MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-371O05
Chromosome	X (Build37)
Map Location	92,273,035 - 92,273,502
singlet/doublet	singlet
Overlap gene	Arhgef9
Upstream gene	Zfx, Eif2s3x, Klhl15, LOC385495, LOC670263, LOC100042098, LOC631145, 0610008C08Rik, EG668148, Maged1, LOC668150, EG385499, EG668156, Gspt2, LOC385500, Zxdb, LOC631331, EG631319, Zxda, Gm371, 9630042H07Rik
Downstream gene	LOC619688, LOC100042189, 2810002O09Rik, Asb12, LOC668202, AK129302, A130028J20Rik, 1700010D01Rik, Las1l
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22764 MGI:99211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eif2s3x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26905 MGI:1349431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC385495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins pseudo : _no_value

name	LOC670263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC631145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	0610008C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68316 MGI:1915566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668148 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668148 MGI:3647163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Maged1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94275 MGI:1930187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG385499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385499 MGI:3645347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins

name	EG668156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668156 MGI:3643998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	Gspt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14853 MGI:1316727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Zxdb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668166 MGI:3694898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	EG631319 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631319 MGI:3648527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	Zxda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668171 MGI:1921689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Gm371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236914 MGI:2685217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	9630042H07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270624 MGI:2444925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236915 MGI:2442233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042189 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2810002O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70392 MGI:1917642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668202 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	AK129302 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245522 MGI:2679294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130028J20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547176 MGI:2442133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700010D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76386 MGI:1923636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Las1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76130 MGI:1923380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205060 GeneID:22764 MGI:99211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein X-linked transcript_id : NM_011768.2

name	Zfx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205066 GeneID:22764 MGI:99211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein X-linked transcript_id : NM_001044386.1

name	Eif2s3x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129962 GeneID:26905 MGI:1349431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked transcript_id : NM_012010.3

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794654 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039061.1

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794652 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039060.1

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794639 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_153165.2

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794642 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039059.1

name	LOC631145 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271777 GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Putative uncharacterized protein CXorf58 transcript_id : XM_001477581.1

name	0610008C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368551 GeneID:68316 MGI:1915566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610008C08 gene transcript_id : NM_026673.2

name	Maged1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130592 GeneID:94275 MGI:1930187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family D, 1 transcript_id : NM_019791.2

name	EG385499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407669 GeneID:385499 MGI:3645347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins product : predicted gene, EG385499 transcript_id : XM_358254.4

name	Gspt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331155 GeneID:14853 MGI:1316727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G1 to S phase transition 2 transcript_id : NM_008179.2

name	Zxdb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490364 GeneID:668166 MGI:3694898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, X-linked, duplicated B transcript_id : NM_001081473.1

name	EG631319 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407672 GeneID:631319 MGI:3648527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : predicted gene, EG631319 transcript_id : XM_994723.1

name	Gm371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83002976 GeneID:236914 MGI:2685217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : gene model 371, (NCBI) transcript_id : XM_141955.3

name	9630042H07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364187 GeneID:270624 MGI:2444925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630042H07 gene transcript_id : NM_178753.3

name	Arhgef9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384851 GeneID:236915 MGI:2442233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc42 guanine nucleotide exchange factor (GEF) 9 transcript_id : NM_001033329.2

name	2810002O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123858769 GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810002O09 gene transcript_id : NM_175179.3

name	Asb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370473 GeneID:70392 MGI:1917642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 12 transcript_id : NM_080858.2

name	LOC668202 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271785 GeneID:668202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Predicted gene, EG546347 transcript_id : XM_001477719.1

name	AK129302 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491857 GeneID:245522 MGI:2679294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AK129302 transcript_id : NM_001003916.1

name	A130028J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347403 GeneID:547176 MGI:2442133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130028J20 gene transcript_id : NM_001034907.2

name	1700010D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364117 GeneID:76386 MGI:1923636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700010D01 gene transcript_id : NM_029590.2

name	Las1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71979674 GeneID:76130 MGI:1923380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LAS1-like (S. cerevisiae) transcript_id : NM_152822.2

name	Zfx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205067 GeneID:22764 MGI:99211
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein X-linked 5; zinc finger protein X-linked 6; X-linked zinc finger protein product : zinc finger protein X-linked protein_id : NP_001037851.1

