MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-267B06
Chromosome	X (Build37)
Map Location	150,620,679 - 150,620,994
singlet/doublet	singlet
Overlap gene	EG625767
Upstream gene	Klf8, LOC100039932, EG635136, Ubqln2, Cypt3, LOC100039998, LOC667241, Kctd12b, 2210013O21Rik, Smt3h1-ps, Spin2, 4921511M17Rik, OTTMUSG00000019268, LOC625650, LOC100040020, EG546397, OTTMUSG00000019256, EG434874, LOC635580
Downstream gene	LOC270665, LOC100040076, 4930524N10Rik, EG434879, LOC667313, 4930542N07Rik, EG434881, LOC100040899, LOC667331, LOC100040925, LOC100040937, Magea6, Magea3, LOC626034, Magea8, Magea2, Magea5, Magea1, 1700042B14Rik, LOC245676, Amd-ps1, LOC667369
Link	Open Mouse BAC browser

Click to get alignment info.

name	Klf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245671 MGI:2442430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG635136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635136 MGI:3643652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ubqln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54609 MGI:1860283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cypt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69361 MGI:1916611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC667241 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667241
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Kctd12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207474 MGI:2444667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210013O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70123 MGI:1917373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 28 ESTs

name	Smt3h1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60456 MGI:1926282
definition	note : SMT3 suppressor of mif two 3 homolog 1, pseudogene (S. cerevisiae) pseudo : _no_value

name	Spin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278240 MGI:3605548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921511M17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78092 MGI:1925342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	OTTMUSG00000019268 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667256 MGI:3709338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	LOC625650 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	LOC100040020 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040020
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	EG546397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546397 MGI:3648189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	OTTMUSG00000019256 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625713 MGI:3709336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	EG434874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434874 MGI:3643221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	LOC635580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	EG625767 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625767 MGI:3644671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC270665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:270665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100040076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	4930524N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75071 MGI:1922321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	EG434879 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434879 MGI:3643220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	LOC667313 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930542N07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75185 MGI:1922435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434881 MGI:3646587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC667331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	LOC100040937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins

name	Magea6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17142 MGI:1333837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17139 MGI:1333832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626034 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins pseudo : _no_value

name	Magea8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17144 MGI:1333827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17138 MGI:1333793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17141 MGI:1333838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17137 MGI:1333834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700042B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73347 MGI:1920597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC245676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:245676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins pseudo : _no_value

name	Amd-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11701 MGI:1310005
definition	gene_synonym : Amd3 note : S-adenosylmethionine decarboxylase, pseudogene 1 pseudo : _no_value

name	LOC667369 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667369
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Klf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344176 GeneID:245671 MGI:2442430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 8 transcript_id : NM_173780.3

name	Ubqln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328235 GeneID:54609 MGI:1860283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 2 transcript_id : NM_018798.2

name	Cypt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842382 GeneID:69361 MGI:1916611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich perinuclear theca 3 transcript_id : NM_173367.2

name	Kctd12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538834 GeneID:207474 MGI:2444667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 12b transcript_id : NM_175429.3

name	2210013O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272507 GeneID:70123 MGI:1917373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : RIKEN cDNA 2210013O21 gene transcript_id : XM_001475273.1

name	2210013O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272506 GeneID:70123 MGI:1917373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : RIKEN cDNA 2210013O21 gene, transcript variant 2 transcript_id : XM_898756.3

name	Spin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52851392 GeneID:278240 MGI:3605548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spindlin family, member 2 transcript_id : NM_001005370.1

name	4921511M17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408452 GeneID:78092 MGI:1925342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : RIKEN cDNA 4921511M17 gene transcript_id : XM_989376.1

name	OTTMUSG00000019268 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408451 GeneID:667256 MGI:3709338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : predicted gene, OTTMUSG00000019268 transcript_id : XM_621118.3

name	LOC625650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408454 GeneID:625650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : hypothetical LOC625650 transcript_id : XM_486801.3

name	LOC100040020 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272471 GeneID:100040020
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : hypothetical protein LOC100040020 transcript_id : XM_001473955.1

name	EG546397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272477 GeneID:546397 MGI:3648189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : predicted gene, EG546397 transcript_id : XM_621121.4

name	OTTMUSG00000019256 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408459 GeneID:625713 MGI:3709336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : predicted gene, OTTMUSG00000019256 transcript_id : XM_136124.4

name	EG434874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272479 GeneID:434874 MGI:3643221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : predicted gene, EG434874 transcript_id : XM_486800.5

