MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-388O17
Chromosome	X (Build37)
Map Location	91,642,838 - 91,643,312
singlet/doublet	singlet
Overlap gene	0610008C08Rik
Upstream gene	Pola1, EG629581, Pcyt1b, Pdk3, EG668103, LOC100042041, AU015836, EG245516, LOC100042062, EG629591, Zfx, Eif2s3x, Klhl15, LOC385495, LOC670263, LOC100042098, LOC631145
Downstream gene	EG668148, Maged1, LOC668150, EG385499, EG668156, Gspt2, LOC385500, Zxdb, LOC631331, EG631319, Zxda, Gm371, 9630042H07Rik, Arhgef9, LOC619688, LOC100042189, 2810002O09Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pola1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18968 MGI:99660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629581 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629581 MGI:3644316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Pcyt1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236900 MGI:2384308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668103 MGI:3645971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100042041 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	AU015836 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385493 MGI:2147954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 3 Proteins

name	EG245516 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245516 MGI:3643282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG629591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629591 MGI:3647485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Zfx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22764 MGI:99211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eif2s3x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26905 MGI:1349431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC385495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins pseudo : _no_value

name	LOC670263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC631145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	0610008C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68316 MGI:1915566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668148 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668148 MGI:3647163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Maged1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94275 MGI:1930187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG385499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385499 MGI:3645347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins

name	EG668156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668156 MGI:3643998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	Gspt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14853 MGI:1316727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Zxdb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668166 MGI:3694898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	EG631319 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631319 MGI:3648527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	Zxda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668171 MGI:1921689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Gm371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236914 MGI:2685217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	9630042H07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270624 MGI:2444925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236915 MGI:2442233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042189 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2810002O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pola1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679408 GeneID:18968 MGI:99660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), alpha 1 transcript_id : NM_008892.1

name	EG629581 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407659 GeneID:629581 MGI:3644316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG629581 transcript_id : XM_894481.2

name	Pcyt1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877072 GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 1, choline, beta isoform transcript_id : NM_177546.2

name	Pcyt1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877070 GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 1, choline, beta isoform transcript_id : NM_211138.1

name	Pdk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130212 GeneID:236900 MGI:2384308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate dehydrogenase kinase, isoenzyme 3 transcript_id : NM_145630.2

name	EG668103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271771 GeneID:668103 MGI:3645971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG668103 transcript_id : XM_994312.2

name	EG245516 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407664 GeneID:245516 MGI:3643282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG245516 transcript_id : XM_994395.1

name	EG629591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001914 GeneID:629591 MGI:3647485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG629591 transcript_id : XM_894492.1

name	Zfx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205060 GeneID:22764 MGI:99211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein X-linked transcript_id : NM_011768.2

name	Zfx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205066 GeneID:22764 MGI:99211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein X-linked transcript_id : NM_001044386.1

name	Eif2s3x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129962 GeneID:26905 MGI:1349431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked transcript_id : NM_012010.3

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794654 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039061.1

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794652 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039060.1

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794639 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_153165.2

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794642 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039059.1

name	LOC631145 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271777 GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Putative uncharacterized protein CXorf58 transcript_id : XM_001477581.1

name	0610008C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368551 GeneID:68316 MGI:1915566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610008C08 gene transcript_id : NM_026673.2

name	Maged1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130592 GeneID:94275 MGI:1930187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family D, 1 transcript_id : NM_019791.2

name	EG385499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407669 GeneID:385499 MGI:3645347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins product : predicted gene, EG385499 transcript_id : XM_358254.4

name	Gspt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331155 GeneID:14853 MGI:1316727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G1 to S phase transition 2 transcript_id : NM_008179.2

name	Zxdb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490364 GeneID:668166 MGI:3694898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, X-linked, duplicated B transcript_id : NM_001081473.1

name	EG631319 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407672 GeneID:631319 MGI:3648527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : predicted gene, EG631319 transcript_id : XM_994723.1

name	Gm371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83002976 GeneID:236914 MGI:2685217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : gene model 371, (NCBI) transcript_id : XM_141955.3

name	9630042H07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364187 GeneID:270624 MGI:2444925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630042H07 gene transcript_id : NM_178753.3