name	Zfx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205061 CCDS:CCDS30276.1 GeneID:22764 MGI:99211
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein X-linked 5; zinc finger protein X-linked 6; X-linked zinc finger protein product : zinc finger protein X-linked protein_id : NP_035898.2

name	Eif2s3x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753738 CCDS:CCDS30277.1 GeneID:26905 MGI:1349431
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0045946 - positive regulation of translation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked protein_id : NP_036140.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794655 CCDS:CCDS30278.1 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : kelch-like 15 isoform a protein_id : NP_001034150.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794643 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3 product : kelch-like 15 isoform c protein_id : NP_001034148.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346619 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 4 product : kelch-like 15 isoform c protein_id : NP_694805.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794653 CCDS:CCDS30279.1 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : kelch-like 15 isoform b protein_id : NP_001034149.1

name	LOC631145 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271778 GeneID:631145
definition	codon_start : 1 product : similar to Putative uncharacterized protein CXorf58 protein_id : XP_001477631.1

name	0610008C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311967 GeneID:68316 MGI:1915566
definition	codon_start : 1 note : Novel transmembrane domain containing protein product : hypothetical protein LOC68316 protein_id : NP_080949.1

name	Maged1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789935 CCDS:CCDS30280.1 GeneID:94275 MGI:1930187
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : melanoma antigen family D, 1 protein_id : NP_062765.1

name	EG385499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772187 GeneID:385499 MGI:3645347
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358254.2

name	Gspt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331156 GeneID:14853 MGI:1316727
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : G1 to phase transition 2 protein_id : NP_032205.2

name	Zxdb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490365 GeneID:668166 MGI:3694898
definition	codon_start : 1 product : zinc finger, X-linked, duplicated B protein_id : NP_001074942.1

name	EG631319 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407673 GeneID:631319 MGI:3648527
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999817.1

name	Gm371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83002977 GeneID:236914 MGI:2685217
definition	codon_start : 1 product : similar to GMCL2 protein_id : XP_141955.3

name	9630042H07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520207 CCDS:CCDS30282.1 GeneID:270624 MGI:2444925
definition	codon_start : 1 note : novel Spin/Ssty repeat containing protein product : hypothetical protein LOC270624 protein_id : NP_848868.1

name	Arhgef9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370312 GeneID:236915 MGI:2442233
definition	GO_component : GO:0005938 - cell cortex [Evidence TAS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence TAS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence TAS] codon_start : 1 note : Cdc42 guanine exchange factor 9; collybistin product : Cdc42 guanine nucleotide exchange factor (GEF) 9 protein_id : NP_001028501.1

name	2810002O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123858770 GeneID:72345 MGI:1919595
definition	codon_start : 1 product : RIKEN cDNA 2810002O09 protein_id : NP_780388.2

name	Asb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270029 CCDS:CCDS30283.1 GeneID:70392 MGI:1917642
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : ankyrin repeat domain-containing SOCS box protein 12 protein_id : NP_543134.1

name	LOC668202 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271786 GeneID:668202
definition	codon_start : 1 product : similar to Predicted gene, EG546347 protein_id : XP_001477769.1

name	AK129302 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491858 CCDS:CCDS30284.1 GeneID:245522 MGI:2679294
definition	codon_start : 1 product : hepatocellular carcinoma-associated antigen 127 protein_id : NP_001003916.1

name	1700010D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729782 GeneID:76386 MGI:1923636
definition	codon_start : 1 product : hypothetical protein LOC76386 protein_id : NP_083866.1

name	A130028J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347404 GeneID:547176 MGI:2442133
definition	codon_start : 1 product : hypothetical protein LOC547176 protein_id : NP_001030079.2

name	Las1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71979675 CCDS:CCDS30287.1 GeneID:76130 MGI:1923380
definition	codon_start : 1 product : LAS1-like protein_id : NP_690035.2

name	LOC385495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385495
definition	number : 1 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 3 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 2 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 1 pseudo : _no_value

name	LOC100042098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042098
definition	number : 1 pseudo : _no_value

name	EG668148 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668148
definition	number : 2 pseudo : _no_value

name	EG668148 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668148
definition	number : 1 pseudo : _no_value

name	LOC668150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668150
definition	number : 2 pseudo : _no_value

name	LOC668150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668150
definition	number : 1 pseudo : _no_value

name	LOC385500 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385500
definition	number : 2 pseudo : _no_value

name	LOC385500 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385500
definition	number : 1 pseudo : _no_value

