MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-217I04
Chromosome	X (Build37)
Map Location	68,481,115 - 68,481,439
singlet/doublet	singlet
Overlap gene	Mtm1
Upstream gene	Ids, 1110012L19Rik, 4930567H17Rik, LOC100040304, LOC628002, LOC628012, BC023829, EG547447, LOC666981, LOC100040409, LOC628053, LOC100040432, EG280121, LOC666993, Ppia-psx_466.1, EG628080, G630014P10Rik, LOC667013
Downstream gene	Mtmr1, Cd99l2, LOC667017, Hmgb3, LOC100040549, Gpr50, LOC654357, 2610030H06Rik, Gm1141, Prrg3, Fate1, Cnga2, Magea4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ids (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15931 MGI:96417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	1110012L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930567H17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC628002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins pseudo : _no_value

name	LOC628012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	BC023829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC666981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins pseudo : _no_value

name	LOC100040409 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC628053 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG280121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC666993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppia-psx_466.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606531
definition	note : peptidylprolyl isomerase A pseudogene x_466.1 pseudo : _no_value

name	EG628080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628080 MGI:3649029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	G630014P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333639 MGI:3045303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667013 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 217 ESTs, 11 Proteins pseudo : _no_value

name	Mtm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17772 MGI:1099452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53332 MGI:1858271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd99l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Hmgb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Gpr50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14765 MGI:1333877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC654357 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654357
definition	note : ribosomal protein L30 pseudogene pseudo : _no_value

name	2610030H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67048 MGI:1914298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1141 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382221 MGI:2685987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prrg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208748 MGI:2685214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fate1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77905 MGI:1925155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Cnga2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12789 MGI:108040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17140 MGI:1333839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781803 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038990.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781805 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038991.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781811 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_010498.2

name	1110012L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803513 GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012L19 gene transcript_id : NM_026787.2

name	4930567H17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368528 GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930567H17 gene transcript_id : NM_001033807.2

name	LOC100040304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271675 GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to syndecan-1 transcript_id : XM_001474469.1

name	LOC628012 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271681 GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : hypothetical LOC628012 transcript_id : XM_001474528.1

name	BC023829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131123 GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023829 transcript_id : NM_001033328.2

name	EG547447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001530 GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG547447 transcript_id : XM_892770.1

name	LOC100040409 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271684 GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to syndecan-1 transcript_id : XM_001474636.1

name	LOC628053 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:125490330 GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC628053 transcript_id : NM_001081476.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001321 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG280121, transcript variant 3 transcript_id : XM_898689.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407488 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG280121, transcript variant 1 transcript_id : XM_207492.5

name	EG628080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407533 GeneID:628080 MGI:3649029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG628080 transcript_id : XM_900336.2

name	G630014P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486842 GeneID:333639 MGI:3045303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA G630014P10 gene transcript_id : NM_001081354.1

name	Mtm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802570 GeneID:17772 MGI:1099452
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked myotubular myopathy gene 1 transcript_id : NM_019926.2

name	Mtmr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57528446 GeneID:53332 MGI:1858271
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 1 transcript_id : NM_016985.2

name	Cd99l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129961 GeneID:171486 MGI:2177151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd99 antigen-like 2 transcript_id : NM_138309.2

name	Hmgb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892877 GeneID:15354 MGI:1098219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group box 3 transcript_id : NM_008253.3

name	LOC100040549 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271688 GeneID:100040549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001474894.1

name	Gpr50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754059 GeneID:14765 MGI:1333877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein-coupled receptor 50 transcript_id : NM_010340.1

name	2610030H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486866 GeneID:67048 MGI:1914298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610030H06 gene transcript_id : NM_001081356.1

name	Gm1141 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387299 GeneID:382221 MGI:2685987
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1141, (NCBI) transcript_id : NM_001033470.2

name	Prrg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487490 GeneID:208748 MGI:2685214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) transcript_id : NM_001081135.1

name	Cnga2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982858 GeneID:12789 MGI:108040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclic nucleotide gated channel alpha 2 transcript_id : NM_007724.2

name	Magea4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9937975 GeneID:17140 MGI:1333839
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 4 transcript_id : NM_020280.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781812 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform a protein_id : NP_034628.2

