MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-124J21
Chromosome	X (Build37)
Map Location	72,244,704 - 72,245,369
singlet/doublet	singlet
Overlap gene	Gab3
Upstream gene	LOC667264, Irak1, Mecp2, Opn1mw, LOC627455, Gm1538, LOC628388, Tktl1, Flna, Emd, LOC100041344, Rpl10, Snora70, Dnase1l1, Taz, B230340J04Rik, Atp6ap1, Gdi1, D0HXS9928E, Plxna3, Lage3, Ubl4, Slc10a3, 1810037C20Rik, G6pdx, Ikbkg, EG628456, LOC628465, LOC100041484, LOC674920, EG245472, Olfr1326-ps1, Olfr1325, EG434797, LOC385383, EG667379, LOC667382, LOC546321, LOC667387, EG628518, Olfr1327-ps1, LOC628637, LOC667413, LOC100041594, LOC627775, EG546325, LOC100041017, EG628573, LOC100041642, LOC667437, EG667446, LOC669291
Downstream gene	Dkc1, Mpp1, EG547412, 4930428E23Rik, EG667190, F8, LOC572559, LOC667218, Fundc2, Mtcp1, Brcc3, LOC667496, Vbp1, Rab39b, EG635243, Pls3, LOC635275, EG635295, LOC667537
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 7 Proteins pseudo : _no_value

name	Irak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16179 MGI:107420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mecp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17257 MGI:99918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Opn1mw (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14539 MGI:1097692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627455 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 7 Proteins pseudo : _no_value

name	Gm1538 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385380 MGI:2686384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC628388 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628388
definition	note : 60S ribosomal protein L3 pseudogene pseudo : _no_value

name	Tktl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83553 MGI:1933244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192176 MGI:95556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13726 MGI:108117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 333 ESTs, 6 Proteins pseudo : _no_value

name	Rpl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110954 MGI:105943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snora70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104368 MGI:2148178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69537 MGI:109628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66826 MGI:109626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230340J04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320703 MGI:2444570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6ap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54411 MGI:109629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14567 MGI:99846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D0HXS9928E (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108160 MGI:1351626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plxna3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18846 MGI:107683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lage3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66192 MGI:1913442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27643 MGI:95049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc10a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214601 MGI:95048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810037C20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66294 MGI:1913544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	G6pdx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14381 MGI:105979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikbkg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16151 MGI:1338074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG628456 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628456 MGI:3644285
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC628465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 11 Proteins

name	LOC674920 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG245472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245472 MGI:3643860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Olfr1326-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236866 MGI:3031160
definition	gene_synonym : GA_x6K02T2QD78-226493-227257; MOR267-19 note : olfactory receptor 1326, pseudogene 1 pseudo : _no_value

name	Olfr1325 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258393 MGI:3031159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434797 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434797 MGI:3645126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 10 Proteins

name	LOC385383 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein pseudo : _no_value

name	EG667379 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667379 MGI:3704139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins

name	LOC667382 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	LOC546321 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 208 ESTs, 3 Proteins

name	LOC667387 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 4 Proteins

name	EG628518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628518 MGI:3645826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Olfr1327-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404499 MGI:3031161
definition	note : olfactory receptor 1327, pseudogene 1 pseudo : _no_value

name	LOC628637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	LOC667413 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041594 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 28 Proteins

name	LOC627775 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein pseudo : _no_value

name	EG546325 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546325 MGI:3645575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG628573 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628573 MGI:3645236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100041642 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 28 Proteins

name	LOC667437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	EG667446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667446 MGI:3645523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins pseudo : _no_value

name	LOC669291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Gab3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210710 MGI:2387324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dkc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245474 MGI:1861727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17524 MGI:105941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547412 MGI:3646428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 3 Proteins

name	4930428E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434800 MGI:3588243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG667190 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667190 MGI:3646324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 244 ESTs, 10 Proteins pseudo : _no_value

name	F8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14069 MGI:88383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC572559 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:572559
definition	note : protein phosphatase 4, regulatory subunit 2 pseudogene pseudo : _no_value

name	LOC667218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	Fundc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67391 MGI:1914641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtcp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17763 MGI:102699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Brcc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210766 MGI:2389572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 3 Proteins pseudo : _no_value

name	Vbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22327 MGI:1333804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab39b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67790 MGI:1915040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG635243 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635243 MGI:3644674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Pls3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102866 MGI:104807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC635275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG635295 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635295 MGI:3646473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC667537 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Irak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606336 GeneID:16179 MGI:107420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin-1 receptor-associated kinase 1 transcript_id : NM_008363.2

name	Mecp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517468 GeneID:17257 MGI:99918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyl CpG binding protein 2 transcript_id : NM_001081979.1

name	Mecp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517481 GeneID:17257 MGI:99918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyl CpG binding protein 2 transcript_id : NM_010788.3

name	Opn1mw (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299640 GeneID:14539 MGI:1097692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) transcript_id : NM_008106.2

name	Gm1538 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086417 GeneID:385380 MGI:2686384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : gene model 1538, (NCBI) transcript_id : XM_358216.1

name	Tktl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347420 GeneID:83553 MGI:1933244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transketolase-like 1 transcript_id : NM_031379.2

name	Flna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347375 GeneID:192176 MGI:95556
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : filamin, alpha transcript_id : NM_010227.2

name	Emd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131088 GeneID:13726 MGI:108117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : emerin transcript_id : NM_007927.2

name	Rpl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372532 GeneID:110954 MGI:105943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein 10 transcript_id : NM_052835.2