name	LOC631331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631331
definition	number : 2 pseudo : _no_value

name	LOC631331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631331
definition	number : 1 pseudo : _no_value

name	LOC619688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619688
definition	number : 1 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 2 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 1 pseudo : _no_value

name	EG668156 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407670 GeneID:668156 MGI:3643998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : predicted gene, EG668156 pseudo : _no_value transcript_id : XR_002150.1

name	Zxda (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:125628683 GeneID:668171 MGI:1921689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, X-linked, duplicated A pseudo : _no_value transcript_id : NR_003292.1

clone name	MSMg01-517A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385P18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-355E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315F21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-371O05.T7 (MSMg01no371_o05.b1)	MSMg01-371O05.TJ (MSMg01no371_o05.g1)
ACC	AG478284	AG478285
length	771	761
length of high quality (start - end)	408 (74 - 481)	560 (42 - 601)
definition	CHROMAT_FILE: MSMg01no371_o05.b1 PHD_FILE: MSMg01no371_o05.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:10:30 2005	CHROMAT_FILE: MSMg01no371_o05.g1 PHD_FILE: MSMg01no371_o05.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:10:30 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	ATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXCTGAGTTGGGGGCTAGCCTGGTTTACA GAGTGAGTCCAAGGACAGTCTGGAATATACACAGAATGAGTCCCAGGACA GTCAGGGATATACACAGAGAAAGCCAGTCAGGAGTAACTCAAAAAAAAAA AAACATAAAATTTTAGGGTCATTTTTTGGTTCTTATGTATTTATTTGTAG AATTTTAGGAGGGTTTTTTTGTTTGTTTGTTTGATTTTTTCGAGAAAGTG TTTCTCTGTGTAACCCTGGCTGTCTTGTAACTCACTCTGTAGACCAGGCT GGCTTCAAACTCAGAAACTTGCCTGCCTCTGGCCACCAAGTGCTGGTATT AAAGGTGTGTGCCACCAGCACCCAGCTTAAGGGTTTTTTAAACAGGGCTT TGTATGGTTTTTAGAAGAGTGTTTTAGTGGGGTTTCTGTTTTTGCCCTTT TGTTTTTTTTGTATTCTCGTGTTGTCTTTTTTTGGCGGCCTTTTCTTTTG GTTATTATTCACTTATCTTTCGCCTCCTTCTCTTTTTCTTCTATGCCTCT TTTTTCCCTCTTTTTTTCTGTTTTCCTTACCTTTTTTTTTCTTTATTCTT TTCACCCTTTACCTTTTTTTGCTTTATCCGTTTTCTTCTAATCCACTTTT ATCTCCTGGCTTTCTGGTTGTTTTTTCATCCTCAATACCTTACTTATCTC ATTCTCATTTTTTTACTTCTN	TXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTTCGAGAATCCGCGGAATT CTATGGGAGTATATCCTGTATTACAGCTATCACAAGAGAAATGCTTAATA CTTAAGTACTTAATCTTATGAATTAAGAGTAAAATAATATGTATGGATGA GTGCATTTATTTATTAAACCCATCAATAAATTCTGCCAAAATCTCCCCAT TTTCTGCATGAGAAAATTGAATCAAGTGCGAGTGATACTTGCTGAAGACA ACACTGCTAGTTAGTGATAAAACTGGGTGTGAACTCAAGAGTCTGGCTTC AAATTATGTGTTCTCATGCATTATCCTATACTGATCTCCTCATTGTACCA GAAGAAAAATATCACTGTTATTCCATGGTGACCACAGTGACGCCTTAGAA ATGCAGATAGAAGAGATGACTAGGATGTCTGGACTATACTATGTATAATG CTTCTGTCTTGTTCCTTGGCTGGTTTTATCAGGTAAAACACAAATAGAGA GCTATAAAATTTGAAGAGATCTATTCCCTTTGAAAAGAGTTTACAGGAAG GATATCTACGAGGCTGGTATGGTTTTTGTATGAACATAAGTCACATAGTC ATCTAAAAATTAGACTGGAAATTACTATCTGATAATCCGGACTCTTACTA AGGAGGAATATTATATTGGATCTAGAAGTGGTTTATTGCACTTTGGGTCA TTTCCATTTCACTCTATTTCTTCTCGTGGATTAAGAAATGTTGCTTTCTT TTTGTTTTCAT
