MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-395E20
Chromosome	X (Build37)
Map Location	21,147,298 - 21,147,691
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Ndufb11, Rbm10, Ube1x, Pctk1, Usp11, LOC100043955, Araf, Syn1, Timp1, Cfp, Elk1, Uxt, A230072C01Rik, Zfp182, Spaca5, D930016N04Rik, Ssxa1, Gm1848, EG546268, EG629024, EG331392, Agtr2, EG668997
Downstream gene	Slc6a14, LOC100043180, LOC100043182, LOC100043956, EG436197, Ppia-psx_207.1, 1700023I07Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ndufb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104130 MGI:1349919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236732 MGI:2384310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube1x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22201 MGI:98890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pctk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18555 MGI:97516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236733 MGI:2384312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043955 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Araf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11836 MGI:88065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20964 MGI:98460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21857 MGI:98752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cfp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18636 MGI:97545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13712 MGI:101833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uxt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22294 MGI:1277988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230072C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320742 MGI:2444644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Zfp182 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319535 MGI:2442220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spaca5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278203 MGI:2685564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	D930016N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245368 MGI:3045326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssxa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385338 MGI:2446782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	Gm1848 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236737 MGI:3037706
definition	note : gene model 1848, (NCBI) pseudo : _no_value

name	EG546268 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546268 MGI:3647035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG629024 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629024 MGI:3648987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG331392 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331392 MGI:3643622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agtr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11609 MGI:87966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668997 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668997 MGI:3645164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Slc6a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56774 MGI:1890216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043182 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043956 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG436197 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436197 MGI:3643675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Ppia-psx_207.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606544
definition	note : peptidylprolyl isomerase A pseudogene x_207.1 pseudo : _no_value

name	1700023I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76705 MGI:1923955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980892 GeneID:104130 MGI:1349919
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11 transcript_id : NM_019435.2

name	Rbm10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704123 GeneID:236732 MGI:2384310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 10 transcript_id : NM_145627.1

name	Ube1x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803326 GeneID:22201 MGI:98890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-activating enzyme E1, Chr X transcript_id : NM_009457.3

name	Pctk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372498 GeneID:18555 MGI:97516
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PCTAIRE-motif protein kinase 1 transcript_id : NM_011049.3

name	Usp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802478 GeneID:236733 MGI:2384312
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 11 transcript_id : NM_145628.3

name	Araf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27545180 GeneID:11836 MGI:88065
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-raf murine sarcoma 3611 viral oncogene homolog transcript_id : NM_009703.1

name	Syn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62177179 GeneID:20964 MGI:98460
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synapsin I transcript_id : NM_013680.3

name	Timp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205062 GeneID:21857 MGI:98752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue inhibitor of metalloproteinase 1 transcript_id : NM_001044384.1

name	Timp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205064 GeneID:21857 MGI:98752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue inhibitor of metalloproteinase 1 transcript_id : NM_011593.2

name	Cfp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364936 GeneID:18636 MGI:97545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement factor properdin transcript_id : NM_008823.3

name	Elk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116292181 GeneID:13712 MGI:101833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELK1, member of ETS oncogene family transcript_id : NM_007922.4

name	Uxt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803139 GeneID:22294 MGI:1277988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitously expressed transcript transcript_id : NM_013840.3

name	A230072C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271007 GeneID:320742 MGI:2444644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : RIKEN cDNA A230072C01 gene transcript_id : XM_001478179.1

name	Zfp182 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972405 GeneID:319535 MGI:2442220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 182 transcript_id : NM_001013387.1

name	Spaca5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407029 GeneID:278203 MGI:2685564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : sperm acrosome associated 5 transcript_id : XM_001006691.1

name	D930016N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802563 GeneID:245368 MGI:3045326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D930016N04 gene transcript_id : NM_183185.2

name	Ssxa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271062 GeneID:385338 MGI:2446782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : synovial sarcoma, X member A, breakpoint 1 transcript_id : XM_001481340.1

name	EG546268 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407033 GeneID:546268 MGI:3647035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG546268 transcript_id : XM_001006694.1

name	EG629024 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407035 GeneID:629024 MGI:3648987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG629024 transcript_id : XM_901092.2

name	EG331392 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375328 GeneID:331392 MGI:3643622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG331392 transcript_id : NM_198633.2

name	Agtr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982509 GeneID:11609 MGI:87966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensin II receptor, type 2 transcript_id : NM_007429.2

name	Slc6a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362684 GeneID:56774 MGI:1890216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter), member 14 transcript_id : NM_020049.3