name	Arhgef9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384851 GeneID:236915 MGI:2442233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc42 guanine nucleotide exchange factor (GEF) 9 transcript_id : NM_001033329.2

name	2810002O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123858769 GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810002O09 gene transcript_id : NM_175179.3

name	Pola1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679409 CCDS:CCDS30272.1 GeneID:18968 MGI:99660
definition	GO_component : GO:0005658 - alpha DNA polymerase:primase complex [Evidence IDA] [Evidence ISS]; GO:0000785 - chromatin [Evidence ISS]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0003889 - alpha DNA polymerase activity [Evidence ISS]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0003896 - DNA primase activity [Evidence ISS]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence ISS] [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0006260 - DNA replication [Evidence IDA] [Evidence IMP]; GO:0006270 - DNA replication initiation [Evidence ISS]; GO:0000731 - DNA synthesis during DNA repair [Evidence ISS]; GO:0006303 - double-strand break repair via nonhomologous end joining [Evidence ISS]; GO:0006273 - lagging strand elongation [Evidence ISS]; GO:0006272 - leading strand elongation [Evidence ISS]; GO:0009268 - response to pH [Evidence ISS]; GO:0009615 - response to virus [Evidence ISS]; GO:0000084 - S phase of mitotic cell cycle [Evidence ISS] codon_start : 1 note : DNA polymerase alpha 1, 180 kDa; G7a/Bat6Hom product : polymerase (DNA directed), alpha 1 protein_id : NP_032918.1

name	EG629581 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001907 GeneID:629581 MGI:3644316
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899574.1

name	Pcyt1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29164513 GeneID:236899 MGI:2147987
definition	EC_number : 2.7.7.15 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004105 - choline-phosphate cytidylyltransferase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; phosphorylcholine transferase B product : phosphate cytidylyltransferase 1, choline, beta isoform isoform 2 protein_id : NP_808214.1

name	Pcyt1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877071 CCDS:CCDS30274.1 GeneID:236899 MGI:2147987
definition	EC_number : 2.7.7.15 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004105 - choline-phosphate cytidylyltransferase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; phosphorylcholine transferase B product : phosphate cytidylyltransferase 1, choline, beta isoform isoform 1 protein_id : NP_997593.1

name	Pdk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704122 CCDS:CCDS30275.1 GeneID:236900 MGI:2384308
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0016310 - phosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : pyruvate dehydrogenase kinase, isoenzyme 3 protein_id : NP_663605.1

name	EG668103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271772 GeneID:668103 MGI:3645971
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999406.2

name	EG245516 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407665 GeneID:245516 MGI:3643282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999489.1

name	EG629591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001915 GeneID:629591 MGI:3647485
definition	codon_start : 1 product : similar to 40S ribosomal protein S18 protein_id : XP_899585.1

name	Zfx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205067 GeneID:22764 MGI:99211
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein X-linked 5; zinc finger protein X-linked 6; X-linked zinc finger protein product : zinc finger protein X-linked protein_id : NP_001037851.1

name	Zfx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205061 CCDS:CCDS30276.1 GeneID:22764 MGI:99211
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein X-linked 5; zinc finger protein X-linked 6; X-linked zinc finger protein product : zinc finger protein X-linked protein_id : NP_035898.2

name	Eif2s3x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753738 CCDS:CCDS30277.1 GeneID:26905 MGI:1349431
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0045946 - positive regulation of translation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked protein_id : NP_036140.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794655 CCDS:CCDS30278.1 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : kelch-like 15 isoform a protein_id : NP_001034150.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794643 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3 product : kelch-like 15 isoform c protein_id : NP_001034148.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346619 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 4 product : kelch-like 15 isoform c protein_id : NP_694805.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794653 CCDS:CCDS30279.1 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : kelch-like 15 isoform b protein_id : NP_001034149.1

name	LOC631145 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271778 GeneID:631145
definition	codon_start : 1 product : similar to Putative uncharacterized protein CXorf58 protein_id : XP_001477631.1

name	0610008C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311967 GeneID:68316 MGI:1915566
definition	codon_start : 1 note : Novel transmembrane domain containing protein product : hypothetical protein LOC68316 protein_id : NP_080949.1