quality values	Open. Hide. 12 15 11 11 10 8 8 8 9 9 15 15 36 35 44 39 39 41 41 39 39 39 39 39 44 59 44 47 33 24 11 9 12 12 11 11 11 19 19 30 28 47 39 59 59 47 47 50 47 47 50 53 57 57 57 57 57 34 26 15 21 10 10 10 17 23 19 13 28 28 33 41 41 57 57 54 54 54 68 68 68 68 68 68 68 68 68 59 59 57 57 59 59 59 68 57 57 57 57 57 57 57 68 68 68 57 57 57 57 57 57 50 50 50 50 50 50 57 57 57 59 59 50 50 50 50 50 51 57 68 68 68 68 50 50 51 51 68 68 57 57 57 57 57 57 57 57 68 68 57 57 57 57 57 57 46 46 46 46 57 57 57 57 57 57 57 57 57 68 68 68 57 57 57 57 57 59 57 57 57 57 57 68 68 57 57 57 57 57 57 52 57 59 68 68 68 68 68 68 59 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 54 54 54 57 57 68 57 59 57 57 57 57 52 54 57 57 57 57 57 57 57 57 57 57 68 57 57 57 57 54 57 54 54 54 57 57 68 57 59 59 57 57 59 59 59 68 68 68 68 59 68 59 59 57 59 57 59 57 59 54 59 54 59 57 57 57 57 57 68 57 59 57 57 54 57 57 59 59 59 59 43 43 43 48 48 57 57 57 57 59 57 59 48 48 48 57 48 50 48 48 48 34 34 18 23 12 14 9 8 8 8 8 10 22 34 41 59 47 48 48 48 43 59 39 42 42 47 47 57 59 59 48 48 59 57 57 57 57 57 57 57 57 57 48 48 43 43 32 40 40 48 48 57 48 59 43 47 47 48 48 54 48 47 57 57 48 48 48 57 57 54 54 54 54 54 59 59 44 36 28 28 37 44 57 57 59 59 54 54 57 57 54 57 57 59 59 54 48 57 47 57 43 47 47 59 57 54 48 57 47 57 43 57 57 57 57 57 57 57 57 48 46 41 41 42 42 42 42 43 41 41 41 59 43 40 28 28 28 30 28 23 23 37 32 32 28 28 21 28 15 20 23 24 28 37 37 33 30 28 22 22 18 21 17 12 9 9 9 8 8 8 8 8 8 10 21 13 10 8 10 11 13 15 11 8 8 8 9 8 10 8 8 8 8 8 8 8 8 8 10 8 8 8 9 10 9 10 10 11 10 12 11 11 11 11 8 10 10 10 9 10 13 21 19 16 10 9 9 9 9 10 8 8 8 8 8 10 10 10 10 8 8 8 9 9 8 8 7 7 8 10 8 8 8 8 8 21 16 19 10 8 8 10 10 10 11 13 12 13 14 13 11 10 10 8 6 6 8 8 10 8 8 8 11 19 30 26 19 10 8 8 8 8 8 10 12 24 19 21 12 10 9 9 9 15 15 11 10 8 15 6 6 8 8 10 19 19 22 23 19 22 12 12 12 8 8 12 12 19 15 8 10 8 11 8 8 8 8 9 9 10 10 9 9 9 12 12 13 15 15 8 8 8 8 9 8 8 9 8 8 8 10 8 10 9 14 9 9 9 9 9 8 9 9 9 8 8 8 8 8 8 8 6 6 8 8 10 8 8 10 8 8 8 8 8 8 8 6 6 6 6 9 9 9 10 10 13 17 10 8 8 8 8 8 8 8 8 8 7 6 8 8 9 9 8 8 8 8 8 8 15 10 10 10 8 8 8 8 8 8 20 23 15 16 12 14 9 9 11 8 8 8 3 0	Open. Hide. 8 8 8 8 12 30 27 29 27 24 22 12 19 9 9 9 17 15 37 37 48 30 28 26 26 22 24 25 25 9 9 9 16 9 9 7 10 8 9 9 12 14 25 27 37 30 30 31 31 50 50 50 50 42 41 33 22 9 9 9 10 8 9 12 15 19 23 30 30 30 39 33 35 32 36 36 36 57 53 53 53 53 53 53 53 53 59 59 42 42 40 40 40 42 57 68 68 68 68 68 68 68 68 68 68 68 57 54 54 68 68 57 57 57 57 57 57 57 68 57 57 57 57 57 46 57 57 57 68 68 68 68 68 68 68 68 68 51 51 51 68 68 68 68 50 50 50 50 50 50 68 68 51 50 50 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 38 38 31 31 31 35 44 44 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 44 44 44 54 57 57 57 68 68 68 68 68 68 59 59 59 59 59 59 57 57 44 57 57 57 57 57 57 57 48 47 59 48 48 48 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 57 59 59 57 57 48 59 48 48 48 48 59 59 59 48 48 46 46 46 47 44 44 44 41 32 37 37 37 37 37 39 39 43 43 48 53 47 59 46 46 46 43 43 39 40 35 39 43 47 47 48 48 48 54 48 48 48 48 48 48 59 59 59 59 41 41 34 36 30 39 39 43 43 48 48 46 46 46 47 47 37 37 32 35 35 33 28 28 24 28 28 37 37 41 41 41 39 36 31 21 15 11 11 14 27 30 39 39 28 34 28 22 22 34 28 30 29 32 37 37 30 31 37 37 25 21 12 10 10 10 13 25 31 24 28 22 19 19 13 18 18 18 19 23 28 30 25 14 14 11 12 12 16 13 11 9 9 8 9 8 8 8 8 8 14 16 20 20 32 32 33 31 28 23 23 21 26 14 14 14 23 18 10 8 8 8 8 10 8 8 8 15 15 25 24 29 19 20 19 11 11 12 10 12 9 6 6 6 7 6 6 6 8 7 8 8 10 10 9 12 9 9 9 12 10 10 9 12 16 16 14 12 11 10 10 8 8 8 8 8 8 10 11 14 10 9 8 8 8 8 8 8 8 8 12 12 16 12 10 8 8 8 8 8 11 9 8 8 8 8 8 13 12 10 10 9 6 6 10 8 8 8 9 9 9 8 8 8 8 8 8 8 8 9 10 10 9 8 8 8 8 10 8 8 8 8 9 9 11 12 12