name	LOC100043180 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271009 GeneID:100043180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043180 transcript_id : XM_001478292.1

name	EG436197 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51830708 GeneID:436197 MGI:3643675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG436197 transcript_id : XM_488335.1

name	1700023I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347328 GeneID:76705 MGI:1923955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700023I07 gene transcript_id : NM_029707.2

name	Ndufb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506933 GeneID:104130 MGI:1349919
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : nuclear protein 15.6 product : neuronal protein 15.6 protein_id : NP_062308.1

name	Rbm10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704124 GeneID:236732 MGI:2384310
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 10 protein_id : NP_663602.1

name	Ube1x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678483 CCDS:CCDS30044.1 GeneID:22201 MGI:98890
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004839 - ubiquitin activating enzyme activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin-activating enzyme E1, Chr X protein_id : NP_033483.1

name	Pctk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242173 CCDS:CCDS30045.1 GeneID:18555 MGI:97516
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : PCTAIRE-motif protein kinase 1 protein_id : NP_035179.1

name	Usp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981834 GeneID:236733 MGI:2384312
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific protease 11 protein_id : NP_663603.2

name	Araf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27545181 GeneID:11836 MGI:88065
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : raf-related oncogene; v-raf murine sarcoma 3611 viral oncogene homolog 1 product : v-raf murine sarcoma 3611 viral oncogene homolog protein_id : NP_033833.1

name	Syn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62177180 GeneID:20964 MGI:98460
definition	GO_component : GO:0045202 - synapse [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence IEA]; GO:0030672 - synaptic vesicle membrane [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence TAS] GO_process : GO:0007269 - neurotransmitter secretion [Evidence IMP] [Evidence IGI] codon_start : 1 product : synapsin I protein_id : NP_038708.2

name	Timp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205063 GeneID:21857 MGI:98752
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008191 - metalloendopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0043249 - erythrocyte maturation [Evidence IEA] codon_start : 1 note : tissue inhibitor of metalloproteinase-1 product : tissue inhibitor of metalloproteinase 1 protein_id : NP_001037849.1

name	Timp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205065 CCDS:CCDS30046.1 GeneID:21857 MGI:98752
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008191 - metalloendopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0043249 - erythrocyte maturation [Evidence IEA] codon_start : 1 note : tissue inhibitor of metalloproteinase-1 product : tissue inhibitor of metalloproteinase 1 protein_id : NP_035723.2

name	Cfp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326449 CCDS:CCDS30047.1 GeneID:18636 MGI:97545
definition	GO_process : GO:0006957 - complement activation, alternative pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 product : properdin factor, complement protein_id : NP_032849.2

name	Elk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116292182 CCDS:CCDS30048.1 GeneID:13712 MGI:101833
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : ELK1, member of ETS oncogene family protein_id : NP_031948.4

name	Uxt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841023 CCDS:CCDS30049.1 GeneID:22294 MGI:1277988
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence ISS]; GO:0000930 - gamma-tubulin complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0016272 - prefoldin complex [Evidence IEA] GO_function : GO:0048487 - beta-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0051297 - centrosome organization and biogenesis [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : ubiquitously expressed transcript protein_id : NP_038868.2

name	A230072C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271008 GeneID:320742 MGI:2444644
definition	codon_start : 1 product : hypothetical protein LOC320742 protein_id : XP_001478229.1

name	Zfp182 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972406 GeneID:319535 MGI:2442220
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 182 protein_id : NP_001013405.1

name	Spaca5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407030 GeneID:278203 MGI:2685564
definition	codon_start : 1 product : sperm acrosome associated 5 protein_id : XP_001006691.1

name	D930016N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147234 CCDS:CCDS30050.1 GeneID:245368 MGI:3045326
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004185 - serine carboxypeptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245368 protein_id : NP_899008.1

name	Ssxa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271063 GeneID:385338 MGI:2446782
definition	codon_start : 1 exception : unclassified translation discrepancy product : similar to synovial sarcoma, X member A, breakpoint 1 protein_id : XP_001481390.1

name	EG546268 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407034 GeneID:546268 MGI:3647035
definition	codon_start : 1 product : similar to SSXB5 protein protein_id : XP_001006694.1

name	EG629024 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999980 GeneID:629024 MGI:3648987
definition	codon_start : 1 product : hypothetical protein protein_id : XP_906185.1

name	EG331392 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348508 GeneID:331392 MGI:3643622
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC331392 protein_id : NP_941035.1