name	Maged1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789935 CCDS:CCDS30280.1 GeneID:94275 MGI:1930187
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : melanoma antigen family D, 1 protein_id : NP_062765.1

name	EG385499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772187 GeneID:385499 MGI:3645347
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358254.2

name	Gspt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331156 GeneID:14853 MGI:1316727
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : G1 to phase transition 2 protein_id : NP_032205.2

name	Zxdb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490365 GeneID:668166 MGI:3694898
definition	codon_start : 1 product : zinc finger, X-linked, duplicated B protein_id : NP_001074942.1

name	EG631319 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407673 GeneID:631319 MGI:3648527
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999817.1

name	Gm371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83002977 GeneID:236914 MGI:2685217
definition	codon_start : 1 product : similar to GMCL2 protein_id : XP_141955.3

name	9630042H07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520207 CCDS:CCDS30282.1 GeneID:270624 MGI:2444925
definition	codon_start : 1 note : novel Spin/Ssty repeat containing protein product : hypothetical protein LOC270624 protein_id : NP_848868.1

name	Arhgef9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370312 GeneID:236915 MGI:2442233
definition	GO_component : GO:0005938 - cell cortex [Evidence TAS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence TAS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence TAS] codon_start : 1 note : Cdc42 guanine exchange factor 9; collybistin product : Cdc42 guanine nucleotide exchange factor (GEF) 9 protein_id : NP_001028501.1

name	2810002O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123858770 GeneID:72345 MGI:1919595
definition	codon_start : 1 product : RIKEN cDNA 2810002O09 protein_id : NP_780388.2

name	LOC100042041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042041
definition	number : 1 pseudo : _no_value

name	LOC100042041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042041
definition	number : 2 pseudo : _no_value

name	LOC100042041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042041
definition	number : 3 pseudo : _no_value

name	LOC100042062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042062
definition	number : 1 pseudo : _no_value

name	LOC385495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385495
definition	number : 1 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 3 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 2 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 1 pseudo : _no_value

name	LOC100042098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042098
definition	number : 1 pseudo : _no_value

name	EG668148 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668148
definition	number : 2 pseudo : _no_value

name	EG668148 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668148
definition	number : 1 pseudo : _no_value

name	LOC668150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668150
definition	number : 2 pseudo : _no_value

name	LOC668150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668150
definition	number : 1 pseudo : _no_value

name	LOC385500 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385500
definition	number : 2 pseudo : _no_value

name	LOC385500 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385500
definition	number : 1 pseudo : _no_value

name	LOC631331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631331
definition	number : 2 pseudo : _no_value

name	LOC631331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631331
definition	number : 1 pseudo : _no_value

name	LOC619688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619688
definition	number : 1 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 2 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 1 pseudo : _no_value

name	AU015836 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271823 GeneID:385493 MGI:2147954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 3 Proteins product : expressed sequence AU015836 transcript_id : XR_035380.1

name	EG668156 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407670 GeneID:668156 MGI:3643998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : predicted gene, EG668156 pseudo : _no_value transcript_id : XR_002150.1

name	Zxda (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:125628683 GeneID:668171 MGI:1921689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, X-linked, duplicated A pseudo : _no_value transcript_id : NR_003292.1