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no371_o05.g1 MSMg01no371_o05.g1 CHROMAT_FILE:
MSMg01no371_o05.g1 PHD_FILE: MSMg01no371_o05.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:10:30 2005
         (560 letters)



>mm_chrX_92272543_92273502
          Length = 960

 Score =  897 bits (464), Expect = 0.0
 Identities = 467/468 (99%)
 Strand = Plus / Minus

                                                                       
Query: 93  ataatatgtatggatgagtgcatttatttattaaacccatcaataaattctgccaaaatc 152
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 960 ataatatgtatggatgagtgcatttatttattaaacccatcaataaattctgccaaaatc 901

                                                                       
Query: 153 tccccattttctgcatgagaaaattgaatcaagtgcgagtgatacttgctgaagacaaca 212
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 900 tccccattttctgcatgagaaaattgaatcaagtgcgagtgatacttgctgaagacaaca 841

                                                                       
Query: 213 ctgctagttagtgataaaactgggtgtgaactcaagagtctggcttcaaattatgtgttc 272
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 840 ctgctagttagtgataaaactgggtgtgaactcaagagtctggcttcaaattatgtgttc 781

                                                                       
Query: 273 tcatgcattatcctatactgatctcctcattgtaccagaagaaaaatatcactgttattc 332
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 780 tcatgcattatcctatactgatctcctcattgtaccagaagaaaaatatcactattattc 721

                                                                       
Query: 333 catggtgaccacagtgacgccttagaaatgcagatagaagagatgactaggatgtctgga 392
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 720 catggtgaccacagtgacgccttagaaatgcagatagaagagatgactaggatgtctgga 661

                                                                       
Query: 393 ctatactatgtataatgcttctgtcttgttccttggctggttttatcaggtaaaacacaa 452
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 660 ctatactatgtataatgcttctgtcttgttccttggctggttttatcaggtaaaacacaa 601

                                                                       
Query: 453 atagagagctataaaatttgaagagatctattccctttgaaaagagtttacaggaaggat 512
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 600 atagagagctataaaatttgaagagatctattccctttgaaaagagtttacaggaaggat 541

                                                           
Query: 513 atctacgaggctggtatggtttttgtatgaacataagtcacatagtca 560
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 540 atctacgaggctggtatggtttttgtatgaacataagtcacatagtca 493


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 22
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 560
Length of database: 960
Length adjustment: 10
Effective length of query: 550
Effective length of database: 950
Effective search space:   522500
Effective search space used:   522500
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information