name	LOC635580 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272481 GeneID:635580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : hypothetical LOC635580 transcript_id : XM_001474001.1

name	EG434879 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408465 GeneID:434879 MGI:3643220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : predicted gene, EG434879 transcript_id : XM_486805.3

name	4930542N07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802341 GeneID:75185 MGI:1922435
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930542N07 gene transcript_id : NM_029199.2

name	EG434881 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81230475 GeneID:434881 MGI:3646587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434881 transcript_id : NM_001037167.1

name	LOC100040899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272513 GeneID:100040899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Predicted gene, EG434881 transcript_id : XM_001475438.1

name	LOC100040925 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272515 GeneID:100040925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : hypothetical protein LOC100040925 transcript_id : XM_001475475.1

name	LOC100040937 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272517 GeneID:100040937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins product : hypothetical protein LOC100040937 transcript_id : XM_001475498.1

name	Magea6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115430104 GeneID:17142 MGI:1333837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 6 transcript_id : NM_020019.3

name	Magea3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910399 GeneID:17139 MGI:1333832
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 3 transcript_id : NM_020017.1

name	Magea8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362870 GeneID:17144 MGI:1333827
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 8 transcript_id : NM_020020.3

name	Magea2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426896 GeneID:17138 MGI:1333793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 2 transcript_id : NM_020016.1

name	Magea5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910401 GeneID:17141 MGI:1333838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 5 transcript_id : NM_020018.1

name	Magea1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426894 GeneID:17137 MGI:1333834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 1 transcript_id : NM_020015.1

name	1700042B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157452 GeneID:73347 MGI:1920597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700042B14 gene transcript_id : NM_001081671.1

name	Klf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424645 CCDS:CCDS30481.1 GeneID:245671 MGI:2442430
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : Kruppel-like factor 8 protein_id : NP_776141.1

name	Ubqln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328236 CCDS:CCDS30482.1 GeneID:54609 MGI:1860283
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : Ubiquitin-related protein product : ubiquilin 2 protein_id : NP_061268.2

name	Cypt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842383 CCDS:CCDS30483.1 GeneID:69361 MGI:1916611
definition	codon_start : 1 note : basic protein CKT1R1; cysteine-rich perinuclear theca protein 3 product : cysteine-rich perinuclear theca 3 protein_id : NP_775543.2

name	Kctd12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425146 CCDS:CCDS30484.1 GeneID:207474 MGI:2444667
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 12b protein_id : NP_780638.1

name	2210013O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272508 GeneID:70123 MGI:1917373
definition	codon_start : 1 product : hypothetical protein LOC70123 protein_id : XP_001475323.1

name	2210013O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004448 GeneID:70123 MGI:1917373
definition	codon_start : 1 product : hypothetical protein LOC70123 isoform 2 protein_id : XP_903849.1

name	Spin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52851393 CCDS:CCDS30485.1 GeneID:278240 MGI:3605548
definition	GO_process : GO:0007276 - gametogenesis [Evidence IEA] codon_start : 1 note : spindlin-like; spindlin family member 2 product : spindlin family, member 2 protein_id : NP_001005370.1

name	4921511M17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408453 GeneID:78092 MGI:1925342
definition	codon_start : 1 product : hypothetical protein LOC78092 protein_id : XP_994470.1

name	OTTMUSG00000019268 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63750724 GeneID:667256 MGI:3709338
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621118.1

name	LOC625650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772538 GeneID:625650
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486801.1

name	LOC100040020 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272472 GeneID:100040020
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474005.1

name	EG546397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272478 GeneID:546397 MGI:3648189
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621121.4

name	OTTMUSG00000019256 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086892 GeneID:625713 MGI:3709336
definition	codon_start : 1 product : hypothetical protein protein_id : XP_136124.2

name	EG434874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272480 GeneID:434874 MGI:3643221
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486800.4

name	LOC635580 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272482 GeneID:635580
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474051.1

name	EG434879 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408466 GeneID:434879 MGI:3643220
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486805.3

name	4930542N07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386374 CCDS:CCDS30486.1 GeneID:75185 MGI:1922435
definition	codon_start : 1 product : hypothetical protein LOC75185 protein_id : NP_083475.1

name	EG434881 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230476 CCDS:CCDS30487.1 GeneID:434881 MGI:3646587
definition	codon_start : 1 product : hypothetical protein LOC434881 protein_id : NP_001032244.1

name	LOC100040899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272514 GeneID:100040899
definition	codon_start : 1 product : similar to Predicted gene, EG434881 protein_id : XP_001475488.1