name	Agtr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680672 GeneID:11609 MGI:87966
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004945 - angiotensin type II receptor activity [Evidence IDA] [Evidence IPI]; GO:0004947 - bradykinin receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0002033 - angiotensin mediated vasodilation during regulation of blood pressure [Evidence IMP]; GO:0002035 - brain renin-angiotensin system [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : AT2 receptor product : angiotensin II receptor, type 2 protein_id : NP_031455.1

name	Slc6a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560353 CCDS:CCDS30051.1 GeneID:56774 MGI:1890216
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence ISS]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : colonic system B0+ amino acid transporter product : solute carrier family 6 (neurotransmitter transporter), member 14 protein_id : NP_064433.2

name	LOC100043180 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271010 GeneID:100043180
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478342.1

name	EG436197 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830709 GeneID:436197 MGI:3643675
definition	codon_start : 1 product : hypothetical protein protein_id : XP_488335.1

name	1700023I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347329 GeneID:76705 MGI:1923955
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] GO_process : GO:0009966 - regulation of signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76705 protein_id : NP_083983.2

name	LOC100043955 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043955
definition	number : 2 pseudo : _no_value

name	LOC100043955 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043955
definition	number : 1 pseudo : _no_value

name	EG668997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668997
definition	number : 1 pseudo : _no_value

name	EG668997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668997
definition	number : 2 pseudo : _no_value

name	EG668997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668997
definition	number : 3 pseudo : _no_value

name	LOC100043182 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043182
definition	number : 1 pseudo : _no_value

name	LOC100043956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043956
definition	number : 3 pseudo : _no_value

name	LOC100043956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043956
definition	number : 2 pseudo : _no_value

name	LOC100043956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043956
definition	number : 1 pseudo : _no_value

