MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-415F04
Chromosome	X (Build37)
Map Location	90,617,163 - 90,617,780
singlet/doublet	singlet
Overlap gene	Pola1
Upstream gene	Mageb18, EG546347, LOC629568, LOC100042663, Rp23-438h3.2, Arx
Downstream gene	EG629581, Pcyt1b, Pdk3, EG668103, LOC100042041, AU015836, EG245516, LOC100042062, EG629591, Zfx, Eif2s3x, Klhl15, LOC385495, LOC670263, LOC100042098, LOC631145, 0610008C08Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mageb18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215641 MGI:3045344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546347 MGI:3646197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042663 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein pseudo : _no_value

name	Rp23-438h3.2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:69357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11878 MGI:1097716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pola1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18968 MGI:99660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629581 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629581 MGI:3644316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Pcyt1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236900 MGI:2384308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668103 MGI:3645971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100042041 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	AU015836 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385493 MGI:2147954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 3 Proteins

name	EG245516 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245516 MGI:3643282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG629591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629591 MGI:3647485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Zfx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22764 MGI:99211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eif2s3x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26905 MGI:1349431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC385495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins pseudo : _no_value

name	LOC670263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC631145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	0610008C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68316 MGI:1915566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mageb18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372036 GeneID:215641 MGI:3045344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen family B, 18 transcript_id : NM_173783.3

name	EG546347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539459 GeneID:546347 MGI:3646197
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546347 transcript_id : NM_001034103.1

name	Rp23-438h3.2 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:50356001 GeneID:69357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC69357 transcript_id : NM_183280.2

name	Arx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982501 GeneID:11878 MGI:1097716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aristaless related homeobox gene (Drosophila) transcript_id : NM_007492.3

name	Pola1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679408 GeneID:18968 MGI:99660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), alpha 1 transcript_id : NM_008892.1

name	EG629581 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407659 GeneID:629581 MGI:3644316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG629581 transcript_id : XM_894481.2

name	Pcyt1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877072 GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 1, choline, beta isoform transcript_id : NM_177546.2

name	Pcyt1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877070 GeneID:236899 MGI:2147987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 1, choline, beta isoform transcript_id : NM_211138.1

name	Pdk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130212 GeneID:236900 MGI:2384308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate dehydrogenase kinase, isoenzyme 3 transcript_id : NM_145630.2

name	EG668103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271771 GeneID:668103 MGI:3645971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG668103 transcript_id : XM_994312.2

name	EG245516 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407664 GeneID:245516 MGI:3643282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG245516 transcript_id : XM_994395.1

name	EG629591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001914 GeneID:629591 MGI:3647485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG629591 transcript_id : XM_894492.1

name	Zfx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205060 GeneID:22764 MGI:99211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein X-linked transcript_id : NM_011768.2

name	Zfx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205066 GeneID:22764 MGI:99211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein X-linked transcript_id : NM_001044386.1

name	Eif2s3x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129962 GeneID:26905 MGI:1349431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked transcript_id : NM_012010.3

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794654 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039061.1

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794652 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039060.1

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794639 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_153165.2

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794642 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039059.1

name	LOC631145 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271777 GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Putative uncharacterized protein CXorf58 transcript_id : XM_001477581.1

name	0610008C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368551 GeneID:68316 MGI:1915566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610008C08 gene transcript_id : NM_026673.2

name	EG546347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539460 GeneID:546347 MGI:3646197
definition	codon_start : 1 product : hypothetical protein LOC546347 protein_id : NP_001029275.1

name	Rp23-438h3.2 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:46518547 GeneID:69357
definition	codon_start : 1 product : hypothetical protein LOC69357 protein_id : NP_899103.1

name	Arx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024213 CCDS:CCDS30271.1 GeneID:11878 MGI:1097716
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : aristaless related homeobox gene protein_id : NP_031518.2

