MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-332D19
Chromosome	X (Build37)
Map Location	75,841,397 - 75,842,222
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Tbl1x, EG628893, LOC667606, Prkx, Pbsn, OTTMUSG00000017866, LOC100042001, 5430402E10Rik, LOC628976, Obp1a, EG546335, EG628991, LOC236874, EG667658, 4930480E11Rik, EG667672, Prrg1
Downstream gene	LOC667679, LOC667684, 4921509A18Rik, LOC667700, EG546337, EG629116, LOC636082, EG667736, LOC100041373, EG636104
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tbl1x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21372 MGI:1336172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628893 MGI:3645962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC667606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Prkx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19108 MGI:1309999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54192 MGI:1860484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000017866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628923 MGI:3709306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein

name	LOC100042001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein pseudo : _no_value

name	5430402E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71351 MGI:1918601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Obp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18249 MGI:1277949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546335 MGI:3648846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins

name	EG628991 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628991 MGI:3647231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC236874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	EG667658 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667658 MGI:3644124
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930480E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74910 MGI:1922160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	EG667672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667672 MGI:3644783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Prrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 3 Proteins

name	LOC667679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 21 Proteins pseudo : _no_value

name	LOC667684 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667684
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	4921509A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70864 MGI:1918114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 2 Proteins

name	LOC667700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG546337 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546337 MGI:3648845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 6 Proteins

name	EG629116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629116 MGI:3644407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 619 ESTs, 7 Proteins

name	LOC636082 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	EG667736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100041373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG636104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tbl1x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348182 GeneID:21372 MGI:1336172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin (beta)-like 1 X-linked transcript_id : NM_020601.2

name	EG628893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001674 GeneID:628893 MGI:3645962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG628893 transcript_id : XM_893693.1

name	Prkx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956079 GeneID:19108 MGI:1309999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, X-linked transcript_id : NM_016979.1

name	Pbsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369561 GeneID:54192 MGI:1860484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : probasin transcript_id : NM_017471.2

name	OTTMUSG00000017866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407583 GeneID:628923 MGI:3709306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein product : predicted gene, OTTMUSG00000017866 transcript_id : XM_486715.3

name	5430402E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352770 GeneID:71351 MGI:1918601
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430402E10 gene transcript_id : NM_027768.2

name	LOC628976 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271713 GeneID:628976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to odorant binding protein Ia transcript_id : XM_001476077.1

name	Obp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347493 GeneID:18249 MGI:1277949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : odorant binding protein Ia transcript_id : NM_008754.2

name	EG546335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407588 GeneID:546335 MGI:3648846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins product : predicted gene, EG546335 transcript_id : XM_621044.3

name	EG628991 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407589 GeneID:628991 MGI:3647231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : predicted gene, EG628991 transcript_id : XM_893814.2

name	LOC236874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271715 GeneID:236874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to odorant binding protein Ia transcript_id : XM_135951.6

name	4930480E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407594 GeneID:74910 MGI:1922160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : RIKEN cDNA 4930480E11 gene transcript_id : XM_135942.5

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271775 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 6 transcript_id : XM_900528.3

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271774 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 1 transcript_id : XM_621045.4

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271773 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 5 transcript_id : XM_900525.3

name	4921509A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407597 GeneID:70864 MGI:1918114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 2 Proteins product : RIKEN cDNA 4921509A18 gene transcript_id : XM_135940.5

name	EG546337 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271779 GeneID:546337 MGI:3648845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 3 Proteins product : predicted gene, EG546337, transcript variant 1 transcript_id : XM_621046.4

name	EG629116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271780 GeneID:629116 MGI:3644407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 619 ESTs, 7 Proteins product : predicted gene, EG629116 transcript_id : XM_893941.3

name	LOC636082 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271717 GeneID:636082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : hypothetical LOC636082 transcript_id : XM_001476250.1

name	EG667736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271782 GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG667736 transcript_id : XM_992119.2

name	LOC100041373 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271719 GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100041373 transcript_id : XM_001476267.1