name	LOC100040925 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272516 GeneID:100040925
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475525.1

name	LOC100040937 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272518 GeneID:100040937
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475548.1

name	Magea6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910404 CCDS:CCDS30488.1 GeneID:17142 MGI:1333837
definition	codon_start : 1 product : melanoma antigen family A, 6 protein_id : NP_064403.1

name	Magea3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910400 CCDS:CCDS30489.1 GeneID:17139 MGI:1333832
definition	codon_start : 1 exception : mismatches in translation product : melanoma antigen family A, 3 protein_id : NP_064401.1

name	Magea8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910406 CCDS:CCDS30490.1 GeneID:17144 MGI:1333827
definition	codon_start : 1 product : melanoma antigen family A, 8 protein_id : NP_064404.1

name	Magea2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426897 CCDS:CCDS30491.1 GeneID:17138 MGI:1333793
definition	codon_start : 1 product : melanoma antigen family A, 2 protein_id : NP_064400.1

name	Magea5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910402 CCDS:CCDS30492.1 GeneID:17141 MGI:1333838
definition	codon_start : 1 product : melanoma antigen family A, 5 protein_id : NP_064402.1

name	Magea1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426895 CCDS:CCDS30493.1 GeneID:17137 MGI:1333834
definition	codon_start : 1 product : melanoma antigen family A, 1 protein_id : NP_064399.1

name	1700042B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157453 GeneID:73347 MGI:1920597
definition	GO_component : GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73347 protein_id : NP_001075140.1

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 3 pseudo : _no_value

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 2 pseudo : _no_value

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 1 pseudo : _no_value

name	EG635136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635136
definition	number : 1 pseudo : _no_value

name	LOC100039998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039998
definition	number : 1 pseudo : _no_value

name	LOC667241 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667241
definition	number : 1 pseudo : _no_value

name	EG625767 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625767
definition	number : 2 pseudo : _no_value

name	EG625767 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625767
definition	number : 1 pseudo : _no_value

name	LOC270665 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:270665
definition	number : 1 pseudo : _no_value

name	LOC100040076 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040076
definition	number : 2 pseudo : _no_value

name	LOC100040076 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040076
definition	number : 1 pseudo : _no_value

name	LOC667313 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667313
definition	number : 1 pseudo : _no_value

name	LOC667313 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667313
definition	number : 2 pseudo : _no_value

name	LOC667369 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667369
definition	number : 1 pseudo : _no_value

name	LOC667369 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667369
definition	number : 2 pseudo : _no_value

name	LOC667369 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667369
definition	number : 3 pseudo : _no_value

name	Amd-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : Amd3 product : S-adenosylmethionine decarboxylase pseudo : _no_value

name	4930524N10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94408464 GeneID:75071 MGI:1922321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : RIKEN cDNA 4930524N10 gene transcript_id : XR_001603.1

name	LOC667331 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272486 GeneID:667331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 7 Proteins product : similar to non-imprinted in Prader-Willi/Angelman syndrome 2 pseudo : _no_value transcript_id : XR_031557.1

name	LOC626034 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272523 GeneID:626034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins product : similar to Transmembrane and TPR repeat-containing protein 3 pseudo : _no_value transcript_id : XR_032305.1

name	LOC245676 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272524 GeneID:245676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins product : similar to ribosomal protein S20 pseudo : _no_value transcript_id : XR_032431.1