name	Pola1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679409 CCDS:CCDS30272.1 GeneID:18968 MGI:99660
definition	GO_component : GO:0005658 - alpha DNA polymerase:primase complex [Evidence IDA] [Evidence ISS]; GO:0000785 - chromatin [Evidence ISS]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0003889 - alpha DNA polymerase activity [Evidence ISS]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0003896 - DNA primase activity [Evidence ISS]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence ISS] [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0006260 - DNA replication [Evidence IDA] [Evidence IMP]; GO:0006270 - DNA replication initiation [Evidence ISS]; GO:0000731 - DNA synthesis during DNA repair [Evidence ISS]; GO:0006303 - double-strand break repair via nonhomologous end joining [Evidence ISS]; GO:0006273 - lagging strand elongation [Evidence ISS]; GO:0006272 - leading strand elongation [Evidence ISS]; GO:0009268 - response to pH [Evidence ISS]; GO:0009615 - response to virus [Evidence ISS]; GO:0000084 - S phase of mitotic cell cycle [Evidence ISS] codon_start : 1 note : DNA polymerase alpha 1, 180 kDa; G7a/Bat6Hom product : polymerase (DNA directed), alpha 1 protein_id : NP_032918.1

name	EG629581 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001907 GeneID:629581 MGI:3644316
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899574.1

name	Pcyt1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29164513 GeneID:236899 MGI:2147987
definition	EC_number : 2.7.7.15 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004105 - choline-phosphate cytidylyltransferase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; phosphorylcholine transferase B product : phosphate cytidylyltransferase 1, choline, beta isoform isoform 2 protein_id : NP_808214.1

name	Pcyt1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877071 CCDS:CCDS30274.1 GeneID:236899 MGI:2147987
definition	EC_number : 2.7.7.15 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004105 - choline-phosphate cytidylyltransferase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; phosphorylcholine transferase B product : phosphate cytidylyltransferase 1, choline, beta isoform isoform 1 protein_id : NP_997593.1

name	Pdk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704122 CCDS:CCDS30275.1 GeneID:236900 MGI:2384308
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0016310 - phosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : pyruvate dehydrogenase kinase, isoenzyme 3 protein_id : NP_663605.1

name	EG668103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271772 GeneID:668103 MGI:3645971
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999406.2

name	EG245516 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407665 GeneID:245516 MGI:3643282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999489.1

name	EG629591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001915 GeneID:629591 MGI:3647485
definition	codon_start : 1 product : similar to 40S ribosomal protein S18 protein_id : XP_899585.1

name	Zfx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205067 GeneID:22764 MGI:99211
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein X-linked 5; zinc finger protein X-linked 6; X-linked zinc finger protein product : zinc finger protein X-linked protein_id : NP_001037851.1

name	Zfx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205061 CCDS:CCDS30276.1 GeneID:22764 MGI:99211
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein X-linked 5; zinc finger protein X-linked 6; X-linked zinc finger protein product : zinc finger protein X-linked protein_id : NP_035898.2

name	Eif2s3x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753738 CCDS:CCDS30277.1 GeneID:26905 MGI:1349431
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0045946 - positive regulation of translation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked protein_id : NP_036140.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794655 CCDS:CCDS30278.1 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : kelch-like 15 isoform a protein_id : NP_001034150.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794643 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3 product : kelch-like 15 isoform c protein_id : NP_001034148.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346619 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 4 product : kelch-like 15 isoform c protein_id : NP_694805.1

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794653 CCDS:CCDS30279.1 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : kelch-like 15 isoform b protein_id : NP_001034149.1

name	LOC631145 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271778 GeneID:631145
definition	codon_start : 1 product : similar to Putative uncharacterized protein CXorf58 protein_id : XP_001477631.1

name	0610008C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311967 GeneID:68316 MGI:1915566
definition	codon_start : 1 note : Novel transmembrane domain containing protein product : hypothetical protein LOC68316 protein_id : NP_080949.1

name	LOC629568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629568
definition	number : 1 pseudo : _no_value

name	LOC629568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629568
definition	number : 2 pseudo : _no_value

name	LOC100042041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042041
definition	number : 1 pseudo : _no_value

name	LOC100042041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042041
definition	number : 2 pseudo : _no_value

name	LOC100042041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042041
definition	number : 3 pseudo : _no_value

name	LOC100042062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042062
definition	number : 1 pseudo : _no_value

name	LOC385495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385495
definition	number : 1 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 3 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 2 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 1 pseudo : _no_value

name	LOC100042098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042098
definition	number : 1 pseudo : _no_value

name	LOC100042663 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271822 GeneID:100042663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein product : hypothetical protein LOC100042663 pseudo : _no_value transcript_id : XR_033643.1

name	AU015836 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271823 GeneID:385493 MGI:2147954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 3 Proteins product : expressed sequence AU015836 transcript_id : XR_035380.1