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781804 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034079.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781806 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 3; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034080.1

name	1110012L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312070 CCDS:CCDS30174.1 GeneID:68618 MGI:1915868
definition	codon_start : 1 product : hypothetical protein LOC68618 protein_id : NP_081063.1

name	4930567H17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702147 GeneID:619303 MGI:3588249
definition	codon_start : 1 product : hypothetical protein LOC619303 protein_id : NP_001028979.1

name	LOC100040304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271676 GeneID:100040304
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474519.1

name	LOC628012 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271682 GeneID:628012
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474578.1

name	BC023829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701820 CCDS:CCDS30176.1 GeneID:236848 MGI:2448555
definition	codon_start : 1 note : ee3 product : cDNA sequence BC023829 protein_id : NP_001028500.1

name	EG547447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001531 GeneID:547447 MGI:3643766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897863.1

name	LOC100040409 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271685 GeneID:100040409
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474686.1

name	LOC628053 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:125490331 GeneID:628053
definition	codon_start : 1 product : hypothetical LOC628053 protein_id : NP_001074945.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001322 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 3 protein_id : XP_903782.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086394 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 1 protein_id : XP_207492.3

name	EG628080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407534 GeneID:628080 MGI:3649029
definition	codon_start : 1 product : hypothetical protein protein_id : XP_905429.2

name	G630014P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486843 GeneID:333639 MGI:3045303
definition	codon_start : 1 product : hypothetical protein LOC333639 protein_id : NP_001074823.1

name	Mtm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910456 CCDS:CCDS30177.1 GeneID:17772 MGI:1099452
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0046716 - muscle maintenance [Evidence IMP]; GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myotubularin protein_id : NP_064310.1

name	Mtmr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393794 CCDS:CCDS30178.1 GeneID:53332 MGI:1858271
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004438 - phosphatidylinositol-3-phosphatase activity [Evidence IDA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : myotubularin-related protein 1 protein_id : NP_058681.1

name	Cd99l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489963 CCDS:CCDS30179.1 GeneID:171486 MGI:2177151
definition	codon_start : 1 note : MIC2 like-1; MIC2 (monoclonal Imperial Cancer Research Fund 2)-like 1 product : Cd99 antigen-like 2 protein_id : NP_612182.1

name	Hmgb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680231 CCDS:CCDS30180.1 GeneID:15354 MGI:1098219
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006323 - DNA packaging [Evidence IEA]; GO:0045578 - negative regulation of B cell differentiation [Evidence IDA]; GO:0045638 - negative regulation of myeloid cell differentiation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : high-mobility group protein 4; high mobilty group protein 2A product : high mobility group box 3 protein_id : NP_032279.1

name	LOC100040549 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271689 GeneID:100040549
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474944.1

name	Gpr50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754060 CCDS:CCDS30181.1 GeneID:14765 MGI:1333877
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein-coupled receptor 50 protein_id : NP_034470.1

name	2610030H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486867 GeneID:67048 MGI:1914298
definition	codon_start : 1 note : RNA binding protein-like product : hypothetical protein LOC67048 protein_id : NP_001074825.1

name	Gm1141 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701991 CCDS:CCDS30182.1 GeneID:382221 MGI:2685987
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC382221 protein_id : NP_001028642.1

name	Prrg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487491 GeneID:208748 MGI:2685214
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : transmembrane gamma-carboxyglutamic acid protein 3 product : proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) protein_id : NP_001074604.1

name	Cnga2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982859 CCDS:CCDS30184.1 GeneID:12789 MGI:108040
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : cyclic nucleotide gated channel 4 product : cyclic nucleotide gated channel alpha 2 protein_id : NP_031750.2

name	Magea4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937976 CCDS:CCDS30185.1 GeneID:17140 MGI:1333839
definition	codon_start : 1 exception : mismatches in translation product : melanoma antigen family A, 4 protein_id : NP_064676.1