name	EG636104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271721 GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG636104 transcript_id : XM_001476286.1

name	Tbl1x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468969 GeneID:21372 MGI:1336172
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : transducin (beta)-like 1 product : transducin (beta)-like 1 X-linked protein_id : NP_065626.1

name	EG628893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001675 GeneID:628893 MGI:3645962
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898786.1

name	Prkx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956080 CCDS:CCDS30248.1 GeneID:19108 MGI:1309999
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : putative serine/threonine kinase product : protein kinase, X-linked protein_id : NP_058675.1

name	Pbsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567372 CCDS:CCDS30249.1 GeneID:54192 MGI:1860484
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : probasin protein_id : NP_059499.1

name	OTTMUSG00000017866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772133 GeneID:628923 MGI:3709306
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486715.1

name	5430402E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001098 GeneID:71351 MGI:1918601
definition	GO_function : GO:0005549 - odorant binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein similar to odorant binding protein I f Obp1f product : hypothetical protein LOC71351 protein_id : NP_082044.1

name	LOC628976 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271714 GeneID:628976
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476127.1

name	Obp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27151739 CCDS:CCDS30251.1 GeneID:18249 MGI:1277949
definition	GO_function : GO:0005549 - odorant binding [Evidence IDA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : odorant-binding protein Ia product : odorant binding protein Ia protein_id : NP_032780.2

name	EG546335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746579 GeneID:546335 MGI:3648846
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621044.1

name	EG628991 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407590 GeneID:628991 MGI:3647231
definition	codon_start : 1 product : similar to odorant binding protein Ib protein_id : XP_898907.2

name	LOC236874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407592 GeneID:236874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_135951.5

name	4930480E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984424 GeneID:74910 MGI:1922160
definition	codon_start : 1 product : hypothetical protein LOC74910 protein_id : XP_135942.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746591 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 1 protein_id : XP_621045.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001561 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 5 protein_id : XP_905618.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001563 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 6 protein_id : XP_905621.1

name	4921509A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984438 GeneID:70864 MGI:1918114
definition	codon_start : 1 product : hypothetical protein LOC70864 protein_id : XP_135940.1

name	EG546337 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001566 GeneID:546337 MGI:3648845
definition	codon_start : 1 product : similar to conserved nuclear protein Nhn1 isoform 1 protein_id : XP_621046.2

name	EG629116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271781 GeneID:629116 MGI:3644407
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899034.2

name	LOC636082 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271718 GeneID:636082
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476300.1

name	EG667736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271783 GeneID:667736 MGI:3643055
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997213.2

name	LOC100041373 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271720 GeneID:100041373
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476317.1

name	EG636104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271722 GeneID:636104 MGI:3645063
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476336.1

name	EG667658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667658
definition	number : 1 pseudo : _no_value

name	EG667672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667672
definition	number : 1 pseudo : _no_value

name	LOC667684 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667684
definition	number : 2 pseudo : _no_value

name	LOC667684 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667684
definition	number : 1 pseudo : _no_value

name	LOC667700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667700
definition	number : 1 pseudo : _no_value

name	LOC667606 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271711 GeneID:667606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to ATP synthase gamma-subunit pseudo : _no_value transcript_id : XR_032530.1

name	LOC100042001 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271770 GeneID:100042001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein product : hypothetical protein LOC100042001 pseudo : _no_value transcript_id : XR_033262.1

name	LOC667679 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271776 GeneID:667679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 21 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_033334.1