name	Dnase1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312311 GeneID:69537 MGI:109628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease 1-like 1 transcript_id : NM_027109.1

name	Taz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802002 GeneID:66826 MGI:109626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tafazzin transcript_id : NM_181516.3

name	B230340J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343133 GeneID:320703 MGI:2444570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230340J04 gene transcript_id : NM_177234.2

name	Atp6ap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378425 GeneID:54411 MGI:109629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal accessory protein 1 transcript_id : NM_018794.3

name	Gdi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803051 GeneID:14567 MGI:99846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanosine diphosphate (GDP) dissociation inhibitor 1 transcript_id : NM_010273.2

name	D0HXS9928E (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801249 GeneID:108160 MGI:1351626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, human DXS9928E transcript_id : NM_138607.2

name	Plxna3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286838 GeneID:18846 MGI:107683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin A3 transcript_id : NM_008883.2

name	Lage3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349821 GeneID:66192 MGI:1913442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : L antigen family, member 3 transcript_id : NM_025410.2

name	Ubl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703809 GeneID:27643 MGI:95049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 4 transcript_id : NM_145405.1

name	Slc10a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703811 GeneID:214601 MGI:95048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 10 (sodium/bile acid cotransporter family), member 3 transcript_id : NM_145406.1

name	1810037C20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976070 GeneID:66294 MGI:1913544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810037C20 gene transcript_id : NM_025473.2

name	G6pdx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50053914 GeneID:14381 MGI:105979
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose-6-phosphate dehydrogenase X-linked transcript_id : NM_008062.2

name	Ikbkg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351396 GeneID:16151 MGI:1338074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of kappaB kinase gamma transcript_id : NM_178590.3

name	Ikbkg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754315 GeneID:16151 MGI:1338074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of kappaB kinase gamma transcript_id : NM_010547.1

name	EG628456 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271696 GeneID:628456 MGI:3644285
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG628456 transcript_id : XM_893204.3

name	LOC100041484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271726 GeneID:100041484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 11 Proteins product : similar to UBE2D3 transcript_id : XM_001476705.1

name	EG245472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271698 GeneID:245472 MGI:3643860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : predicted gene, EG245472 transcript_id : XM_141845.6

name	Olfr1325 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239363 GeneID:258393 MGI:3031159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1325 transcript_id : NM_146398.1

name	EG434797 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271728 GeneID:434797 MGI:3645126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 9 Proteins product : predicted gene, EG434797, transcript variant 1 transcript_id : XM_486708.5

name	EG667379 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271731 GeneID:667379 MGI:3704139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : predicted gene, EG667379 transcript_id : XM_990209.2

name	LOC546321 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271699 GeneID:546321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 208 ESTs, 3 Proteins product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) transcript_id : XM_001475536.1

name	LOC667387 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271735 GeneID:667387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 4 Proteins product : similar to X-linked lymphocyte-regulated 4A transcript_id : XM_001487797.1

name	EG628518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271701 GeneID:628518 MGI:3645826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG628518 transcript_id : XM_893271.3

name	LOC628637 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271703 GeneID:628637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : similar to RIKEN cDNA 1700030B21 gene transcript_id : XM_893398.2

name	LOC100041594 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271740 GeneID:100041594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001476843.1

name	LOC100041594 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271742 GeneID:100041594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001476854.1

name	EG546325 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157512 GeneID:546325 MGI:3645575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546325 transcript_id : NM_001081670.1

name	EG628573 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271747 GeneID:628573 MGI:3645236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG628573 transcript_id : XM_893332.2

name	LOC100041642 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271750 GeneID:100041642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001476944.1

name	LOC100041642 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271748 GeneID:100041642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001476927.1

name	LOC669291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271705 GeneID:669291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RIKEN cDNA 1700030B21 gene transcript_id : XM_001475692.1

name	Gab3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356007 GeneID:210710 MGI:2387324
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor receptor bound protein 2-associated protein 3 transcript_id : NM_153073.2

name	Gab3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345510 GeneID:210710 MGI:2387324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor receptor bound protein 2-associated protein 3 transcript_id : NM_181584.3

name	Dkc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064866 GeneID:245474 MGI:1861727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dyskeratosis congenita 1, dyskerin homolog (human) transcript_id : NM_001030307.1

name	Mpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982179 GeneID:17524 MGI:105941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated transcript_id : NM_008621.2

name	EG547412 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271754 GeneID:547412 MGI:3646428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 3 Proteins product : predicted gene, EG547412 transcript_id : XM_486711.4

name	F8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679732 GeneID:14069 MGI:88383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor VIII transcript_id : NM_007977.1

name	Fundc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366263 GeneID:67391 MGI:1914641
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUN14 domain containing 2 transcript_id : NM_026126.3

name	Mtcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343581 GeneID:17763 MGI:102699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mature T-cell proliferation 1 transcript_id : NM_010839.5

name	Mtcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372643 GeneID:17763 MGI:102699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mature T-cell proliferation 1 transcript_id : NM_001039373.2

name	Brcc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542276 GeneID:210766 MGI:2389572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BRCA1/BRCA2-containing complex, subunit 3 transcript_id : NM_145956.2

name	Vbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248571 GeneID:22327 MGI:1333804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : von Hippel-Lindau binding protein 1 transcript_id : NM_011692.2

name	Rab39b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360120 GeneID:67790 MGI:1915040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB39B, member RAS oncogene family transcript_id : NM_175122.3

name	Pls3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704119 GeneID:102866 MGI:104807
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plastin 3 (T-isoform) transcript_id : NM_145629.1