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 2 pseudo : _no_value

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 1 pseudo : _no_value

name	LOC666993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666993
definition	number : 1 pseudo : _no_value

name	LOC667017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667017
definition	number : 1 pseudo : _no_value

name	LOC628002 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271683 GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035666.1

name	LOC666981 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271686 GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035667.1

name	LOC667013 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271687 GeneID:667013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 217 ESTs, 11 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_031583.1

name	Fate1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:116089270 GeneID:77905 MGI:1925155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetal and adult testis expressed 1 pseudo : _no_value transcript_id : NR_003243.1

clone name	MSMg01-377M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-172L20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-099F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428A10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-492C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-217I04.T7 (MSMg01no217_i04.b1)	MSMg01-217I04.TJ (MSMg01no217_i04.g1)
ACC	AG397017	AG397018
length	1,302	1,458
length of high quality (start - end)	325 (73 - 397)	---
definition	CHROMAT_FILE: MSMg01no217_i04.b1 PHD_FILE: MSMg01no217_i04.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:45:05 2005	CHROMAT_FILE: MSMg01no217_i04.g1 PHD_FILE: MSMg01no217_i04.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:45:06 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NGGTCTATGGGCCTATAGACTCCTAAGGGAGAGGATCCGCGGAATTCATC TGGAATTACATAGAATTGTGTCAAACTAGCAGGGAGGTACAGAAGACAAT GGTTGAGATCTGGAAAGGAAACAATCACTGTGCCCACACCCTTCAATGAG GCAATGTCAATAATCAATGAGCCTAATTCTCATTAGTCACAGATGCTCCG ATGAAGATGATGGCTCTTATGTGATAATCTAATCTCAGCAAGTGGCTAAT TATCCAAATATATAGTAACTCATATGAGTTAGATCAGTTTATCTTAGCTG CTTCAAATCTTAGAACTAAGTTACCTAGTTTGATGAGACCACAGAAAGCG TAAAGTGCTAGGTAGGTTTTCATTTTGAAACTCACTCTTCTTACCATATA TAAGAATTTAGCTCAAAGATGAATCTACTTTTACAACCTTAAATGTTCTT TTTTTCCCCCCCCCCCACCAANTCAGAGGCTTCTAAAAAAGAAGAGGGAA TCTTTTTTTTTTTTTCCCAGCAGCCAGTGACAGACTTTGGATAGATCTAT TTACTCTATTTCTTGGTTTTCTCATGACAAATACCACATCTTCAGGACAG TTGATTGGCTTTAGTGATACAAGCTGTTAGCCATAGAACAGAGTAATTTT AGATATCATAAGCTAAAACTAGTTTGGCAAATAAACTACTAAAAGGTCAA CAACTATAACCAATTTTCTTTTTATGAACAAAGGTAACTTAGTGATAGGG CAGGCATTGAAGCGAACCATTAAAATCTCCAATGCATCGAGTAACAGTCA ATCCCGTGACAGTAAACAAAGTTTTAAAATAGGATCAAGATCAAGTTACC ATTTACCTGCCAATTCCAAGATTCTTGAACCCAGCTAATCTCTCCCCAAT AAAACAAAATCTTTTGGTGAGTTATCTTCTGCAATGAAAATTAATTCCTC CAAGCCCCTTGTTAAATTCATATGTTAAAAAACTTTTTTTTAAAGAAAAA AGTCTCAATGTCCATCTGCTCAAATATTAATACATGCCATAGAAATTTTA