clone name	MSMg01-440H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518L06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-426K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418C23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-331I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M06
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-332D19.T7 (MSMg01no332_d19.b1)	MSMg01-332D19.TJ (MSMg01no332_d19.g1)
ACC	AG448322	AG448323
length	1,289	1,282
length of high quality (start - end)	698 (131 - 828)	821 (94 - 914)
definition	CHROMAT_FILE: MSMg01no332_d19.b1 PHD_FILE: MSMg01no332_d19.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:18:28 2005	CHROMAT_FILE: MSMg01no332_d19.g1 PHD_FILE: MSMg01no332_d19.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:18:28 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NNNGGCGGCCATTGNNNNACATTGGCGCTAAGACTCCANAGGGAGAGGAT CCGCGGAATTCCCAGAGCAGAAGGAGCCTACAAAGTCACGTCAGATACAA TAGAATAATTACGCACACCTTGAACAACCGAAAAGCAGNCACACACAAAT GAAATCTATACAGCTGTTGTCCAGGGCTAAGGTTAGGAAAAATGGGAACA ACTGTTGTTTGTAGGGCTGCTGTAGGCTACTGAGATGTCTCCATCCTGGC CGACTGCAGGCAGTCCTTTATTTCAGATGGCAGGTCCTCTGGAGAAATGT GTCTCCTGCTTCTCAGGGTCCAAGATGCCATTACCATTCTTTCCTTTGTT TGCTGTGGTTGAGTTTTAAGGAGGGTAAGTAGAAGATATTTAAGGAGAAA GAGTCTTTTATGGCACAAAAACTGACTCTAGGTTTATAATAGCTTGTATT TTTTTCCTAAAATGTCACCTTATAAACATCTATAAGTTCGATTTCTTTTT CTTAGCTGTGGCCAGGCAGTCCCAACTTTTTGACTTGTTAGGGATGCTTG GGAAGCAGTTTGGTGCTTTCACATGTTTTCAGGGAAGATACCTTAGAGTT CAGGTTCCCCAGACTTTGTTTCCAGCCCTGAGACATGTAGGCAAGACAGC CTTCCAGACATAGGCTTCGAAATCCTAAGCCATTAGTACGGAAGGAATGA TCATCTTGGAAGGATTCCAGGATTATCAAGGCCTGGAGTACTGCTAAATT TACCATTTAAAACCAACCCCAACAGGAGCTTTCAAAGTGTCTATTTCATT GTTTTTATTTTTTAAACATGCTTCAACTATAGAAAAAGTCTTCTGCTGAA AATATTTCTTATATTTTGTTCTGGCTTGGTTGAAAAAAAAAAAAAATATA CAACCTTTAAATTTGTGAATTTTGTGAAGGTTCCTTTAAAAGTGGATTCC CTTGCTCCTGTGAAGGGTCAATGCCCTACAGGAAAGGGCCTTGAGGGAGG GAATGCCCGACACACAACCAGAATGGGGGGGTTGTGAACTAGGAAAGGAA AAAGAATAAAGNCCNNCNNNNNCNNNNNNTNNCNNNCNANATTCTCCNTT TTTCNTTTCTTCTTTTCAACTCCCNTTNCCTNTCTCTNTCCTTCANTNTT TCCTTNCTNCTTCTCCTCTCTTTNTCNNNNTTCTNTCTNNNAAANNANNN CTTTTNNNNNNNNTTNCTCTTNNTTTTCTTTNNCAATATNNTTTTCATTN ANTCCTAAATTTCNTTTACNANATATACTAAAATAATCA	NCCCAATCCATTNNNANCCGCATGGAXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXCCCTTAAGAAACCATCTCCAA TGGCTGAAAAGCACTTAAAGACATGTTCAAAGTCCTTAGTCATCAGGAAA ATGCAAATCAAAATGACCCTGAGATTCCACCTTACAACAATCAGAATGGC TAAGATCAAAAATGGAGATGAGAAGGAGAGAAATGAGGTCCAGGGACAGG CCCAAATTTGAATCTAGCTCAAGGGGAGGTCCAGTTGCCTGACACTGTTA