clone name	MSMg01-419I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399A01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-414M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-395E20.T7 (MSMg01no395_e20.b1)	MSMg01-395E20.TJ (MSMg01no395_e20.g1)
ACC	AG496153	AG496154
length	781	790
length of high quality (start - end)	484 (45 - 528)	399 (73 - 471)
definition	CHROMAT_FILE: MSMg01no395_e20.b1 PHD_FILE: MSMg01no395_e20.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:07:06 2005	CHROMAT_FILE: MSMg01no395_e20.g1 PHD_FILE: MSMg01no395_e20.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:07:06 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCTCAACTATGAAATACTGAATGGGTGAGAAGCAACTAAAAAAAATGT TAAACATCCTTAGTCATCAGGATGACTAATGCAAATCAAAACGACCCTGA GACTCCACCTCATACCAGTCAGAATGGCTAAAATCAAAAACTCAGGTGAC AGCAGGTGCTAGAGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTG GTGGGATTGCAAGCTGGTGCAATCACTCTGGAAATCAGTTTGATGGTTCC TCAGAAAATTGAACATAGTACTACTGGAGGATCCAGCAATACCACTCCTG AGCATATACCCAGCTGCTTCAACATGATGGATGCTGGATGCAGATGCTCC AACATGTAGTAAGGACACATGCTCCACTATGTTCACAGCAGCTAGATACA ACCCAGATGTCTCTCAACAGAGGAATGGACACAGAAAATGTGGTACATTT ACACAATGGCGAACTATGCAACTATTACAAACAATGAATTCATGAAATTC TTAAAGAAATGAATGGATCTGGAGGATATATCCTAAGTGAGATAACCCAT TCCCAAAGACCACATGTGATATGCACTCCCCGAAGTGTGGAAATTTAACT CAAAAGTCCGAAAAAACATGTACAATTTGGAAACCCCTTTTACTCCATAA AGAACAACCCATGGGAAAAATCCCCACCCTCTCCAAAAGGGCAATAAATA TACCCTTGATGGGTTTCTTAAATTAATTTTN	AATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXTTTATATGTTTTGGATGATGGTACTTAG GTTTCTTGTGATTACAAATTCAACAAGAGAGTGAAAATGAAGTGTTATAT TAGAAGAAAACCTTAATCTAGAATTTCCAATTTCATTTTCTTTTTGGTGT ATTTAGAAGACCAGCAATTTTTCATTTTTATAAAATGTATCTTATTTTAT ATTTATTTAATATATAAATATATGTAACAATAAATATATATATATATATA ATTACATATAGCACAGCTGTCCTCTGAGAAGCAGTATCAGCAGCTGACTG ACACAGATGCAGATAGTTAGAGCCAACCATTGGGCTGAATTCGGGGACAC CTGTGAAAGAGTTAGGGGAGGAAAAAAGGAGCTGAAAGTGATGGCAACCC CACAGGAAGACCAGCAGTTTCAACTAACCTGCACCCCTGGGAGCTCCCAG AGACAGAGCCACCAACCAAAGAGCATACACTCTCTGGTCCAAGGCCACTG GCACATGTGTAGAATAGGGTTTGCCTTGTCTGACCTCTATGGGAGAGGAT GCCCCTGATCCTGTAAAAAATTGATGCCCCGTGGTGGGGGAAGATACCCT CGGCATAATCTTATGGTCGAATACCTTTTCTTATAGTATTTAGTTATGGA CATTGTGTGTAAAATTTCCGTCTGTTTTTATTGATTGGATATCACCATTC TTCTTTCGTTTTTATTCCCATTTTTTTGTCTCTTTGCTTT
quality values	Open. Hide. 8 8 8 8 10 17 21 31 40 39 25 25 12 12 12 25 19 22 12 12 12 23 28 43 23 19 17 14 14 15 23 9 9 9 9 9 9 20 23 18 18 14 18 18 27 27 50 50 29 29 28 28 36 36 47 50 47 25 25 12 21 18 21 13 14 14 27 29 37 48 43 43 43 43 43 43 48 54 54 54 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 50 50 50 50 68 57 57 68 68 68 68 68 68 68 68 51 50 50 50 50 68 68 68 57 57 57 57 50 57 57 68 68 68 68 57 57 59 59 68 68 68 68 68 50 50 50 50 50 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 45 52 57 57 57 57 57 52 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 57 68 57 57 57 57 57 57 59 59 59 57 43 43 47 59 57 57 57 57 57 57 57 57 59 59 59 54 54 57 57 57 57 59 59 48 48 48 48 48 43 48 48 48 57 57 57 57 57 57 48 57 47 43 43 59 39 37 43 39 39 30 37 35 39 39 59 37 37 35 28 28 40 59 59 41 46 41 41 39 39 34 31 37 31 31 31 37 37 37 36 36 21 28 13 13 13 19 28 25 31 30 37 37 37 37 37 37 32 29 25 30 29 31 32 32 37 37 41 41 41 32 32 20 18 22 28 28 34 15 11 6 6 6 7 12 20 20 20 34 15 10 9 8 8 8 12 20 27 16 17 17 11 9 12 9 10 8 9 8 9 11 21 15 22 28 34 32 32 18 19 12 10 10 15 10 10 14 17 20 9 9 9 9 10 10 12 13 15 10 10 10 10 15 13 11 11 10 10 8 12 8 7 9 8 8 10 10 14 13 21 11 11 11 8 8 8 8 8 8 8 8 8 8 11 11 15 9 9 8 8 8 8 11 10 15 16 12 12 10 8 7 7 7 8 10 10 10 10 11 8 8 8 10 8 9 8 8 8 6 6 6 8 8 8 8 9 12 12 11 11 10 10 10 10 10 10 11 11 19 12 15 9 9 9 10 10 10 12 12 11 15 10 10 8 8 8 6 6 8 6 6 6 7 10 10 10 10 6 6 6 8 9 9 10 10 10 10 10 10 11 11 12 13 9 9 9 13 9 14 14 14 14 12 8 8 6 6 8 8 8 9 13 9 11 12 10 10 9 9 12 13 10 11 9 9 9 9 9 10 10 8 8 9 9 9 9 11 11 6 6 6 6 10 8 10 8 8 8 8 8 10 13 13 3 0	Open. Hide. 9 9 9 9 9 9 8 6 6 6 6 8 14 13 37 29 37 30 31 30 32 37 31 31 37 37 19 27 9 6 6 6 6 7 8 10 10 13 19 21 34 32 29 30 34 37 37 36 36 37 37 37 37 37 23 23 11 9 9 9 9 15 16 28 28 34 24 28 28 28 36 36 57 57 57 57 53 43 43 43 43 43 53 59 47 47 42 42 42 42 48 48 48 54 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 50 50 41 41 41 48 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 50 50 41 42 42 50 57 57 57 57 57 57 68 68 68 68 68 68 59 59 59 57 57 57 57 57 57 68 57 68 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 54 54 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 59 59 68 68 68 68 68 59 59 59 59 59 59 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 50 50 50 50 50 50 46 34 30 23 12 12 11 18 12 18 18 23 41 30 59 48 48 48 59 59 59 59 59 59 59 59 59 59 48 48 48 48 48 48 59 59 68 68 68 68 54 54 54 54 57 57 57 57 59 59 59 59 59 59 57 57 59 59 57 57 54 54 46 57 43 43 43 46 57 57 59 59 59 59 54 54 54 54 54 57 57 59 59 54 54 54 54 54 54 54 54 68 68 68 68 57 57 57 48 48 48 57 57 57 48 48 48 47 59 43 48 48 48 48 48 59 59 41 28 23 23 28 34 28 31 35 37 37 39 40 37 37 30 30 25 22 25 22 27 25 30 30 31 37 32 29 25 27 29 29 24 24 24 24 28 33 28 28 23 14 14 16 23 12 12 11 17 13 30 21 25 22 16 18 21 22 19 29 29 27 32 17 16 9 10 10 10 12 23 23 23 23 23 23 24 25 10 10 10 10 10 11 16 17 9 8 8 8 8 15 16 22 11 11 12 12 16 16 19 13 12 12 16 11 9 8 8 8 8 10 8 11 9 9 12 14 18 15 15 10 10 9 15 12 10 10 10 12 18 10 10 10 10 10 9 6 6 6 6 6 6 10 8 8 10 8 6 8 6 6 8 10 7 6 6 6 6 6 6 8 8 8 8 8 8 8 8 10 13 14 13 8 8 6 6 8 8 12 10 10 8 8 8 8 8 8 8 8 8 10 12 10 10 10 9 9 10 14 9 9 9 9 9 9 9 10 20 18 11 11 8 8 8 8 9 9 8 7 6 6 8 6 8 8 8 8 8 8 8 8 13 12 11 12 9 10 10 10 9 8 8 8 10 6 6 8 10 8 8 8 12 8 9 8 8 8 8 8 8 8 8 10 10 8 7 7 6 6 6 6 6 10 10 15 15 20 20 15 14 10 10 9 9 12 13 12 13 11 11 11 8 8 6 6 8 7 9 10 10 10 11 12 12 15 12 8 8 8 8 8 8 8 6 8 6 6 8 10 10 8 8 8 8 10 9 9 9 13 13 10 12 8 8 8 8 12 10 11 11 11 17 13 14 10 13 9 9 9 9 9 9 9 11 6 6 6 6 10 7