CTTTTTTGGGAATTGGAAAAAGCCCCCTTTACCCATTTAACTTTCCATTT CATTTAATTTTTTTATATCTCTTGGAATCTCTTCAATTCACCTCATATAG GTCCTTCCAAAAAACATCCCAAATATGTGCCTTAATCTCTTCCTTTAGAA TTATTAAACTTCTCATATCTCTTCTGTGACTCTTTCAAATATAAACATAA TAACATCGTTTCTTTGATACTCTACTATATATCATTCTCTTTTCATTATT TG	TGGTGAGAGATGAGAACGACGAGAGAGTGAAGGACAACTGATACCTCACA CAACCAGTTTTCTTNNTNNTAGCNCAAGAAGATAAAGAGAGCGACGGCNT ACGGTGTTNCTGCCTAGTNCCTTCCCCCTTTTTACCCATACTTCGCCCTA TGTTCTTATGCGCGCGACGCGCGCAGAGAGGCAGAGCCACATTAGAGATA GAGATCAAGCAAGCAGTAGNAGCGCAGCAGGTTGGCGGTGCGTGTTCTTT TGCGGATATCACGGCCGCCGCTACCTCTAGAATATATACGATATATCTAC CCGCATAAATCCACTCTTCGACGATACGGATTCGAAACACATAAACCACG AACTGATCCACACGAACAGAGCAAGCAGGTGAGGAATACTGCTTACAATG CCAGGGAGTCGGTCTGCCCGCGATCTACACTCAACACTATACTGCGGCGC GACGCCGCGCGCCGATATCTACCGCGGAGCACATCCGCCACATCACGCGA GGCGCGGTCATTACTACACCACCGCGAATATACGATCAANTACATATTCA CGGATCCATGGCAGATGAGACAGCGTCGAACACACAGAAACGCGGACAGC GTATAGCGATATTCGAATATGTTAAAGATCGTATCAAACACTGGGGAGGG ATATATCGTTCAGAGCATGACATCACGAATACTAGTATAGTGAGCGACGC GGATCGCCGCCGCCTCTCATAGCGTCGCGCGACACGCGTATCAGACTATC ACTCTAACCAACCGCGGAACGCAGTTCGTTATGCTCGCGTGAGATGACAC TCGACATATCGGCGACGCGATTCAGACCGCGAATTACACTCGAAGAGAGC CGTCGCGCGTACTACTTTCACGAGTTCACTTCGGCCGTAGCGATGGTGNG TCAGCCAACGATCACGATACCCGCGATATAATTTACTCGTCACTCGACAC CGACGTATATCAGCACGAGCAGCGCTATAAGTAAAGCACGTCGCCACCAC GTGGTCGACGGATCTCTCGTACGCGCGCGCCGCGCACATATATAGACGAT CACGCACCGTTATGCGCGTACNCCGCGCGACGGCGATCACACACAGACAT CAGACATTGTATNCGTATANATAGCACANATGTCGGTACACAGATGATCG GTGTCTATACACGTAGACGCGGCGCGAATATGATATGTATATGAGNCGAC AGCGCATTTCTACGACGCGCGTATGCGATGANTAATTTCATGAGATGTAT CACANCGCCGTATCGCGTACGTAATCGTACGTATATCACGTACACACGAT ATCGTGTAGTATANTNGTCACTACTAGCCCAGAGACTAATGTCGATGCAC AGGTATACAACTACTATATCACTACGCACGTAGAAATCACATCACGCGTC TCGACAGCGCTGCCCGACGACGNCACGACATNANTAGTCGCGTCATCACT CGCTGATN
quality values	Open. Hide. 0 3 6 6 6 7 9 7 6 10 11 8 8 10 8 8 8 8 8 12 8 8 8 8 8 8 13 21 36 36 36 34 34 34 34 34 36 47 43 43 48 48 50 53 47 53 48 48 42 42 57 43 46 48 42 32 33 14 12 10 21 21 12 12 15 12 15 19 15 13 10 15 13 24 38 27 48 40 41 41 47 47 37 48 27 30 19 30 30 37 37 33 44 35 37 37 44 44 57 57 57 44 44 20 32 20 17 16 30 30 36 32 32 37 44 59 57 47 46 36 36 28 28 28 42 40 44 57 50 48 48 50 50 54 54 54 57 54 54 54 50 50 50 48 54 54 57 57 54 54 54 59 57 48 48 42 48 42 42 48 48 48 53 53 43 42 42 34 57 43 43 33 33 33 33 33 29 32 24 21 19 12 12 15 22 24 39 46 46 46 48 48 46 46 46 48 48 57 57 53 53 53 53 53 53 57 57 59 59 59 57 48 48 48 48 48 48 68 54 57 57 68 57 57 57 57 57 57 59 59 59 59 59 57 57 57 48 48 57 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 54 54 54 57 57 57 68 57 57 57 57 50 37 50 50 59 57 57 57 57 57 57 50 54 52 57 57 52 52 57 57 52 52 52 54 57 57 57 57 59 59 50 59 54 59 59 59 57 57 57 57 57 57 59 57 57 57 43 43 29 43 43 57 57 39 39 43 47 44 47 42 42 35 35 42 44 57 57 57 44 44 43 48 39 44 42 42 39 42 42 48 57 57 57 48 48 48 48 48 46 48 43 48 48 57 57 57 54 54 47 48 43 48 48 59 57 57 57 59 59 59 59 59 57 57 57 57 57 57 59 57 57 57 50 