clone name	MSMg01-124K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385P18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274I17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-388O17.T7 (MSMg01no388_o17.b1)	MSMg01-388O17.TJ (MSMg01no388_o17.g1)
ACC	AG491299	AG491300
length	773	758
length of high quality (start - end)	345 (62 - 406)	485 (83 - 567)
definition	CHROMAT_FILE: MSMg01no388_o17.b1 PHD_FILE: MSMg01no388_o17.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:32:21 2005	CHROMAT_FILE: MSMg01no388_o17.g1 PHD_FILE: MSMg01no388_o17.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:32:21 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCCAGA AGCTCCCCTCAATGAGTAATTCTGGTAGAATATTGAAAGATGGTGATGCT TGAAGAAACACTGACATTAGAGACCAGGGTCATGTGGTTTTAGAGGTTAT CCTAGTAACTTAACACATCTTAGAGTCATCTGAGAAGGTGATCTCAATTG AGGGATAGTCCAGATTGGCCTGTGGAAATATCTGTTATATTGTCTTGATT GAGAATTTATGTGGGGGGGGGGCAGCCCAGTATGGGTAGCATTATTCCCT GGACAGGTACTCCTGGGCTGCATATACGCATAAGCCAGTAAGCAATCCAG AAAACACAATATCCCTGTGGTTATGTTTCAAGTACTTATTTGAATTCCTA CCCTGGACTNCCCCCCTGATGGACTCTCACCTGGATGTGTAAGCCCAATG AATCATTTCCTGCCCTATGTTGCTATTGGTCTGCGTTTTATCACCGCATC TGACAGACCACTAGCCCAGCCGCGTAAATGATTCTTATCAGGAATTACGA TAGGGGCGATCCCCGCGACACTTTAACCATTACTACGGCCTCCTTCTCTA CCCCGACCTTCTCCCCCCGACTGCAGCTTCTCTTCCCGACCACGCACCCT CCTCCCCCCCTACTCGTCACTTCCCGCACTGTCCACTATTTCCGTCGGTC GTCTACCCCCCACCCTTTCACCTCCCACCCTTCCCCCTCTACGCCCCACC CTCCCGCTCGTTCCCCTCCCCCN	NNCCCCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCTCATATCATATTAGTAA CATGCATAATGCCCCAGGTTTGATCATTAGCATCAGTAATAAAAGACATA CACATAATTTATAGCCAGTCATCTTAAGAGAAAATTATATGTAACCACAC TTTTTCTTATTCTTTTTCCTTTCTTTGGTTTTTCATTTTTTTTCTTTTCA ATTTTCATTTTTTTAAACGTTTATGTTATACAGTTCTTTGCTTTTTGAGA CAGAATTTCACTGTTCATGTTGGTTCTTGAGTTTGTAGCAGTCTGCCCGC CTCAGCCTCCTGAGTGCTGACATTAGAGATGTGCTGACATTAGAGATGTG AGCCTCCAGACTCCCATTGCCCCCTCTTTTGTGGTACTAGAGACTGAAGC CAAGATGTTTCCTAGGCAAGTGCTCTACCACTGAACTATACTCCAAGCAT ATTATGCAGGTTTAAGGGATGTGTCCCAAGATTTTCTGTAGTAGTTACAC ACACACACACACACACACACACATATACTTTCACACCTCCCCCCTCCTTT TCACACCACACTTCCTTCCCCACAGCAANACAAATGAAGAAATTTTTGGA CTGGGAGTTTAGCAAATCCTTTTTTTCCCCTTCCCCACTGGCTTCCTCTC CCACCCCTTTCCTGCCTGGGGCCCCCGATCCCCTGGGCAAAACCTCATTT GAACGGGG
quality values	Open. Hide. 11 11 23 23 23 21 14 14 9 9 9 14 16 33 33 41 22 19 12 12 14 19 19 9 9 9 9 9 9 12 23 23 30 30 30 28 29 37 48 47 31 31 30 30 25 23 11 11 11 21 23 8 8 8 8 9 11 13 13 10 10 10 22 28 41 48 33 36 36 31 31 29 31 31 35 35 57 53 53 50 50 47 47 50 50 57 68 48 42 42 42 41 42 43 42 43 42 46 39 43 46 44 59 59 59 59 44 42 30 31 30 37 30 28 22 22 19 29 34 59 57 57 44 46 43 43 37 48 32 32 13 15 15 32 34 57 57 57 57 57 57 57 57 57 57 54 54 54 57 44 57 43 43 33 44 44 32 32 12 19 24 27 27 37 52 52 52 52 52 44 44 44 44 44 44 43 52 52 52 57 57 57 57 57 57 57 57 57 57 47 57 57 42 42 35 35 35 44 44 57 57 57 57 57 57 57 57 57 57 57 52 52 52 57 57 57 57 57 59 35 57 43 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 44 44 52 52 52 57 57 57 57 57 45 45 52 57 57 57 52 52 52 43 43 43 43 43 44 43 52 52 59 59 57 54 54 52 57 38 38 28 41 43 52 52 57 59 57 47 42 35 35 35 43 43 43 30 30 26 32 35 35 32 43 43 59 27 19 9 9 9 17 17 42 42 35 44 32 32 32 42 35 35 42 28 28 20 20 20 27 41 41 41 43 36 40 28 28 28 28 25 23 23 25 44 28 28 28 31 36 42 48 47 37 40 30 30 30 37 32 39 47 40 39 35 32 33 29 28 28 29 35 35 39 39 48 48 48 59 59 48 