name	Irak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606337 CCDS:CCDS30219.1 GeneID:16179 MGI:107420
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IPI]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : pelle-like product : interleukin-1 receptor-associated kinase 1 protein_id : NP_032389.2

name	Mecp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517469 GeneID:17257 MGI:99918
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008327 - methyl-CpG binding [Evidence IDA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0035197 - siRNA binding [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0016358 - dendrite development [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence TAS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0042551 - neuron maturation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0050884 - regulation of posture [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : methyl CpG binding protein 2 isoform 1 protein_id : NP_001075448.1

name	Mecp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149645 GeneID:17257 MGI:99918
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008327 - methyl-CpG binding [Evidence IDA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0035197 - siRNA binding [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0016358 - dendrite development [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence TAS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0042551 - neuron maturation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0050884 - regulation of posture [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : methyl CpG binding protein 2 isoform 2 protein_id : NP_034918.1

name	Opn1mw (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679975 CCDS:CCDS30220.1 GeneID:14539 MGI:1097692
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0001750 - photoreceptor outer segment [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007602 - phototransduction [Evidence IEA]; GO:0018298 - protein-chromophore linkage [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : green cone pigment; green LWS cone opsin; green LWS photopigment; green long wavelength sensitive cone opsin; M opsin; MWS opsin; Green opsin; Midwavelength sensitive opsin; opsin 1, medium-wave-sensitive product : opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) protein_id : NP_032132.1

name	Gm1538 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086418 GeneID:385380 MGI:2686384
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358216.1

name	Tktl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347421 CCDS:CCDS30221.1 GeneID:83553 MGI:1933244
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : transketolase-like 1 protein_id : NP_113556.2

name	Flna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347376 GeneID:192176 MGI:95556
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence TAS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0005080 - protein kinase C binding [Evidence IDA] GO_process : GO:0045022 - early endosome to late endosome transport [Evidence IDA] codon_start : 1 note : filamin A; actin-binding protein 280; GENA 379; dilated pupils 2 product : filamin, alpha protein_id : NP_034357.2

name	Emd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679641 CCDS:CCDS30222.1 GeneID:13726 MGI:108117
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IEA]; GO:0005637 - nuclear inner membrane [Evidence TAS]; GO:0005652 - nuclear lamina [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : emerin protein_id : NP_031953.1

name	Rpl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16418339 GeneID:110954 MGI:105943
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 note : 24.6 kDa protein; 24.6kDa protein product : ribosomal protein 10 protein_id : NP_443067.1

name	Dnase1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312312 CCDS:CCDS30223.1 GeneID:69537 MGI:109628
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004536 - deoxyribonuclease activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006308 - DNA catabolism [Evidence IEA] codon_start : 1 note : DNase X product : deoxyribonuclease 1-like 1 protein_id : NP_081385.1

name	Taz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31442416 CCDS:CCDS30224.1 GeneID:66826 MGI:109626
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0046471 - phosphatidylglycerol metabolism [Evidence ISS] codon_start : 1 product : tafazzin protein_id : NP_852657.1

name	B230340J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893279 GeneID:320703 MGI:2444570
definition	codon_start : 1 product : hypothetical protein LOC320703 protein_id : NP_796208.1

name	Atp6ap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055172 CCDS:CCDS30226.1 GeneID:54411 MGI:109629
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1; ATPase, H+ transporting, lysosomal interacting protein 1; V-ATPase subunit Ac45; vacuolar H+ ATPase accessory subunit 1 product : ATPase, H+ transporting, lysosomal accessory protein 1 protein_id : NP_061264.1

name	Gdi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859560 CCDS:CCDS30227.1 GeneID:14567 MGI:99846
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : Rab GDIalpha product : guanosine diphosphate (GDP) dissociation inhibitor 1 protein_id : NP_034403.1

name	D0HXS9928E (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070432 GeneID:108160 MGI:1351626
definition	codon_start : 1 exception : mismatches in translation product : DNA segment, human DXS9928E protein_id : NP_613073.1

name	Plxna3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286839 CCDS:CCDS30228.1 GeneID:18846 MGI:107683
definition	codon_start : 1 note : plexin 3 product : plexin A3 protein_id : NP_032909.2

name	Lage3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384798 CCDS:CCDS30229.1 GeneID:66192 MGI:1913442
definition	codon_start : 1 product : Eso3 protein protein_id : NP_079686.1

name	Ubl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703810 CCDS:CCDS30230.1 GeneID:27643 MGI:95049
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : ubiquitin-like protein GDX; housekeeping protein DXS254E product : ubiquitin-like 4 protein_id : NP_663380.1

name	Slc10a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703812 CCDS:CCDS30231.1 GeneID:214601 MGI:95048
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008508 - bile acid:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 10, member 3 product : protein P3 protein_id : NP_663381.1

name	1810037C20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313538 GeneID:66294 MGI:1913544
definition	codon_start : 1 product : family 3, member A protein protein_id : NP_079749.1

name	G6pdx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996917 CCDS:CCDS30232.1 GeneID:14381 MGI:105979
definition	GO_function : GO:0004345 - glucose-6-phosphate 1-dehydrogenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006006 - glucose metabolism [Evidence IEA]; GO:0006749 - glutathione metabolism [Evidence IMP] codon_start : 1 product : glucose-6-phosphate dehydrogenase X-linked protein_id : NP_032088.1

name	Ikbkg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754316 GeneID:16151 MGI:1338074
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence IDA]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma product : inhibitor of kappaB kinase gamma isoform 1 protein_id : NP_034677.1

name	Ikbkg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519887 CCDS:CCDS30233.1 GeneID:16151 MGI:1338074
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence IDA]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma product : inhibitor of kappaB kinase gamma isoform 2 protein_id : NP_848705.1