50 50 50 47 47 37 20 20 11 12 11 11 9 12 9 9 12 23 30 41 59 47 48 59 59 59 48 48 57 48 48 57 57 48 48 48 48 48 48 57 57 57 57 59 59 48 57 48 48 59 59 59 59 59 43 41 24 21 9 9 9 12 10 18 22 22 12 16 16 12 10 11 16 16 15 10 11 10 11 16 23 27 3 0 3 23 20 16 11 10 8 8 8 8 8 12 12 17 30 21 18 9 9 9 11 11 11 12 12 20 28 28 39 59 59 59 59 59 59 59 59 59 59 59 59 59 59 48 47 40 47 43 48 43 43 43 30 30 15 15 15 30 30 29 32 30 33 41 41 41 32 37 32 42 32 32 32 42 42 47 48 59 57 54 54 48 48 48 48 48 59 59 59 59 42 42 35 35 44 44 44 42 48 48 48 48 57 44 44 43 43 35 43 43 43 44 42 43 43 43 23 28 24 38 24 43 33 35 35 43 43 57 43 44 44 48 44 44 42 35 35 35 42 42 35 22 27 22 24 33 36 41 43 43 37 37 42 37 30 30 19 19 13 21 21 24 15 18 20 30 30 19 19 11 11 11 15 15 20 34 29 34 14 14 14 28 28 43 39 32 32 32 23 20 20 31 28 35 39 36 33 34 28 28 32 34 34 22 22 22 22 28 27 27 21 13 12 12 16 22 22 25 25 24 22 22 28 28 22 22 12 12 12 26 11 11 11 13 13 21 22 33 33 34 34 39 47 43 43 43 43 43 39 47 37 37 30 25 28 28 23 18 14 20 13 10 12 9 10 8 8 8 8 7 9 10 10 15 15 13 11 11 11 12 15 10 10 8 8 8 8 16 11 11 12 24 21 37 37 23 19 8 8 8 8 8 10 8 8 8 8 11 11 12 12 13 10 10 10 10 10 13 16 15 11 10 11 11 10 10 11 11 8 8 10 11 16 19 18 24 12 12 8 10 8 8 9 11 14 16 16 14 10 11 10 10 10 8 17 13 15 14 10 6 6 6 6 8 8 12 10 10 15 21 15 10 10 10 13 13 23 13 17 11 10 9 14 14 12 15 12 9 9 10 12 16 18 16 10 10 10 10 10 10 10 10 10 21 21 28 33 25 21 16 10 9 9 9 9 8 10 8 8 8 10 15 12 12 14 24 15 17 15 24 26 15 13 10 9 8 8 8 8 19 25 29 30 9 8 8 8 8 8 8 10 10 10 10 10 8 8 8 10 10 10 10 10 9 10 13 19 13 16 16 15 11 14 8 8 6 7 7 7 11 8 8 8 10 9 9 8 10 10 8 8 10 15 10 10 10 9 9 9 11 11 9 7 7 8 8 8 8 8 8 16 16 12 12 14 21 17 16 11 10 8 8 8 10 11 14 16 15 15 10 8 10 8 8 8 12 10 9 9 8 8 8 8 8 8 8 8 8 8 8 10 10 10 8 10 8 8 8 8 8 8 8 8 10 10 10 11 13 11 11 11 15 11 11 8 10 10 8 8 9 9 9 10 10 11 9 9 6 8 8 8 8 9 9 12 12 13 9 11 9 9 10 10 20 20 21 26 19 15 11 16 11 11 11 16 10 11 10 10 10 17 12 14 10 13 10 8 10 8 8 8 8 12 11 9 9 12 13 13 11 13 9 9 9 9 8 8 6 7 7 8 8 8 8 15 17 16 13 11 11 10 10 9 10 8 8 8 8 8 10 8 9 9 9 9 8 9 12 12 8 8 8 8 8 8 8 10 17 22 15 15 8 8 8 8 8 8 12 12 9 9 8 7 8 6 6 8 10 7 6 8 8 8 8 9 9 12 12 8 8 8 10 15 15 15 8 8 6 6 6 6 10 8 10 8 8 6 6 10 12 8 8 9 10 10 10 10 9 8 8 10 6 6 8 8 8 8 6 6 6 6 13 10 7 6 10 6 8 8 8 8 8 9 12 10 15 15 6 6 6 6 6 6 10 8 9 9 9 9 11 7 8 7 6 10 8 8 8 12 13 12 10 7 7 8 8 8 10 10 10 8 8 8 8 8 10 9 9 10 11 12 11 11 11 10 10 13 10 9 9	Open. Hide. 6 6 6 6 6 6 8 8 8 6 6 6 6 7 8 7 7 9 9 9 9 11 11 12 12 12 9 9 6 6 6 6 8 8 9 9 10 9 9 9 8 8 6 6 6 6 12 9 6 6 6 6 6 6 6 6 6 6 8 6 9 12 15 3 0 0 3 0 0 3 8 8 3 0 3 8 8 8 8 10 6 9 8 6 6 6 6 6 8 8 8 8 8 10 10 10 10 3 0 3 8 8 8 8 8 10 13 3 0 3 9 6 8 10 10 10 6 3 0 3 10 9 16 19 17 12 10 9 9 10 15 24 14 15 10 10 7 8 8 8 8 8 8 8 8 8 7 10 10 6 6 6 6 8 8 8 6 6 8 8 8 10 12 8 8 8 8 10 9 10 9 7 6 8 8 8 8 8 8 8 8 6 6 6 7 8 8 8 6 8 6 6 8 8 8 8 8 6 6 8 8 8 8 8 8 6 6 6 6 6 6 6 6 8 6 10 8 8 3 