48 43 34 34 23 23 20 30 28 31 8 8 6 6 6 6 3 0 3 17 17 15 12 12 12 21 26 32 35 37 32 32 37 37 32 28 23 23 24 32 28 29 32 34 28 24 14 14 21 18 16 19 19 15 15 19 29 37 42 23 21 17 16 17 29 33 43 43 43 48 37 37 28 28 19 24 21 21 22 24 23 23 21 23 18 15 18 18 19 19 8 9 8 10 9 12 11 13 13 10 9 9 10 13 13 9 9 9 9 9 10 10 10 12 11 11 10 10 10 15 11 11 11 11 11 12 10 8 8 8 8 8 6 6 8 8 11 12 13 10 9 9 9 15 14 16 10 10 10 11 11 11 9 11 8 8 8 8 10 11 11 12 12 12 12 12 11 11 11 23 23 33 28 19 18 9 9 10 10 10 15 20 17 10 10 10 10 8 8 9 18 11 12 11 12 12 10 10 10 9 10 10 8 8 8 8 8 8 14 10 12 8 9 17 20 22 19 10 6 6 8 8 10 8 10 8 8 8 8 6 8 6 6 8 8 10 10 9 9 9 9 10 10 15 10 10 8 8 8 8 9 10 8 8 8 8 8 8 9 9 9 10 8 8 9 12 13 12 8 8 7 7 8 8 9 9 9 9 9 10 10 10 10 9 9 8 8 8 6 8 8 8 8 8 8 6 8 8 8 10 9 8 8 8 8 8 9 11 12 8 8 8 8 10 10 14 11 15 10 10 10 10 10 12 9 8 8 8 8 13 10 8 8 8 8 8 13 13 8 8 8 12 14 19 12 12 10 8 8 8 12 10 9 8 8 6 6 13 10 9 6 10 6 8 8 8 8 8 8 8 8 11 8 8 8 10 10 11 13 3 0	Open. Hide. 0 0 3 6 6 6 8 8 10 10 8 8 8 11 7 9 9 9 15 17 31 31 31 26 27 26 26 26 32 19 19 9 15 12 12 9 11 11 12 9 11 9 9 10 10 11 9 11 18 17 25 25 26 32 44 31 33 28 36 28 33 39 27 13 8 6 8 8 8 7 7 9 15 23 28 20 10 16 19 28 28 35 36 38 33 42 42 42 47 42 42 42 47 44 57 57 57 57 32 32 31 30 30 42 42 43 43 48 54 54 54 54 42 42 33 30 30 42 44 68 68 50 57 57 39 39 32 38 38 57 39 37 38 39 39 35 43 44 68 68 68 68 68 68 57 57 47 47 44 57 41 41 41 44 44 57 59 68 68 68 68 68 57 50 50 37 43 37 43 43 52 52 57 50 50 38 41 35 43 43 52 41 50 50 50 50 51 68 68 68 68 68 68 57 57 57 57 54 57 57 57 59 59 57 57 57 57 57 59 59 59 54 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 68 68 68 68 43 57 54 54 54 57 59 68 68 68 57 57 57 57 57 57 57 37 37 37 57 59 57 47 54 54 54 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 54 54 54 54 59 59 59 68 68 68 68 68 68 68 59 59 59 57 57 57 57 57 57 57 57 57 47 47 42 39 39 39 59 41 41 37 37 37 29 31 13 10 10 10 10 10 12 19 25 23 34 41 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 57 48 48 48 57 59 59 48 48 36 37 28 44 44 57 48 57 57 57 48 48 48 57 48 48 54 43 57 57 57 53 53 57 57 57 57 57 57 48 48 48 47 47 47 39 47 47 59 59 47 47 39 39 32 32 23 17 14 10 9 9 10 20 26 47 41 41 50 50 50 50 59 57 48 48 48 48 41 41 39 37 37 37 59 59 41 37 32 41 41 41 41 47 41 41 48 48 48 48 48 48 36 36 25 28 30 37 40 43 43 43 48 48 43 43 40 40 39 43 43 57 57 54 54 54 59 59 57 48 48 43 43 39 43 35 35 37 42 43 48 43 32 32 20 17 19 41 30 48 57 59 59 59 59 46 39 39 35 37 37 40 27 29 32 37 37 37 41 41 34 34 28 21 21 24 24 28 41 41 59 41 41 19 24 13 21 34 25 28 29 19 19 10 10 10 17 18 34 31 37 21 21 12 12 11 12 11 10 8 8 8 8 6 6 10 12 12 8 8 8 6 6 8 8 17 13 18 14 14 11 9 8 8 8 8 8 8 10 9 9 10 10 8 8 8 8 8 8 8 14 10 12 9 9 9 9 13 10 10 10 10 9 9 9 3 0 3 10 13 10 10 13 12 10 8 11 8 8 8 8 9 8 12 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 8 8 8 8 8 13 16 16 13 12 9 10 10 16 13 11 14 14 15 13 8 8 8 8 8 9 8 8 8 8 10 8 8 8 8 10 9 10 12 19 18 22 23 19 8 8 8 8 6 6 8 8 9 9 10 8 8 8 8 8 8 10 10 10 11 10 9 9 12 8 8 8 12 12 13 12 12 8 8 8 8 8 8 10 10 8 8 8 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no388_o17.g1 MSMg01no388_o17.g1 CHROMAT_FILE:
MSMg01no388_o17.g1 PHD_FILE: MSMg01no388_o17.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:32:21 2005
         (485 letters)