CTGATGCTGTGGTGTGCTGCCCTCCAAGAGGCCCAACAAGCACCTGAAAG AGTCAGATGCTGATATTAGCACCCAGCCAATGGGCAAAAGCAGAAACTGA GACAGTCAGGATTTATTAGTGAGGTGGATTGTGGAACAGCATCTTTAAAG GTAAGCAGGGGAGAAGCATTGAGCCAAGAAAGCCAGAAGTCTGAGGTGTT GATTTGGTACTGAAAGGAAAGTTGGAAGAAAACTGGGCTTTCATGCTAGA ATATGAAATTTAGATTAATCTGAATCTGTTTTCCCTGGCCATAGTCACTT AAAATTACTCCAGAATAAACCTTTTCATATTCCCTCTTTTTACAATGATT TATCTATTTTTAATTTTCATGTAGATACACATTTTGCCTTTGTGTATGTA TGTGCAACATTTGCATGCCTGGCATCCTTAGTGGCAGAAGATCTTGGACC TCTGGAACTGGAGTTATGGGTGGTTGTGAGCCACTTTATGGGTTCTAGGA ATCAAACCCAGACTCTGGGCAAGAGGAGCCAGTGTTCCCAACTGTTGAGC CATTTCCCATTCCCCATTTTTTTCATGTAAGATTTGAATAGTATACCTGA ATTTATGTTAAAGAGATTTTTAATCATATCTTCTATATATTTGAAATATG ATTTTCCTTTTTTTCTGACTATATAATTATAGCCCGTAAATATTTTCTTG AATTTATTTTGTTAAAACCTTGATTTGGTAAATTTTAAAAACCCAGGATT AAATATATATATTTATATATATAATTNTTTTATATATAAATATTTTANTA TTAAAATTATTTTAATTATTAATATAATAATTNTACTCTCCCTATTACTC CCACACCCATCAAATATAAACACTTTTTATATAAAAATTTCCTTCTTTTT CTCATCACACAAAAACAAATTTTTCTCGTCACAGTAGTTCTCTCCANATA TAATAATACACCACCCATCTAATTATTTTCCC
quality values	Open. Hide. 0 0 0 3 6 6 6 8 8 7 9 9 11 3 0 0 0 0 3 6 6 6 8 6 8 10 8 8 6 6 8 8 8 10 8 8 8 3 0 3 9 19 19 20 24 24 28 31 31 33 33 37 41 30 30 28 26 19 19 11 11 10 21 19 31 31 33 33 37 33 33 33 21 19 9 9 9 13 12 12 12 9 9 9 8 8 8 8 8 8 10 13 27 27 42 50 50 44 44 53 53 53 53 38 38 36 53 41 41 37 37 37 37 27 27 11 11 11 16 16 12 11 11 12 15 15 22 22 12 12 12 15 22 30 59 29 29 3 0 3 29 29 59 59 59 59 50 50 50 53 53 57 57 57 48 48 48 48 44 44 47 47 47 50 50 50 50 50 68 53 50 50 57 54 53 51 51 51 51 51 68 68 68 68 68 68 68 68 57 59 59 57 57 57 59 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 57 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 68 68 57 57 57 68 68 68 68 68 68 59 59 59 59 57 57 59 59 59 59 68 68 68 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 43 38 32 14 14 14 18 32 43 62 62 62 62 68 68 68 68 68 59 59 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 59 59 68 68 59 59 59 59 57 57 52 57 57 59 59 57 57 57 59 59 59 59 68 68 68 68 68 68 59 59 59 59 59 59 59 59 68 59 59 59 57 57 54 57 57 57 57 57 57 59 59 57 57 50 50 43 43 43 59 57 57 57 59 59 48 48 48 59 59 59 59 54 47 59 57 57 57 59 59 68 68 68 59 59 57 57 57 59 57 57 57 57 57 57 57 43 43 43 57 57 57 57 57 46 46 43 43 43 47 47 54 59 59 68 59 59 46 57 47 59 48 48 48 48 47 47 48 48 48 59 47 43 39 39 43 43 48 32 32 20 24 24 37 37 25 23 11 11 11 21 21 33 37 39 39 34 34 28 37 37 34 36 25 25 18 26 26 34 34 48 43 43 39 43 39 