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no395_e20.g1 MSMg01no395_e20.g1 CHROMAT_FILE:
MSMg01no395_e20.g1 PHD_FILE: MSMg01no395_e20.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:07:06 2005
         (399 letters)



>mm_chrX_21147098_21147896
          Length = 799

 Score =  716 bits (370), Expect = 0.0
 Identities = 390/400 (97%), Gaps = 7/400 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   tttatatgttttggatgatggtacttaggtttcttgtgattacaaattcaacaagagagt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tttatatgttttggatgatggtacttaggtttcttgtgattacaaattcaacaagagagt 260

                                                                       
Query: 61  gaaaatgaagtgttatattagaagaaaaccttaatctagaatttccaatttcattttctt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gaaaatgaagtgttatattagaagaaaaccttaatctagaatttccaatttcattttctt 320

                                                                       
Query: 121 tttggtgtatttagaagaccagcaatttttcatttttataaaatgtatcttattttatat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tttggtgtatttagaagaccagcaatttttcatttttataaaatgtatcttattttatat 380

                                                                       
Query: 181 ttatttaatatataaatatatgtaacaataaatatatatatatatataattacatatagc 240
           ||||||||||||||||||||||||||||||||||||||||||      ||||||||||||
Sbjct: 381 ttatttaatatataaatatatgtaacaataaatatatatata------attacatatagc 434

                                                                       
Query: 241 acagctgtcctctgagaagcagtatcagcagctgactgacacagatgcagatagttagag 300
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 435 acagctgtcctccgagaagcagtatcagcaactgactgacacagatgcagatagttagag 494

                                                                       
Query: 301 ccaaccattgggctgaattcggggacacctgtgaaagagttagggga-ggaaaaaaggag 359
           |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 495 ccaaccattgggctgaattcggggacccctgtgaaagagttaggggaaggaaaaaaggag 554

                                                   
Query: 360 ctgaaagtgatggcaaccccacaggaagaccagcagtttc 399
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 555 ctgaaagtgatggcaaccccacaggaagaccagcagtttc 594


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 17
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 399
Length of database: 799
Length adjustment: 9
Effective length of query: 390
Effective length of database: 790
Effective search space:   308100
Effective search space used:   308100
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information