clone name	MSMg01-063I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-396E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-267B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-315D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434H02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-267B06.T7 (MSMg01no267_b06.b1)	MSMg01-267B06.TJ (MSMg01no267_b06.g1)
ACC	AG407897	AG407898
length	737	736
length of high quality (start - end)	320 (45 - 364)	650 (77 - 726)
definition	CHROMAT_FILE: MSMg01no267_b06.b1 PHD_FILE: MSMg01no267_b06.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:05:02 2005	CHROMAT_FILE: MSMg01no267_b06.g1 PHD_FILE: MSMg01no267_b06.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:05:02 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCTCTCCTCATAACAATAAAAAGTAGGTAATCATTGCCTGGATATGAT AGAAGATTTAAGAATATCAGATGTGTTAGTTTCCATAAAGTGTATAACTG AGGCTCCACCTAATCAAAGCACAGGACAGAAATGTAAAGGGTTGTGTGAG CCAAGCTTGGTAGGTGAGACACTCTTCTGAGTTGTAATGTCTACTGAACA GAACGTCTTTTCTTGAAGGTGATTGAACTCTTGTGTGACTCCATTTCTGT TCAACATTTTCTGTTGGTTGAAAGATATTTATGATAACAGCATCTTTCAA ATGGACCATCTCACTCTTGTTACACCACACCCCCCAGTTTAAGTAAATTA AATCGGGGAAGGGTTCAAATTGGGTCTGTATGAAACAGATGCATCTATTG CATGGGATTCAAATATGAGCAAGACCAGATCTTACTAGCCTAGCATATTA GTGTGGCCCAGCATTTTCCACCTGAGTCATGTTGTAAATCAAAACTCACT GCTCTTGTAGTCCACTGCCCCAAATCTGCCTTCATAAGTCAGAAGGTGTG AGAAGGGTATTACTGAGGTCCACATCAATTGAAATCACATCTTTCTGCTA TAAATTTTCAAGTGGTACAGCTAACATCTTCAAAGTGGGAAGCACATTCC ACTGGCAATGTCCATTACTGGGTACCTGGGAAGGAAG	CCATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXAATGTTTAGCTATGTACCCCATTT TGTAATAGGGTTATTTGAATTTCTGCACTCCAGCTTCTTGAGCTCCTGTA TATATTGGATATTTGTCCCCTATCAGACTTAGGATTGGTAAAAATTCTTT CCCAATCAGGTGGTGGCCTTTTTGTCTTATTGACAGTATCTATTGCTCTA CAGAAGCTTTGCAATTTTATAAGGTCCCATTCGTCCACTCTTGATCTTAC AGCACAGGCCATTGCTGTTCTGTTTAGGAAATTTTCTCCTGTACCCATAT CTTTGAGGCTTTTCCCCACTTTCTCCTCTATAAATTTCAGTGTCTCTGAT TTTATGTGGCGGTCTTTGATCCACTTAGACTTGAGCTTTGTACAAGCACA TAAAAATGGATCAATTTTCATTCTTCTACAGGATAATCGCCAGTTGTACC TTCACAGTTTGTTGAAAATGCTGTCTTTTTTCAACTGGATGGTTTTAGCT CCCTTGTCAAACATCAGGTGACCATAGGTGTGTGGGTTCATTTTTGGGTC TTCAATTCTATTCCATCCATCTACCTGTCTGTCATTTTACTTGTACCATG CAGTTTTGATCACAATTGCTCTATAGTACAGCTTGAGGTCAAGAATGGTG ATTCTCCCAGAGGTTCTTTTATTGTTGAGAATATTN
quality values	Open. Hide. 8 8 8 8 8 8 13 30 59 37 29 29 28 22 22 30 23 23 24 28 28 28 43 43 29 25 28 28 28 35 44 57 53 50 50 57 57 57 57 42 37 26 30 36 40 41 48 57 42 47 47 47 53 50 59 59 59 59 50 50 50 50 50 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 59 57 57 59 57 57 68 68 68 68 68 68 68 68 68 68 51 51 51 51 51 51 68 68 68 68 68 57 57 57 57 52 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 59 68 68 57 57 57 68 68 68 68 68 68 68 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 59 59 59 68 59 59 59 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 53 57 59 59 59 57 57 57 57 57 57 59 57 57 57 57 57 53 44 48 34 34 16 16 11 12 11 10 10 10 10 15 10 8 8 8 8 8 8 8 8 9 8 9 9 10 9 9 26 28 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 68 68 68 68 68 68 57 59 59 57 57 44 44 40 30 41 20 28 28 31 44 23 25 25 30 30 42 39 47 57 57 57 57 68 57 59 59 59 59 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 68 68 68 68 68 57 57 57 59 59 59 59 68 68 68 68 68 68 68 57 59 59 57 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 68 57 57 57 57 59 57 57 68 68 68 68 68 68 68 57 57 57 59 59 59 59 68 68 68 68 68 57 57 57 57 57 57 59 59 57 57 57 59 59 57 53 48 48 48 50 48 48 48 48 41 41 41 47 59 44 44 37 39 37 37 39 44 44 59 59 50 50 59 59 59 59 57 57 57 57 57 57 48 48 48 48 48 48 48 57 57 57 57 59 59 57 57 57 57 57 50 57 57 57 57 57 48 48 48 59 59 59 59 57 57 48 48 48 48 48 48 47 47 59 59 37 37 32 31 31 32 37 31 36 39 37 37 39 40 46 46 48 48 41 41 41 41 47 41 41 31 31 41 39 41 37 37 41 41 36 40 41 41 43 41 41 37 37 37 41 37 32 31 31 39 31 31 39 41 41 41 41 41 41 41 41 41 37 31 31 30 32 32 29 29 32 34 37 34 34 29 29 28 36 20 20	Open. Hide. 8 8 8 13 10 8 8 8 8 19 25 48 48 48 48 57 48 57 50 53 57 57 57 57 50 50 50 57 57 50 48 34 26 18 11 21 21 29 24 29 33 33 48 36 57 57 57 68 68 68 68 68 68 68 68 57 57 68 68 68 44 42 19 21 12 14 14 24 24 19 15 30 30 41 48 48 47 47 47 48 50 57 68 68 68 68 68 68 68 68 68 59 59 57 68 68 68 53 53 57 57 59 50 50 50 53 53 53 53 53 57 53 53 53 53 53 41 41 37 37 37 33 39 25 13 8 8 8 8 13 21 37 37 37 59 59 59 59 53 53 53 53 53 50 57 57 57 53 53 53 53 53 53 47 47 53 47 47 47 51 51 47 51 51 68 68 68 68 68 68 68 68 57 68 54 54 54 57 57 59 57 51 51 50 50 50 50 68 68 68 68 68 68 57 57 57 57 59 59 59 59 59 59 59 59 57 57 57 59 59 68 68 68 68 59 59 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 57 59 59 59 57 57 57 68 68 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 57 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 43 43 27 16 14 14 14 39 39 62 62 62 62 62 39 39 39 35 35 35 35 35 43 43 43 44 62 68 68 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 59 59 59 59 59 59 68 57 57 57 57 57 57 59 57 57 57 57 68 68 68 68 57 57 57 57 57 57 57 57 57 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 68 68 68 68 59 57 57 52 52 52 57 59 57 57 57 57 57 57 59 59 59 59 68 59 59 57 59 59 68 59 59 59 59 59 59 57 57 57 57 57 57 59 59 57 57 57 47 47 47 57 57 57 59 59 59 59 59 57 57 57 59 59 59 47 47 48 54 57 57 68 59 57 57 59 57 48 48 48 48 48 54 54 54 54 57 59 59 68 68 68 68 54 54 48 48 48 57 53 50 50 48 48 57 57 57 57 48 48 48 57 48 50 50 50 50 50 41 59 41 41 41 37 37 41 43 59 47 43 43 41 41 44 41 44 41 41 37 37 32 31 31 32 43 41 41 41 41 41 43 39 43 43 43 40 43 32 39 30 28 34 33 24 19 20 30 37 34 31 37 30 31 37 31 31 23 21 11 11 13 25 28 43 43 43 32 32 20 28 20 28 24 37 31 30 29 29 32 21 17 12 12 12 25 15 15 14 15 13 11 9 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no267_b06.b1 MSMg01no267_b06.b1 CHROMAT_FILE:
MSMg01no267_b06.b1 PHD_FILE: MSMg01no267_b06.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:05:02 2005
         (320 letters)