name	EG628456 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271697 GeneID:628456 MGI:3644285
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898297.3

name	LOC100041484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271727 GeneID:100041484
definition	codon_start : 1 product : similar to UBE2D3 protein_id : XP_001476755.1

name	EG245472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001598 GeneID:245472 MGI:3643860
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141845.4

name	Olfr1325 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239364 CCDS:CCDS30234.1 GeneID:258393 MGI:3031159
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD78-203513-202575; olfactory receptor MOR102-1 product : olfactory receptor 1325 protein_id : NP_666510.1

name	EG434797 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271729 GeneID:434797 MGI:3645126
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_486708.3

name	EG667379 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271732 GeneID:667379 MGI:3704139
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995303.2

name	LOC546321 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271700 GeneID:546321
definition	codon_start : 1 product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) protein_id : XP_001475586.1

name	LOC667387 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271736 GeneID:667387
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487847.1

name	EG628518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271702 GeneID:628518 MGI:3645826
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898364.3

name	LOC628637 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271704 GeneID:628637
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898491.2

name	LOC100041594 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271741 GeneID:100041594
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476893.1

name	LOC100041594 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271743 GeneID:100041594
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476904.1

name	EG546325 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157513 GeneID:546325 MGI:3645575
definition	codon_start : 1 product : hypothetical protein LOC546325 protein_id : NP_001075139.1

name	EG628573 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001620 GeneID:628573 MGI:3645236
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898425.1

name	LOC100041642 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271749 GeneID:100041642
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476977.1

name	LOC100041642 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271751 GeneID:100041642
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476994.1

name	LOC669291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271706 GeneID:669291
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475742.1

name	Gab3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346479 CCDS:CCDS30235.1 GeneID:210710 MGI:2387324
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030225 - macrophage differentiation [Evidence IDA] codon_start : 1 exception : mismatches in translation function : differentiation signaling product : growth factor receptor bound protein 2-associated protein 3 protein_id : NP_694713.1

name	Gab3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712032 CCDS:CCDS30235.1 GeneID:210710 MGI:2387324
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030225 - macrophage differentiation [Evidence IDA] codon_start : 1 product : growth factor receptor bound protein 2-associated protein 3 protein_id : NP_853615.1

name	Dkc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064867 GeneID:245474 MGI:1861727
definition	GO_function : GO:0004730 - pseudouridylate synthase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : dyskerin protein_id : NP_001025478.1

name	Mpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678924 CCDS:CCDS30236.1 GeneID:17524 MGI:105941
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : membrane protein, palmitoylated (55 kDa) product : membrane protein, palmitoylated protein_id : NP_032647.1

name	EG547412 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001635 GeneID:547412 MGI:3646428
definition	codon_start : 1 product : similar to MGC12966 protein protein_id : XP_486711.2

name	F8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679733 CCDS:CCDS30238.1 GeneID:14069 MGI:88383
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0007596 - blood coagulation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Factor VIII product : coagulation factor VIII protein_id : NP_032003.1

name	Fundc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541957 CCDS:CCDS30239.1 GeneID:67391 MGI:1914641
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : FUN14 domain containing 2 protein_id : NP_080402.2

name	Mtcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754760 GeneID:17763 MGI:102699
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : mature T-cell proliferation 1 isoform b protein_id : NP_034969.1

name	Mtcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439951 CCDS:CCDS30241.1 GeneID:17763 MGI:102699
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : mature T-cell proliferation 1 isoform a protein_id : NP_001034462.1

name	Brcc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165366 GeneID:210766 MGI:2389572
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0030234 - enzyme regulator activity [Evidence ISS] GO_process : GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0010165 - response to X-ray [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : 6.1A protein product : c6.1a protein protein_id : NP_666068.1

name	Vbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248572 GeneID:22327 MGI:1333804
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] codon_start : 1 product : von Hippel-Lindau binding protein 1 protein_id : NP_035822.2

name	Rab39b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424726 CCDS:CCDS30242.1 GeneID:67790 MGI:1915040
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB39B, member RAS oncogene family protein_id : NP_780331.1

name	Pls3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704120 CCDS:CCDS30243.1 GeneID:102866 MGI:104807
definition	codon_start : 1 note : T-plastin; plastin 3, T product : plastin 3 precursor protein_id : NP_663604.1

name	LOC628465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628465
definition	number : 1 pseudo : _no_value

name	LOC628465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628465
definition	number : 2 pseudo : _no_value

name	LOC628465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628465
definition	number : 3 pseudo : _no_value

name	LOC674920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674920
definition	number : 1 pseudo : _no_value

name	LOC674920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674920
definition	number : 2 pseudo : _no_value

name	LOC674920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674920
definition	number : 3 pseudo : _no_value