clone name	MSMg01-354L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404P22
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-264F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-415F04.T7 (MSMg01no415_f04.b1)	MSMg01-415F04.TJ (MSMg01no415_f04.g1)
ACC	AG511409	AG511410
length	703	721
length of high quality (start - end)	624 (46 - 669)	515 (72 - 586)
definition	CHROMAT_FILE: MSMg01no415_f04.b1 PHD_FILE: MSMg01no415_f04.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:33:40 2005	CHROMAT_FILE: MSMg01no415_f04.g1 PHD_FILE: MSMg01no415_f04.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:33:40 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCCCAGATGAAAATGAGGTCACACGAGTGATTTCAGGGATTTGGGAA AATTGTTCCTAGTAAATAGTACTGTTTATTACTGGTAAATGGCTTTAAGA AAAGCAGAACTCTGTATTGTCTGCTTTTGACTCAGGTGTGCCATAAATTA AACTTATAAAACTTCCTTCATACTTTTACATATTGCTTATATAGATTCCA CACGTTGCAAATAACTACAGGCAAATGTCTGTCATTTGGCTGATACAAAG CTTGAACTCGAAGAATATCAGTTCTTTGGACTGATGAGTGAGCCAAGCTG ACTGCTTCTCACACTTGTTCAGGGCCCTAGTCTTATCTTGCTATCAGCTG AGCAGTTTGCCCATAAAATGAGCACAGCTGCATTACTCTGAGAAAATGGT CTCCAAGGAAGGCAGTGATTAGTTCTAAAACATGAAGGGGATTATAAAGG TACTCTCTTTCTTGAAACCAGAAGATAAGGATTTTACTGTAGGAATTATT TGCAATTTGGAGATGTCTAAGCATCTCGAGTCAGGTTGCCTTTCGGTATT AAGGATTTCTATTCCTTGGACTGCTAAAGTCAACATGCAGGAAAGCTCAT TATTGCTAGAAGTACTGACAGAAAAGTAGCACGGACCCCCTGGAGTCTTC TCN	ACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXAAAGTCAGCCTGGAACAAAGCAAGTTCCA GATCCAGGTGTGGTGGTACATACCTCCTCCAACAAGACCATACCTCCTAA TAGTGCCAGTCACTGGGGGCCAAGCATATACAAACCATCACAGGGGAAGA CTGGATAGAAGCCCAAGATGCCAGAAGAATGAATGAAAATACGCAGCTGC TAGGGGTGGGGTAGGGGACCTCTAGAAAGGTCCAGAGACCTGGAATATGA GAAGTGCTTGGTATTAATTGTGGGTGCCCAACAGTGGGGAGATATAACCT GAAGAACCCATCATCAGTAGTTAGACAGGGCTCCCAGTGGAGGGATGAGG AAATCAACCCACCTTCAAACTTTTGACCTAGAATTGTTCCTGTCTAAAAG AAATTCGGGGACAAAATGGAGCAGAGACTGAAGGAATTGTGGATCAGTAA CTGGCCCAATTTAGTTAGGACCCATCTCACTCAGAGGGACACATCAAAGC AGGACACTACTACTGATGTTGTGTTGTGCTTGCACACAAGAGCCTAGCAT AACTGTCCTCTGAGAGGATCTACCAGCATATGACTGAGACACATGTTGAT ACTTATAGTTCACCACCGATTATATTGAAGACCGGGACCCCTATGTAAGA GTTGTGGTAAGACTGCAACCG
quality values	Open. Hide. 8 8 8 8 9 9 13 23 27 47 37 37 37 31 31 37 37 30 30 33 37 33 33 50 46 27 22 20 17 15 9 11 11 9 9 23 23 41 43 46 27 26 17 20 20 25 28 47 39 36 36 37 29 37 34 34 24 17 13 10 11 11 16 12 17 26 29 40 42 48 48 41 41 47 47 47 47 47 59 59 50 50 50 48 48 42 41 39 48 48 50 50 50 50 68 68 68 68 68 68 68 68 68 68 57 57 44 44 42 42 44 44 68 68 68 68 68 68 57 57 50 57 57 57 57 68 68 68 57 57 57 57 57 57 57 68 68 51 51 50 50 50 57 59 59 59 68 68 68 68 68 57 57 52 52 52 57 57 44 44 52 57 57 57 57 68 68 57 57 52 52 57 57 57 57 59 59 57 57 57 57 43 43 29 44 44 68 59 59 57 52 52 52 59 57 68 68 68 68 57 59 57 57 59 59 59 68 68 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 68 62 62 62 62 44 44 43 52 52 52 52 62 62 52 62 62 62 62 52 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 52 52 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 44 43 31 27 43 43 68 68 68 44 62 43 43 35 44 44 43 62 62 62 62 62 62 52 62 62 62 62 68 68 68 68 68 62 44 62 35 43 43 59 59 59 59 59 59 59 59 59 59 59 57 57 52 52 52 57 57 59 59 59 59 59 52 57 52 59 59 59 52 52 57 57 57 57 45 45 57 44 59 57 54 52 57 57 57 57 57 57 50 39 59 50 57 57 57 