39 39 39 39 37 30 30 17 17 17 30 30 39 28 31 20 23 23 34 34 31 31 23 28 32 39 39 30 39 37 32 28 18 18 13 15 15 28 21 28 28 34 32 32 20 20 20 32 32 41 41 41 34 34 34 32 24 22 28 24 27 19 28 31 32 31 33 27 30 25 23 22 28 37 37 37 37 39 33 33 30 37 37 36 29 27 29 26 28 28 28 28 32 37 32 30 28 32 22 23 23 30 32 30 33 32 31 29 29 22 31 22 22 22 19 20 20 32 32 40 40 39 39 40 41 32 32 41 39 34 31 35 36 39 39 37 31 39 27 27 24 24 24 32 24 30 14 14 14 28 28 29 29 30 30 30 37 34 34 25 20 12 22 11 11 11 12 12 22 15 28 28 37 31 31 18 21 12 13 12 19 12 13 13 20 20 39 39 22 19 17 19 16 19 37 37 36 39 34 32 20 12 12 11 16 16 23 12 12 11 23 19 19 13 11 11 11 13 12 15 14 17 17 25 25 29 18 18 11 11 11 12 12 20 12 12 12 11 11 11 11 19 17 24 22 11 11 8 8 6 8 6 6 6 6 6 6 6 8 9 9 15 15 12 12 12 12 15 11 11 8 15 9 10 10 10 11 15 10 10 11 15 15 9 8 8 8 13 10 11 15 14 10 10 8 8 8 8 12 11 11 11 10 11 9 10 8 8 8 8 9 9 10 8 8 8 8 9 7 7 7 9 10 8 9 9 8 8 8 8 10 8 8 8 8 8 8 10 9 11 9 9 8 8 10 8 8 8 8 9 10 9 9 7 7 7 7 8 8 7 9 9 12 21 21 10 11 10 10 8 8 9 9 8 9 15 12 11 13 10 10 9 10 12 10 10 10 10 10 10 9 9 8 8 7 7 6 6 9 9 9 8 8 8 8 10 13 13 10 9 9 9 9 6 7 6 6 8 11 13 9 6 6 6 7 7 9 9 8 8 8 9 9 9 9 9 9 3 0 3 3 0 0 3 0 0 0 0 0 3 0 0 0 0 0 0 3 0 0 3 0 0 0 3 0 3 0 3 18 8 10 10 10 3 0 3 8 6 7 14 3 0 3 10 10 10 9 10 8 8 6 6 6 7 7 6 8 8 7 8 3 0 3 3 0 3 6 3 0 3 10 10 10 3 0 3 17 19 8 8 6 3 0 3 0 3 6 8 8 14 21 3 0 3 3 0 3 8 8 8 8 6 6 6 6 8 9 7 7 3 0 3 3 0 0 0 0 3 6 6 3 0 3 12 3 0 0 0 3 7 3 0 0 3 0 0 0 3 27 27 27 3 0 0 0 0 0 0 0 0 3 3 0 3 8 8 8 3 0 0 3 7 7 6 6 6 8 3 0 0 3 10 10 13 18 3 0 0 3 7 6 6 6 8 14 3 0 3 0 3 7 7 9 9 9 9 9 7 7 3 0 3 6 8 6 3 0 3 0 3 6 6 8 8 6 6 6 8 8 11 11 11 9 12 9 9	Open. Hide. 0 3 7 6 6 6 6 6 6 7 7 3 0 0 0 3 0 3 6 6 6 6 7 7 6 8 3 0 3 6 6 6 7 16 9 9 6 6 6 6 8 7 8 12 11 17 8 9 9 21 19 19 12 14 19 28 33 32 32 33 37 37 35 35 35 35 36 36 36 44 44 39 37 42 47 23 21 9 9 7 8 8 8 8 6 6 6 6 6 8 9 9 9 19 21 33 33 33 31 31 31 36 36 36 38 50 50 53 57 59 59 41 41 31 31 31 30 23 22 11 11 12 16 18 13 13 19 19 23 28 28 28 28 28 29 25 24 14 19 25 42 43 53 53 53 50 59 57 57 57 59 59 59 59 57 57 57 57 57 57 57 53 50 50 68 50 50 48 50 48 48 47 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 57 57 42 42 35 44 44 57 57 57 57 57 57 54 54 57 57 57 68 68 68 68 68 57 57 57 57 59 59 59 59 59 59 68 68 68 68 68 68 59 59 68 68 59 59 59 59 59 57 57 57 57 57 57 68 68 68 68 57 59 59 59 59 59 59 68 59 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 68 68 