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 4 pseudo : _no_value

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 3 pseudo : _no_value

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 2 pseudo : _no_value

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 1 pseudo : _no_value

name	EG635243 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635243
definition	number : 1 pseudo : _no_value

name	LOC635275 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635275
definition	number : 1 pseudo : _no_value

name	LOC635275 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635275
definition	number : 2 pseudo : _no_value

name	EG635295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635295
definition	number : 1 pseudo : _no_value

name	LOC667537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667537
definition	number : 1 pseudo : _no_value

name	LOC667264 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271692 GeneID:667264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 7 Proteins product : similar to Mapre1 protein pseudo : _no_value transcript_id : XR_032127.1

name	LOC627455 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271712 GeneID:627455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 7 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_032643.1

name	LOC100041344 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271716 GeneID:100041344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 333 ESTs, 6 Proteins product : similar to suppressor of initiator codon mutations, related sequence 1 pseudo : _no_value transcript_id : XR_032790.1

name	Snora70 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604685 GeneID:104368 MGI:2148178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 70 transcript_id : NR_002899.1

name	LOC385383 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271730 GeneID:385383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : similar to X-linked lymphocyte-regulated 5D pseudo : _no_value transcript_id : XR_032906.1

name	LOC667382 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271733 GeneID:667382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to xlr3a gene product pseudo : _no_value transcript_id : XR_032920.1

name	LOC667413 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271739 GeneID:667413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins product : hypothetical LOC667413 pseudo : _no_value transcript_id : XR_032929.1

name	LOC627775 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271744 GeneID:627775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : similar to X-linked lymphocyte-regulated 5D pseudo : _no_value transcript_id : XR_032949.1

name	LOC667437 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271752 GeneID:667437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to xlr3a gene product pseudo : _no_value transcript_id : XR_032994.1

name	EG667446 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271753 GeneID:667446 MGI:3645523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins product : predicted gene, EG667446 pseudo : _no_value transcript_id : XR_035679.1

name	4930428E23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271759 GeneID:434800 MGI:3588243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930428E23 gene transcript_id : XR_035328.1

name	EG667190 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407543 GeneID:667190 MGI:3646324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 244 ESTs, 10 Proteins product : predicted gene, EG667190 pseudo : _no_value transcript_id : XR_002058.1

name	LOC667218 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271762 GeneID:667218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to D19Bwg1357e protein pseudo : _no_value transcript_id : XR_033077.1

name	LOC667496 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271764 GeneID:667496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 3 Proteins product : similar to high mobility group nucleosomal binding domain 1 pseudo : _no_value transcript_id : XR_033121.1