52 52 52 59 59 59 44 44 43 43 52 43 44 44 68 68 68 59 59 59 39 39 43 50 50 59 59 59 50 48 48 59 59 59 59 48 48 32 41 41 57 68 57 57 68 68 57 57 43 43 43 43 43 44 57 57 57 68 57 57 57 57 57 59 57 68 68 54 54 54 41 41 28 32 42 48 48 68 68 57 54 54 48 48 48 48 68 48 48 42 48 48 53 59 59 59 59 59 59 59 34 34 31 43 43 41 41 59 37 40 40 59 59 37 37 32 27 27 30 28 34 27 27 15 26 26 27 25 29 32 37 37 37 59 47 47 47 34 34 41 37 28 28 28 35 41 41 39 40 41 39 40 40 39 39 39 39 36 36 26 30 19 28 20 32 32 47 39 39 39 28 34 32 37 37 30 24 29 26 22 22 23 22 29 32 29 33 28 31 32 34 34 19 19 19 19 13 26 26 24 18 17 17 24 24 31 37 37 39 37 37 32 27 24 20 28 30 27 30 30 30 28 23 14 9 9 9 17 14 11 11 11 25 24 32 23 23 18 14 15 11 9 9 10 11 11 19 21 32 28 28 19 24 24 21 21 12 12 20 24 28 23 23 31 22 19 9 9 9 10 9 13 11 13 10 8 8 8 10 10 10 10 13 13 14 14 19 22 22 28 18 18 10 10 8 8 8 8 10 9 3 0	Open. Hide. 6 6 6 8 8 8 9 9 14 16 31 33 41 37 39 44 44 47 44 44 39 37 41 34 27 27 17 12 11 11 10 10 21 19 28 28 28 31 35 37 53 53 53 53 50 43 43 34 34 37 44 44 43 34 16 19 13 12 18 24 24 36 34 42 42 41 42 42 42 42 33 32 43 43 48 43 48 39 44 37 37 42 48 48 50 47 47 54 57 57 48 48 54 59 59 59 42 41 41 41 48 48 47 47 47 44 57 57 68 68 68 68 68 68 68 57 57 43 50 50 57 50 46 48 52 52 52 50 43 36 43 50 52 52 57 57 57 52 52 52 57 52 52 52 52 52 52 52 57 57 68 68 57 57 57 52 52 52 57 52 52 52 57 57 57 59 59 59 57 45 45 52 59 52 52 52 59 59 59 57 52 52 44 43 42 52 52 52 52 52 52 57 57 57 68 68 68 57 57 57 57 62 62 62 62 62 62 68 62 62 62 52 52 52 52 62 62 62 62 62 43 43 39 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 45 45 45 52 52 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 62 62 52 52 52 52 43 43 44 44 68 68 68 62 44 39 39 43 43 62 62 62 62 52 43 62 62 62 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 59 59 43 52 52 43 62 62 68 68 68 62 62 62 52 52 52 52 62 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 52 52 62 44 44 68 62 44 44 43 45 52 43 43 43 45 43 43 43 59 59 68 68 68 68 62 62 52 52 52 57 57 44 57 35 43 43 43 43 44 44 57 68 57 57 57 57 57 57 57 68 68 68 68 57 57 52 52 52 57 52 52 52 52 52 52 57 57 37 37 57 57 57 57 59 59 57 57 57 52 43 43 44 44 57 57 57 68 57 59 52 52 52 52 57 57 57 57 59 59 68 68 68 57 57 43 50 43 32 32 44 44 57 44 43 43 44 57 57 57 57 57 57 42 42 31 44 42 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 44 42 31 30 37 37 43 46 43 59 57 57 54 57 57 54 57 57 43 43 43 43 43 43 43 43 43 43 39 43 37 43 43 43 39 37 37 37 37 33 33 28 28 28 24 32 34 43 41 31 29 32 36 36 33 39 39 40 40 40 40 41 37 31 31 18 14 15 25 20 22 22 22 29 37 37 33 28 28 17 17 11 11 11 19 15 19 27 20 22 22 12 13 9 14 14 18 13 19 16 15 19 22 22 11 17 19 19 15 19 25 29 19 19 21 26 19 24 24 26 17 12 11 9 10 8 7 7 10 13 14 21 22 26 20 16 16 12 12 11 9 9 8 8 8 8 10 10 11 19 23 24 28 23 23 21 12 12 15 14 11 12 10 10 10 12 11 16 10 8 8 8 8 9 12 10 9 9 9 9 9 10 11 12 14 17 14 14 11 10 8 10 6 6 6 6 12 11 11 8 8 6 6 8 8 6 6 7 8 7 6 8 7 7 7 7 10 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no415_f04.b1 MSMg01no415_f04.b1 CHROMAT_FILE:
MSMg01no415_f04.b1 PHD_FILE: MSMg01no415_f04.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:33:40 2005
         (624 letters)