59 59 59 59 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 57 57 57 57 57 54 54 57 57 57 57 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 57 57 57 57 57 57 57 54 59 54 57 57 57 59 54 59 59 68 68 68 59 59 57 57 48 57 43 44 43 48 43 44 43 48 48 48 48 53 48 48 48 42 42 42 28 27 18 11 11 11 11 14 22 30 34 50 50 50 50 50 50 57 57 57 59 59 57 57 57 57 57 57 47 59 43 48 48 59 59 68 68 68 68 68 59 68 68 68 68 68 59 59 48 48 48 48 48 48 48 48 57 57 57 57 57 46 43 44 44 57 57 57 57 57 59 57 57 54 57 57 57 57 48 48 57 57 57 57 57 68 57 57 57 57 57 57 57 57 59 59 59 54 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 54 54 59 59 59 59 59 59 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 54 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 68 59 59 59 59 57 57 57 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 57 44 48 37 44 44 57 57 57 59 59 68 68 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 48 46 43 47 47 47 36 36 34 44 41 37 31 39 32 32 26 23 30 30 37 37 39 43 31 31 32 37 37 41 37 37 29 29 31 32 39 39 36 36 32 36 36 41 41 41 41 39 37 32 28 28 28 28 30 37 39 39 40 40 40 46 48 37 37 37 37 37 39 43 27 27 14 18 19 30 30 41 37 37 39 30 22 22 28 23 20 25 24 24 23 29 26 37 30 23 30 32 39 43 32 34 22 19 19 15 15 15 21 25 17 16 16 24 25 30 30 20 19 18 23 25 27 25 24 29 30 30 25 27 37 34 34 30 39 37 35 35 39 32 31 31 35 28 32 39 37 37 37 44 37 37 41 34 34 28 30 32 16 16 11 19 19 34 30 30 15 17 11 11 11 13 21 22 31 31 37 25 22 22 22 26 27 36 36 39 37 26 19 23 11 11 9 12 12 21 14 19 16 16 17 15 30 30 28 30 32 34 37 25 25 12 12 12 18 16 24 20 10 10 10 20 21 25 8 8 8 11 11 13 14 14 14 9 11 15 12 9 9 11 23 11 11 11 9 9 9 13 12 12 15 15 19 24 28 18 16 13 13 10 13 9 11 10 8 8 8 8 8 8 8 11 12 9 9 9 12 13 12 9 8 8 10 10 14 25 22 18 10 8 8 8 8 10 9 12 9 10 18 12 15 10 12 11 15 12 9 10 13 10 9 8 9 9 9 13 21 19 17 14 9 10 9 10 10 10 10 10 13 22 16 12 13 15 15 10 9 8 12 12 8 8 8 15 15 12 8 8 8 8 8 6 6 8 3 0 3 11 11 10 10 13 13 11 8 8 8 12 10 8 6 6 8 8 6 3 0 3 8 8 8 19 10 10 10 10 8 7 7 7 12 9 9 9 11 10 6 8 8 8 8 8 12 11 9 9 9 9 9 9 3 0 3 10 10 10 10 9 8 8 6 6 8 10 8 8 8 10 10 9 9 8 11 10 8 8 8 9 9 9 9 16 12 11 11 10 8 8 6 6 6 6 8 17 17 15 13 13 8 7 7 6 14 8 8 6 6 6 10 10 10 10 9 9 10 10 12 12 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 6 6 8 6 8 8 8 9 10 10 10 10 10 7 8 8 6 6 8 8 10 10 9 8 8 8 8 8 8 8 3 0 3 8 10 9 8 10 10 12 6 6 6 6 10 8 9 9 8 8 6 6 8 8 8 8 8 8 12 23 15 10 10 12 11 11 11