>mm_chrX_150620475_150621194
          Length = 720

 Score =  611 bits (316), Expect = e-179
 Identities = 316/316 (100%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattctctcctcataacaataaaaagtaggtaatcattgcctggatatgatagaagatt 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 520 gaattctctcctcataacaataaaaagtaggtaatcattgcctggatatgatagaagatt 461

                                                                       
Query: 65  taagaatatcagatgtgttagtttccataaagtgtataactgaggctccacctaatcaaa 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 taagaatatcagatgtgttagtttccataaagtgtataactgaggctccacctaatcaaa 401

                                                                       
Query: 125 gcacaggacagaaatgtaaagggttgtgtgagccaagcttggtaggtgagacactcttct 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 gcacaggacagaaatgtaaagggttgtgtgagccaagcttggtaggtgagacactcttct 341

                                                                       
Query: 185 gagttgtaatgtctactgaacagaacgtcttttcttgaaggtgattgaactcttgtgtga 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 gagttgtaatgtctactgaacagaacgtcttttcttgaaggtgattgaactcttgtgtga 281

                                                                       
Query: 245 ctccatttctgttcaacattttctgttggttgaaagatatttatgataacagcatctttc 304
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280 ctccatttctgttcaacattttctgttggttgaaagatatttatgataacagcatctttc 221

                           
Query: 305 aaatggaccatctcac 320
           ||||||||||||||||
Sbjct: 220 aaatggaccatctcac 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 320
Length of database: 720
Length adjustment: 9
Effective length of query: 311
Effective length of database: 711
Effective search space:   221121
Effective search space used:   221121
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information