>mm_chrX_90616959_90617981
          Length = 1023

 Score = 1158 bits (599), Expect = 0.0
 Identities = 614/619 (99%), Gaps = 1/619 (0%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattcccagatgaaaatgaggtcacacgagtgatttcagggatttgggaaaattgttcc 64
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 822 gaattcccagaggaaaatgaggtcacacgagtgatttcagggatttgggaaaattgttcc 763

                                                                       
Query: 65  tagtaaatagtactgtttattactggtaaatggctttaagaaaagcagaactctgtattg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 762 tagtaaatagtactgtttattactggtaaatggctttaagaaaagcagaactctgtattg 703

                                                                       
Query: 125 tctgcttttgactcaggtgtgccataaattaaacttataaaacttccttcatacttttac 184
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 702 tctgc-tttgactcaggtgtgccataaattaaacttataaaacttccttcatacttttac 644

                                                                       
Query: 185 atattgcttatatagattccacacgttgcaaataactacaggcaaatgtctgtcatttgg 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 643 atattgcttatatagattccacacgttgcaaataactacaggcaaatgtctgtcatttgg 584

                                                                       
Query: 245 ctgatacaaagcttgaactcgaagaatatcagttctttggactgatgagtgagccaagct 304
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 583 ctgatacaaagcttgaactcgaagaatatcagttctttggactgatgagtgagccaagct 524

                                                                       
Query: 305 gactgcttctcacacttgttcagggccctagtcttatcttgctatcagctgagcagtttg 364
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 gactgcttctcacacttgttcagggccctagtcttatcttgctatcagctgagcagtttg 464

                                                                       
Query: 365 cccataaaatgagcacagctgcattactctgagaaaatggtctccaaggaaggcagtgat 424
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 463 cccataaaatgagcacagctgtattactctgagaaaatggtctccaaggaaggcagtgat 404

                                                                       
Query: 425 tagttctaaaacatgaaggggattataaaggtactctctttcttgaaaccagaagataag 484
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 403 tagttctaaaacatgaaggggattataaaggtactctctttcttgaaaccagaagataag 344

                                                                       
Query: 485 gattttactgtaggaattatttgcaatttggagatgtctaagcatctcgagtcaggttgc 544
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 gattttactgtaggaattatttgcaatttggagatgtctaagcatctcgagtcaggttgc 284

                                                                       
Query: 545 ctttcggtattaaggatttctattccttggactgctaaagtcaacatgcaggaaagctca 604
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 283 ctttcggtattaaggatttctatttcttggactgctaaagtcaacatgcaggaaggctca 224

                              
Query: 605 ttattgctagaagtactga 623
           |||||||||||||||||||
Sbjct: 223 ttattgctagaagtactga 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 30
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 624
Length of database: 1023
Length adjustment: 10
Effective length of query: 614
Effective length of database: 1013
Effective search space:   621982
Effective search space used:   621982
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information