clone name	MSMg01-404L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405E22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317M05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-124J21.T7 (MSMg01no124_j21.b1)	MSMg01-124J21.TJ (MSMg01no124_j21.g1)
ACC	AG333924	AG333925
length	1,252	1,229
length of high quality (start - end)	662 (120 - 781)	90 (497 - 586)
definition	CHROMAT_FILE: MSMg01no124_j21.b1 PHD_FILE: MSMg01no124_j21.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:35:57 2005	CHROMAT_FILE: MSMg01no124_j21.g1 PHD_FILE: MSMg01no124_j21.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:35:57 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NTTAATCACTGCGCGCTATAGACTCCTAAGGGAGAGGATCCGCGGAATTC ACTGGTATAAGGAGCCCATTACAATCCCAAAGAAAACCAACTTCAAGGTT GCTGAGCCCCTGATTAGCACATAAAGCACTTTGCACTCAAACATTAGGGT CTGAGTTCAGATCTCCAGAACCCAAATAAAAGCTAGGCATGTTTACATAT ATCTGTAATTCAGATACTTGCTGGGGAGGAGAAGGTAGATGAATCCCTGA AAGTCTCTAGCCAGGCAGCCTAGCCAATCCTAAAATTTACTTAAATAAAG AGACAGAGAGACAGAAAGACAAGGTGAATTGAGGTAGTGGAATACTTCTG ATGTCAACCCTTGGCCCTCACATACATGTGCATACACATATGCACATGCT CTAATATGTACACGTACTTACTTATAAAACACACATGCACACACAACATA CATGCATATACTTAAAATACACATTAAAAAAGAAAACGAAAGGAGGAAAT TAGTTTCAAATTGATTTTCTCCCAATCAAAAAACAAACAAACAAACAAAA AACCCGGTGACCTGGTTTTATAATAAGCCATTCTTTATGACTGCACACAG ACTTTTGAGAAAAGTGCATTCATCATAATGAACTCTCAAGATTATAAATT TAGAGAAACAACACACACACACATACACACACACTAACACACAAAAAAAA ACCCACAGGGTTACCATTTGGATGTACTTTTCTTCTTCTTCTTCTTCTTC TTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCTCCTCTTCTT CTTCTTCAGAAGGAGTGGAAAAAAGCCTTGCACAATTAATACCATTTCTT TGTGCAAAGAGAAAACTGGTTCGATTGCTAATATAAGGATTACCGATGAA GTCCATGCCATGTCCTTAAAGCTGCCTTTGAAACGCCCAAAATCAAACAG CCCTGTGGGGGTTTGAAGCCTGTTCCTTCCAAAAACAATTTCCCTTTTGG CCCAAGCAATTTCTTTGAAGACACTTCCCCTTATACCCGGTCCTACTCCG GAAACAAAAGGCTCCCAATTTGCGGGTTCCTAACCCCCCTCCTGTCAAAA CAAAAAAAATGGCCTTTTATTATTCAACTTAACACCAATTTTCAATAATG TGCCCCCAAGCTCATAAAGGGTACTGTGCCGGGATTAAATAAAAAATCTT CCTTGCTCAATCTTATTTCTTCCCACCAACTTCACTAAACCCCTCCTCTT CT	GGGGGACCGAGTGGGGCTGGGGCGCCGGXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXCCCATGAGATCCCCCNGANNNNNGANNNNNNNNNNNNN GNCCATAAAAACCCCCCGNNGNGNNNANNNGAGNNNNNNNAGANNNGGGN NGGANAAGAAANNNNNNAGNAGGGGGCCCCAGCGGGCAACAGAGCAGAAA CANNNNCCCAGCNAAGAGGGGGAAGGGCAGGCCNNNNAAACAAGAGGAAA GGAGGGGGGNGANNNCNGAAACCCAGGNCACCCAACNNNAGGAAGAACAA GGGGAANCCAAANANNNNAACAAAACCAGGGGNCGGCGGAGGGAGNAAGG CAGAGAAANNCAGGGNCAANAGCNCACCANNNAGCAGGCCATTTTTTTTT GAAAANCNCNCNGGGAGNNGNANGANNNCAGGAAAAAGCCCGCCCTATTT ATTGACCCCCAAGNACNAGCANANGGANTGAAAAAAAAAGAGGGGACTTT CCCCCTTTAATGTGCTGTTTACTAAATTATCTCAATCAGTCGAAGCAAAG TAAATTTCTACTCACGGCAACATCATCTTCTTGAAATGGCTTCCGGACTT TTTTCTTCTTATGCTTCTTTGGGAAGGTAATTACTACAAGAAACAAACTC AATATTTGAAGATTTTGAAAACTAAAACCAAAGTTTAAAATTAACTCTAA AATCGGGACAAAGAAAACATTTTAAAAGCCTGACATTACTGGGAGAGAAC TTACGTTTGAGAGGCCTTTTTTTTTTTTTGGTTAGGCCGGGAAAGGACTC TAGGCAGGGGAGGGCTTCCCTTCGGGTTCTCCACGGGGCTGAGGCAAGGC CAAATATTATTTTAGGGAAGCACTGGGCCACGGGCGGGAAAGGTGCACAA AGGAAACACAGAACTGCCCAAAGGGGACCTGGGGATCTCAAAAGAATATC TAGGAAGGGCGGAGATAACACTGGGCTCCCAAACCCTCTGGGGCTTTGCT TTCTAAACACTTGACCGGGACACTTTGTAACCCACATTTCAATAAGGTCT GGGCAAGTGGCAGAAGAAAAGGGTATGGCGGTTCCTTATCCGAAATAAGG CGGCTCTATGGGCTGGAGGGTCCTGGGAGGGGGAATCGGGAATAAAAACT TTTGGACGAAGGGCCGGGATTAAAGGGGAGGCCATGTCCCGGGTGACGGA GAGGGGGGTGCTTTCCAAGGNGTGTAGAT
quality values	Open. Hide. 0 3 6 6 8 8 9 9 9 10 11 11 14 18 18 14 12 10 8 8 8 10 14 9 8 8 8 8 8 22 22 36 32 36 36 36 36 37 47 47 42 39 34 37 37 50 26 23 13 10 10 19 21 29 35 29 31 31 33 33 30 39 25 21 11 12 10 10 10 7 6 6 6 8 8 10 11 12 12 15 23 30 43 42 50 50 50 53 53 57 57 53 53 50 50 47 53 44 44 39 37 37 34 25 13 8 7 8 8 8 10 8 8 8 10 8 13 11 12 12 18 24 34 37 57 59 57 57 57 53 44 44 43 39 39 43 44 48 48 54 54 57 54 48 54 54 68 68 54 54 54 54 50 57 57 50 47 48 48 50 57 57 57 57 57 47 48 48 57 59 57 57 54 54 54 57 57 34 32 14 14 14 14 32 32 44 44 47 47 47 57 50 50 57 57 48 48 48 57 57 68 68 57 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 59 57 59 59 59 57 57 54 52 57 52 52 52 59 59 59 59 57 57 57 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 57 57 52 52 52 57 57 57 57 57 57 57 57 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 52 52 52 52 52 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 39 15 12 10 9 9 9 11 14 18 39 41 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 41 39 39 44 43 52 62 52 52 52 62 62 62 62 62 62 62 52 43 43 39 35 35 39 44 44 62 45 43 43 47 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 52 52 52 43 43 45 52 52 62 62 62 62 62 62 43 43 43 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 45 43 44 45 45 45 57 59 59 59 57 57 57 57 57 57 47 57 57 57 57 39 39 39 57 57 59 59 57 57 57 57 57 57 57 57 57 57 57 59 59 68 68 68 68 57 57 57 57 57 57 52 52 52 52 52 52 52 52 57 57 57 57 44 43 33 33 44 44 57 57 43 43 43 57 57 57 57 52 52 59 59 59 54 54 54 57 57 57 50 50 44 43 43 43 42 43 43 44 44 59 57 57 57 57 57 57 44 42 31 31 42 44 