11 10 10 10 10 12 15 19 13 12 9 9 12 8 8 6 6 10 10 11 11 10 10 10 11 11 11 18 15 15 13 10 10 12 10 10 15 10 9 9 9 13 12 10 15 10 10 10 11 10 12 10	Open. Hide. 8 8 8 8 8 8 10 8 8 15 21 37 41 41 41 41 41 47 42 50 50 53 53 48 48 42 50 47 47 25 23 9 9 7 8 8 8 6 6 9 9 7 8 10 10 10 21 23 11 11 10 23 26 42 42 42 30 25 18 12 9 9 9 8 8 7 7 7 10 13 9 10 10 13 19 21 33 24 33 59 59 48 48 48 50 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 68 68 68 51 51 42 42 42 42 42 36 36 36 43 59 68 50 50 50 50 50 27 41 17 23 23 14 21 41 44 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 50 57 57 57 57 68 57 57 57 57 54 57 54 57 57 57 57 68 68 68 68 68 68 68 68 59 59 27 21 10 10 11 23 23 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 57 57 52 57 57 52 57 57 57 59 57 57 57 57 52 52 59 57 57 57 57 57 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 62 62 44 44 28 26 14 14 18 38 43 62 62 62 62 62 62 43 43 35 35 35 43 62 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 57 57 57 52 57 57 57 59 59 59 59 59 59 57 57 57 52 43 57 43 43 57 28 28 12 12 13 24 24 12 12 28 28 57 52 43 43 28 28 28 43 44 57 52 43 43 43 57 50 57 57 59 44 44 33 32 24 17 17 17 18 28 19 30 28 27 31 41 38 41 25 25 23 32 32 32 32 35 35 44 33 29 23 27 24 30 34 50 34 32 29 29 29 31 27 27 27 32 36 42 42 46 57 48 48 48 48 48 48 48 48 43 32 28 15 13 11 11 11 11 21 18 18 13 18 18 28 31 32 37 36 28 22 12 12 12 12 15 15 11 10 11 13 21 17 19 17 25 25 28 32 21 24 13 13 21 21 21 25 15 15 15 13 8 8 10 10 10 15 15 11 8 8 8 10 12 17 22 16 15 15 13 13 14 15 10 15 10 11 11 11 15 24 12 12 8 13 8 8 8 8 8 8 8 8 8 12 13 19 17 8 8 8 8 8 8 9 8 8 8 9 10 9 10 16 15 10 8 6 6 8 6 8 8 8 12 11 11 8 8 8 10 8 6 6 6 6 6 8 8 8 8 12 13 8 8 8 8 8 9 9 10 12 13 10 10 8 12 14 10 8 8 8 10 11 9 9 9 9 9 10 10 8 8 6 6 8 8 11 10 10 10 15 12 10 10 11 13 10 10 10 12 9 14 11 11 9 9 10 10 10 9 9 9 9 10 10 8 8 8 8 13 11 12 10 10 9 12 8 7 9 10 10 10 10 10 15 15 21 19 8 10 6 6 8 8 8 8 9 8 8 7 7 10 12 8 8 8 10 10 8 10 10 10 10 11 11 9 10 10 10 13 11 16 14 10 10 10 10 10 15 13 13 8 8 8 11 8 8 8 8 8 8 8 8 8 8 9 9 12 14 12 10 11 10 9 9 10 9 9 10 11 11 12 9 9 11 8 8 8 6 8 6 7 10 10 8 8 8 8 10 13 9 9 9 9 9 11 12 11 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no099_f11.g1 MSMg01no099_f11.g1 CHROMAT_FILE:
MSMg01no099_f11.g1 PHD_FILE: MSMg01no099_f11.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:56:46 2005
         (363 letters)



>mm_chrX_67832826_67833588
          Length = 763

 Score =  656 bits (339), Expect = 0.0
 Identities = 354/359 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcattgctgtcattttgctgtgttctcctctcatagcagaaagaattaactagttctctc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tcattgctgtcattttgctgtgttctcctctcatagcagaaagaattaactagttctctc 260

                                                                       
Query: 61  tcctgtttcagataagctattaaatcccattcataagagcactatccttgtaatttccca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tcctgtttcagataagctattaaatcccattcataagagcactatccttgtaatttccca 320

                                                                       
Query: 121 caaagactccacctcttctgacaccattaggagctgggatttcaaaatataaattttgtg 180
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cagagactccacctcttctgacaccattaggagctgggatttcaaaatataaattttgtg 380

                                                                       
Query: 181 tgggatgcaatcattcaaatactgttctagaattattttctaacccttcaaatctttctg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tgggatgcaatcattcaaatactgttctagaattattttctaacccttcaaatctttctg 440

                                                                       
Query: 241 agtatattttttttgttcttttcaacctacaggcaaaacagtagccagatgtttgctcac 300
           ||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 agtatattttggatgttcttttcaacctacaggcaaaacagtagccagatgtttgctcac 500

                                                                      
Query: 301 cttccctttggtcagggagtctgacgactcacagaactgtaatttgtagctagagttaa 359
           ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 501 cttccctttggtcagggagtctgacgactcacagaactgtaatttgtagttagagttaa 559


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 363
Length of database: 763
Length adjustment: 9
Effective length of query: 354
Effective length of database: 754
Effective search space:   266916
Effective search space used:   266916
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information