0 3 8 8 6 6 6 6 6 8 10 18 16 9 8 8 8 8 8 6 6 6 6 6 6 6 6 7 6 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 10 8 8 6 10 6 6 6 6 8 10 9 8 6 6 6 7 7 7 10 8 6 6 6 6 11 10 10 10 8 8 8 8 8 8 8 6 6 7 7 6 6 11 8 10 10 10 9 9 12 10 8 8 8 6 8 8 6 6 6 8 10 8 6 6 6 6 8 6 8 8 8 8 8 8 8 8 8 6 6 6 6 8 9 7 8 8 8 8 8 9 10 8 8 8 10 12 10 10 9 9 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 10 10 11 8 8 7 6 8 6 6 8 6 6 6 6 6 6 8 7 6 9 10 8 12 8 8 6 6 6 6 6 6 8 8 8 8 8 8 10 10 10 10 10 8 11 9 9 8 6 10 6 6 6 6 7 7 8 6 10 7 7 12 8 8 8 8 10 9 13 15 10 7 7 7 8 8 15 8 8 8 7 6 6 6 8 8 10 8 10 6 9 9 9 7 6 8 8 6 6 6 6 8 8 8 8 8 10 14 28 26 19 15 11 8 8 6 6 6 8 11 17 13 9 9 9 9 9 9 9 9 12 8 9 8 10 8 6 6 6 7 8 9 9 12 10 13 10 11 11 11 9 6 6 6 6 3 0 3 8 8 8 8 8 8 9 6 8 8 8 8 6 8 8 10 6 6 8 6 6 7 7 6 6 6 6 8 6 8 8 8 8 8 8 8 9 12 11 11 11 10 11 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 10 8 8 8 8 8 8 8 6 7 7 10 6 6 6 6 8 8 10 10 10 8 6 7 8 8 9 8 8 8 8 8 8 8 8 6 6 8 6 6 6 6 8 8 8 8 6 6 8 6 8 8 8 8 6 6 6 8 6 6 6 6 7 7 8 8 8 9 9 10 10 10 8 8 8 8 8 8 12 15 8 8 6 6 6 6 8 6 8 8 8 10 9 8 8 8 8 7 7 9 9 9 9 12 10 8 8 10 8 10 11 11 6 6 6 6 8 6 9 10 10 8 10 6 6 8 6 6 8 6 6 8 6 6 8 6 8 7 9 7 8 8 8 8 8 8 8 8 8 8 8 6 6 10 8 9 8 9 8 8 8 6 6 6 6 6 6 6 6 6 6 10 10 9 9 9 9 9 8 8 10 8 8 8 8 9 13 16 11 11 11 11 10 10 10 10 8 6 6 6 10 8 8 6 6 8 8 6 8 8 8 6 6 6 6 6 6 10 8 8 6 6 6 6 6 6 8 8 8 8 7 7 13 12 11 9 9 8 6 6 6 6 6 6 6 8 8 8 8 6 12 7 7 8 6 8 8 7 9 9 9 9 11 12 8 8 8 6 6 8 11 8 10 9 6 6 6 6 7 6 7 6 8 6 8 8 8 11 11 11 9 9 3 0 3 9 6 6 6 6 6 6 6 6 8 9 8 8 8 8 6 6 6 7 6 7 8 12 11 6 6 6 6 6 6 6 6 8 6 6 6 6 6 6 11 10 11 9 6 6 6 6 6 6 8 8 8 6 8 6 6 6 8 10 8 8 8 8 17 17 19 8 8 8 8 8 6 8 8 6 7 7 8 6 6 6 6 6 6 8 10 8 8 8 8 8 8 8 8 6 6 6 6 6 8 6 6 8 10 8 8 8 8 8 8 10 9 9 9 9 9 9 10 9 6 8 6 6 6 6 8 8 8 8 8 8 9 12 8 6 6 6 6 8 8 8 10 10 10 11 9 8 8 6 6 6 6 6 6 8 8 10 8 6 6 6 6 8 6 8 8 8 8 8 8 3 0 3 9 10 8 8 10 8 8 8 8 8 8 10 9 10 10 11 16 18 16 12 8 7 7 7 8 6 6 6 6 6 8 8 6 6 6 6 8 8 3 0 3 6 8 8 10 3 0 3 6 6 6 6 6 8 3 0 3 7 7 7 8 8 9 8 8 8 8 13 8 6 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 8 8 8 8 8 8 8 8 8 8 10 15 8 6 6 6 8 10 8 6 8 6 6 6 6 8 6 10 9 9 3 0 3 6 6 6 6 8 8 6 6 6 6 8 6 6 6 6 6 8 6 6 8 8 8 9 9 9 8 10 6 6 6 12 10 8 3 0 3 10 8 8 8 8 8 6 6 6 6 6 6 8 7 6 6 8 8 8 8 3 0 3 8 8 8 8 8 7 7 6 7 6 7 7 6 8 8 9 12 11 8 6 6 6 6 6 8 8 8 9 9 9 10 9 9 9 9 7 8 8 8 7 8 9 10 10 10 10 11 10 8 6 6 6 6 6 6 8 3 0 3 0 3 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 6 8 8 8 8 6 6 8 6 6 6 6 6 6 8 6 8 8 8 8 6 6 6 6 6 6 8 8 8 8 8 8 6 6 6 6 8 6 8 9 8 6 7 6 6 6 6 6 6 8 8 6 6 6 6 10 10 8 8 8 6 6 6 6 6 8 8 8 8 8 8 6 6 6 6 6 8 8 10 3 0 3 7 7 6 8 8 8 3 0 3 0 3 6 6 6 8 12 12 12 8 9 8 8 8 8 7 6 6 6 6 6 6 6 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no217_i04.b1 MSMg01no217_i04.b1 CHROMAT_FILE:
MSMg01no217_i04.b1 PHD_FILE: MSMg01no217_i04.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:45:05 2005
         (325 letters)