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no332_d19.g1 MSMg01no332_d19.g1 CHROMAT_FILE:
MSMg01no332_d19.g1 PHD_FILE: MSMg01no332_d19.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:18:28 2005
         (821 letters)



>mm_chrX_75841284_75842509
          Length = 1226

 Score = 1497 bits (774), Expect = 0.0
 Identities = 811/826 (98%), Gaps = 5/826 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   tctccaatggctgaaaagcacttaaagacatgttcaaagtccttagtcatcaggaaaatg 60
           |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||
Sbjct: 939 tctccaatggctgaaaagcacttaaagagatgttcaaagtctttagtcatcaggaaaatg 880

                                                                       
Query: 61  caaatcaaaatgaccctgagattccaccttacaacaatcagaatggctaagatcaaaaat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 879 caaatcaaaatgaccctgagattccaccttacaacaatcagaatggctaagatcaaaaat 820

                                                                       
Query: 121 ggagatgagaaggagagaaatgaggtccagggacaggcccaaatttgaatctagctcaag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 819 ggagatgagaaggagagaaatgaggtccagggacaggcccaaatttgaatctagctcaag 760

                                                                       
Query: 181 gggaggtccagttgcctgacactgttactgatgctgtggtgtgctgccctccaagaggcc 240
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759 gggaggtccagtggcctgacactgttactgatgctgtggtgtgctgccctccaagaggcc 700

                                                                       
Query: 241 caacaagcacctgaaagagtcagatgctgatattagcacccagccaatgggcaaaagcag 300
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 699 caaaaagcacctgaaagagtcagatgctgatattagcacccagccaatgggcaaaagcag 640

                                                                       
Query: 301 aaactgagacagtcaggatttattagtgaggtg-----gattgtggaacagcatctttaa 355
           ||||||||||||||||||||||  |||||||||     ||||||||||||||||||||||
Sbjct: 639 aaactgagacagtcaggatttaagagtgaggtggagttgattgtggaacagcatctttaa 580

                                                                       
Query: 356 aggtaagcaggggagaagcattgagccaagaaagccagaagtctgaggtgttgatttggt 415
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 579 aggtaagcaggggagaagcattgagccaagaaagccagaagtctgaggtgttgatttggt 520

                                                                       
Query: 416 actgaaaggaaagttggaagaaaactgggctttcatgctagaatatgaaatttagattaa 475
           ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 519 actgaaaggaaagttggaagaaaactgggctttcatgctagaatatggattttagattaa 460

                                                                       
Query: 476 tctgaatctgttttccctggccatagtcacttaaaattactccagaataaaccttttcat 535
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 459 tctgaatctcttttccctggccatagtcacttaaaattactccagaataaaccttttcat 400

                                                                       
Query: 536 attccctctttttacaatgatttatctatttttaattttcatgtagatacacattttgcc 595
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 399 attccctctttttacaatgatttatctatttttaattttcatgtagatacacattttgcc 340

                                                                       
Query: 596 tttgtgtatgtatgtgcaacatttgcatgcctggcatccttagtggcagaagatcttgga 655
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 339 tttgtgtatgtatgtgcaacatttgcatgcctggcatccttagtggcagaagatcttgga 280

                                                                       
Query: 656 cctctggaactggagttatgggtggttgtgagccactttatgggttctaggaatcaaacc 715
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 279 cctctggaactggagttatgggtggttgtgagccactttatgggttctaggaatcaaacc 220

                                                                       
Query: 716 cagactctgggcaagaggagccagtgttcccaactgttgagccatttcccattccccatt 775
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 cagactctgggcaagagcagccagtgttcccaactgttgagccatttcccattccccatt 160

                                                         
Query: 776 tttttcatgtaagatttgaatagtatacctgaatttatgttaaaga 821
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 159 tttttcatgtaagatttgaatagtatacctgaatttatgttaaaga 114


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 36
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 821
Length of database: 1226
Length adjustment: 10
Effective length of query: 811
Effective length of database: 1216
Effective search space:   986176
Effective search space used:   986176
X1: 9 (17.8 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 9 (18.3 bits)
S2: 9 (18.1 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information