46 42 42 37 32 32 37 33 33 28 24 28 20 20 20 28 28 43 40 46 40 40 40 39 39 37 35 37 37 40 37 30 30 30 30 33 32 35 24 25 12 13 14 28 30 36 32 32 32 39 39 39 57 46 48 48 48 34 34 36 30 25 23 21 15 15 24 28 28 28 31 39 39 42 42 42 39 47 36 35 28 32 43 59 59 47 46 41 39 19 16 9 9 9 22 25 41 40 40 40 39 27 19 10 9 9 9 17 23 37 37 37 37 43 46 43 43 37 37 30 30 30 30 24 19 11 11 11 22 25 28 20 8 8 8 10 9 9 10 13 14 29 33 28 33 33 32 24 14 11 10 10 8 8 10 12 17 16 11 10 10 11 13 11 14 19 19 15 13 9 9 9 15 18 17 10 10 10 13 18 30 30 37 30 28 16 15 8 8 8 19 15 19 15 17 10 8 8 8 8 9 12 10 11 11 11 12 10 8 8 8 8 8 8 9 10 11 11 18 16 11 11 11 13 15 12 13 14 10 10 9 9 9 8 9 8 10 8 8 11 10 19 21 15 10 10 10 9 9 9 9 10 8 11 8 8 8 8 8 8 9 8 8 8 8 8 9 12 10 9 9 10 19 14 13 13 10 10 10 11 11 12 12 12 10 10 8 8 8 8 8 8 8 8 8 10 13 13 13 9 9 9 9 13 12 12 10 10 10 13 13 8 9 10 10 9 10 10 10 8 8 8 8 11 11 11 12 15 11 9 8 8 8 6 7 8 6 6 6 6 9 8 10 9 9 10 12 14 10 8 8 10 9 9 11 10 11 14 12 8 11 10 8 6 6 6 6 7 7 8 8 8 9 8 8 8 8 8 8 8 10 8 12 14 10 12 9 9 9 9 8 8 8 8 8 8 9 8 8 6 8 8 8 14 12 9 10 8 8 8 8 11 13 8 8 8 8 10 8 8 8 8 10 10 10 10 10 9 10 12 15 19 21 10 10 10 10 10 8 8 8 8 8 10 11 19 19 19 18 19 24 22 16 19 11 13 7 11 10 10 8 8 6 6 8 8 9 8 8 6 7 8 6 6 6 6 8 8 9 9 10 22 15 20 18 10 10 8 8 8 8 9 9 8 8 8 8 9 9 12 11 10 10 10 8 8 7 7 8 6 8 8 8 8 8 8 8 8 8 8 6 6 6 8 8 8 6 11 6 6 8 8 13 8 10 10 16 17 17 9 9 8 8 8 8 8 8 8 8 8 11 8 8 8 8 8 6 6 8 8 8 6 6 8 8 10 8 8 8 8 8 10 8 8 8 8 8 6 8 6 6 8 8 6 6 7 6 8 8 8 8 8 8 8 8 8 8	Open. Hide. 6 8 8 8 15 6 6 6 6 6 6 6 6 7 7 8 13 8 8 12 11 11 13 10 10 9 9 9 9 9 9 9 10 16 16 14 20 24 31 31 36 36 36 33 20 20 23 30 30 31 31 33 59 37 19 18 3 0 3 7 6 6 6 8 7 6 7 7 7 6 6 11 10 12 11 12 3 0 3 3 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 3 6 6 6 8 8 10 10 10 9 10 10 12 11 9 3 0 0 3 0 3 0 0 0 3 0 0 0 3 27 3 0 0 0 0 0 0 0 3 27 3 0 0 0 3 9 3 0 0 3 9 3 0 3 27 27 27 29 3 0 0 0 0 0 0 3 3 0 3 6 6 7 6 6 6 6 8 9 9 9 9 12 11 11 10 11 10 8 8 12 15 24 34 37 41 41 41 25 25 3 0 0 0 0 3 9 9 25 17 3 0 3 6 6 6 8 8 9 9 23 24 24 11 11 9 15 8 9 7 7 3 0 0 0 0 3 27 27 41 41 41 41 59 48 48 50 50 47 59 59 59 59 24 19 7 7 3 0 3 3 0 0 0 3 0 3 23 27 59 47 47 44 27 25 3 0 3 25 9 9 9 27 27 3 0 0 0 3 27 27 59 19 9 9 9 9 19 9 9 9 9 7 7 3 0 3 25 25 27 3 0 3 0 0 0 0 3 11 9 9 9 9 9 9 6 6 7 7 7 3 0 3 7 7 9 9 9 9 9 9 7 14 3 0 3 27 27 59 43 36 39 39 39 25 25 3 0 0 3 27 27 27 3 0 3 29 3 0 3 25 3 0 3 27 27 27 3 0 0 0 3 27 27 11 11 9 23 9 9 9 14 17 18 12 8 6 6 6 6 7 9 23 3 0 3 0 3 0 3 0 3 25 25 25 3 0 0 3 0 3 0 3 3 0 0 0 3 22 17 11 11 11 10 10 13 18 20 23 12 10 10 10 12 9 13 10 12 9 9 9 23 17 21 21 10 8 8 8 8 10 3 0 3 3 0 3 23 27 3 0 3 0 3 7 3 0 3 23 16 12 11 15 12 11 10 6 6 6 6 6 7 10 11 11 11 23 27 43 47 43 44 40 43 43 43 39 44 33 33 24 34 37 40 40 35 43 43 34 34 14 14 14 30 30 54 54 48 48 48 48 43 44 43 48 42 42 32 32 29 36 43 50 42 42 42 46 47 43 54 54 59 48 48 42 34 33 33 40 40 40 36 35 26 32 28 43 43 43 47 48 47 47 37 39 39 34 36 39 23 18 9 9 9 19 25 23 20 10 10 11 17 17 22 11 11 23 23 29 43 43 57 57 48 48 48 48 39 39 35 37 37 47 59 59 48 41 40 40 39 39 23 18 9 9 6 6 13 25 26 37 37 40 40 39 39 37 48 48 48 48 48 48 43 43 40 40 43 43 48 50 47 37 32 25 28 28 33 33 29 19 15 8 8 8 17 18 23 28 29 37 41 40 33 21 14 9 9 10 14 13 11 12 12 26 25 33 31 30 25 21 23 10 10 10 10 10 8 8 8 10 12 12 30 29 30 30 23 23 24 32 24 28 19 22 12 12 20 23 25 9 9 9 11 8 11 8 7 7 8 17 21 30 31 30 29 23 14 9 7 8 7 15 16 19 21 19 10 10 10 17 19 20 28 25 23 21 17 10 10 18 23 18 13 9 9 8 8 8 8 8 19 15 11 11 10 9 12 6 6 8 8 6 8 10 8 8 6 9 9 18 22 19 11 11 12 22 22 19 19 8 8 7 8 8 8 8 8 6 7 6 9 7 14 16 19 15 12 12 14 16 8 8 8 8 8 17 12 19 13 10 10 10 10 12 14 12 11 11 9 9 9 10 9 9 12 12 9 10 10 14 12 12 10 10 10 25 16 20 23 32 24 16 16 16 22 15 19 16 10 10 8 11 11 12 11 8 8 8 8 9 9 11 10 9 8 8 8 8 8 8 9 10 8 8 8 8 10 11 6 6 6 6 6 6 10 8 8 6 6 10 8 8 14 14 11 10 10 13 9 9 12 15 13 8 6 8 8 9 15 19 11 6 6 6 6 8 8 8 8 8 8 6 6 8 6 6 8 8 8 6 6 8 8 10 9 10 11 11 8 8 9 9 9 9 8 8 8 6 6 6 7 6 6 8 8 9 6 12 10 15 10 13 10 10 8 8 6 6 6 6 8 10 10 10 9 9 9 12 12 10 11 11 11 11 11 10 8 8 8 11 9 9 9 8 8 8 6 8 6 7 7 6 8 8 8 8 8 8 10 10 8 8 8 8 13 13 10 8 8 6 6 6 10 8 8 9 9 12 11 11 8 10 9 8 10 8 8 8 8 9 9 11 11 13 21 25 17 12 11 8 8 8 8 8 8 6 6 8 8 10 11 9 9 9 10 10 11 8 8 8 8 8 8 8 8 8 8 11 11 12 16 12 10 8 8 8 8 8 10 10 10 10 10 10 8 8 8 8 8 8 7 11 13 10 12 12 12 10 15 8 8 8 8 8 10 15 23 12 11 11 11 12 14 9 8 8 8 13 10 12 12 9 8 8 10 8 10 6 6 6 8 8 10 10 8 6 6 8 6 8 8 10 11 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 9 9 8 8 8 8 12 13 8 6 6 6 6 6 11 10 8 6 6 6 6 8 8 6 6 6 6 6 6 3 0 3 8 8 8 8 8 8 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no124_j21.b1 MSMg01no124_j21.b1 CHROMAT_FILE:
MSMg01no124_j21.b1 PHD_FILE: MSMg01no124_j21.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:35:57 2005
         (662 letters)