>mm_chrX_68480915_68481639
          Length = 725

 Score =  613 bits (317), Expect = e-180
 Identities = 323/325 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   aaactagcagggaggtacagaagacaatggttgagatctggaaaggaaacaatcactgtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 525 aaactagcagggaggtacagaagacaatggttgagatctggaaaggaaataatcactgtg 466

                                                                       
Query: 61  cccacacccttcaatgaggcaatgtcaataatcaatgagcctaattctcattagtcacag 120
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 465 cccacacccttcaatgaggcaatgtcaataatcaatgagcctaattctcagtagtcacag 406

                                                                       
Query: 121 atgctccgatgaagatgatggctcttatgtgataatctaatctcagcaagtggctaatta 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 405 atgctccgatgaagatgatggctcttatgtgataatctaatctcagcaagtggctaatta 346

                                                                       
Query: 181 tccaaatatatagtaactcatatgagttagatcagtttatcttagctgcttcaaatctta 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 345 tccaaatatatagtaactcatatgagttagatcagtttatcttagctgcttcaaatctta 286

                                                                       
Query: 241 gaactaagttacctagtttgatgagaccacagaaagcgtaaagtgctaggtaggttttca 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 gaactaagttacctagtttgatgagaccacagaaagcgtaaagtgctaggtaggttttca 226

                                    
Query: 301 ttttgaaactcactcttcttaccat 325
           |||||||||||||||||||||||||
Sbjct: 225 ttttgaaactcactcttcttaccat 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 325
Length of database: 725
Length adjustment: 9
Effective length of query: 316
Effective length of database: 716
Effective search space:   226256
Effective search space used:   226256
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information