>mm_chrX_91642629_91643513
          Length = 885

 Score =  874 bits (452), Expect = 0.0
 Identities = 470/480 (97%), Gaps = 9/480 (1%)
 Strand = Plus / Plus

                                                                       
Query: 10  tattagtaacatgcataatgccccaggtttgatcattagcatcagtaataaaagacatac 69
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 210 tattagtaacatgcataatgccccaggtttgatcattagcatcagtaataaaagacatac 269

                                                                       
Query: 70  acataatttatagccagtcatcttaagagaaaattatatgtaaccacactttttcttatt 129
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 270 acataatttatagccagtcatcttaagagaaaattatatgtaaccacactttttcttatt 329

                                                                       
Query: 130 ctttttcctttctttggtttttcattttttttcttttcaattttcatttttttaaacgtt 189
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 ctttttcctttctttggtttttcattttttttcttttcaattttcatttttttaaacgtt 389

                                                                       
Query: 190 tatgttatacagttctttgctttttgagacagaatttcactgttcatgttggttcttgag 249
           ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
Sbjct: 390 tatgttatacagttctttgctttttgagacagaatttcactgttcatgttggc-cttgag 448

                                                                       
Query: 250 tttgtagcagtctgcccgcctcagcctcctgagtgctgacattagagatgtgctgacatt 309
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 tttgtagcagtctgcccgcctcagcctcctgagtgctgacattagagatgtgctgacatt 508

                                                                       
Query: 310 agagatgtgagcctccagactcccattgccccct----cttttgtggtactagagactga 365
           |||||||||||||||||||||||||||||    |    ||||||||||||||||||||||
Sbjct: 509 agagatgtgagcctccagactcccattgc----tttttcttttgtggtactagagactga 564

                                                                       
Query: 366 agccaagatgtttcctaggcaagtgctctaccactgaactatactccaagcatattatgc 425
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 565 agccaagatgtttcctaggcaagtgctctaccactgaactatactccaagcatattatgc 624

                                                                       
Query: 426 aggtttaagggatgtgtcccaagattttctgtagtagttacacacacacacacacacaca 485
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 625 aggtttaagggatgtgtcccaagattttctgtagtagttacacacacacacacacacaca 684


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 31
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 485
Length of database: 885
Length adjustment: 10
Effective length of query: 475
Effective length of database: 875
Effective search space:   415625
Effective search space used:   415625
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information