>mm_chrX_72244503_72245568
          Length = 1066

 Score = 1218 bits (630), Expect = 0.0
 Identities = 655/668 (98%), Gaps = 10/668 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   ataaagcactttgcactcaaacattagggtctgagttcagatctccagaacccaaataaa 61
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 ataaagcactttgcactcaaacattagggtctgagttcagatctccagaacccaaataaa 261

                                                                       
Query: 62  agctaggcatgtttacatatatctgtaattcagatacttgctggggaggagaaggtagat 121
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 agctaggcatgtttacatacatctgtaattcagatacttgctggggaggagaaggtagat 321

                                                                       
Query: 122 gaatccctgaaagtctctagccaggcagcctagccaatcctaaaatttacttaaataaag 181
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 gaatccctgaaagtctctagccaggcagcctagccaatcctaaaatttacttaaataaag 381

                                                                       
Query: 182 agacagagagacagaaagacaaggtgaattgaggtagtggaatacttctgatgtcaaccc 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 agacagagagacagaaagacaaggtgaattgaggtagtggaatacttctgatgtcaaccc 441

                                                                       
Query: 242 ttggccctcacatacatgtgcatacacatatgcacatgctctaatatgtacacgtactta 301
           ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||
Sbjct: 442 ttggccctcacatacatgtgcatacacatatgcacatgcaccaatatgtacacgtactta 501

                                                                       
Query: 302 cttataaaacacacatgcacacacaacatacatgcatatacttaaaatacacattaaaaa 361
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 cttataaaacacacatgcacacacaacatacatgcatatacttaaaatacacattaaaaa 561

                                                                       
Query: 362 agaaaacgaaaggaggaaattagtttcaaattgattttctcccaatcaaaaaacaaacaa 421
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 agaaaacgaaaggaggaaattagtttcaaattgattttctcccaatcaaaaaacaaacaa 621

                                                                       
Query: 422 acaaacaaa----aaacccggtgacctggttttataataagccattctttatgactgcac 477
           |||||||||    |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 acaaacaaacaaaaaacccggtgacctggttttataataagccattctttatgactgcac 681

                                                                       
Query: 478 acagacttttgagaaaagtgcattcatcataatgaactctcaagattataaatttagaga 537
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 acagacttttgagaaaagtgcattcatcataatgaactctcaagattataaatttagaga 741

                                                                       
Query: 538 aacaacacacacacacatacacacacactaacacaca----aaaaaaaacccacagggtt 593
           |||||||||||||||  ||||||||||||||||||||    |||||||||||||||||||
Sbjct: 742 aacaacacacacaca--tacacacacactaacacacacacaaaaaaaaacccacagggtt 799

                                                                       
Query: 594 accatttggatgtacttttcttcttcttcttcttcttcttcttcttcttcttcttcttct 653
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 800 accatttggatgtacttttcttcttcttcttcttcttcttcttcttcttcttcttcttct 859

                   
Query: 654 tcttcttc 661
           ||||||||
Sbjct: 860 tcttcttc 867


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 63
Number of extensions: 19
Number of successful extensions: 19
Number of sequences better than 10.0: 1
Number of HSP's gapped: 15
Number of HSP's successfully gapped: 1
Length of query: 662
Length of database: 1066
Length adjustment: 10
Effective length of query: 652
Effective length of database: 1056
Effective search space:   688512
Effective search space used:   688512
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information