MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-505M17
Chromosome	X (Build37)
Map Location	147,683,150 - 147,683,836
singlet/doublet	singlet
Overlap gene	Wnk3
Upstream gene	LOC333588, Tmem29, LOC100040101, Alas2, Apex2, Pfkfb1, Tro, LOC100039716, Maged2, Itih5l, LOC667021, Gnl3l, Fgd1, Tsr2, LOC100040221, EG667027, LOC675278
Downstream gene	ORF34, LOC623804, LOC100039760, Phf8, LOC385448, LOC237116, Huwe1, LOC675514, Hsd17b10, Ribc1, Smc1a, LOC100040394, Iqsec2, Jarid1c
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC333588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:333588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Tmem29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 1 Protein

name	LOC100040101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Alas2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11656 MGI:87990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apex2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77622 MGI:1924872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkfb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18639 MGI:107816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tro (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56191 MGI:1928994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Maged2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80884 MGI:1933391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itih5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634882 MGI:2685232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins pseudo : _no_value

name	LOC667021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Gnl3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237107 MGI:2448557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14163 MGI:104566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69499 MGI:1916749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG667027 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667027 MGI:3648636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Wnk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279561 MGI:2652875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 5 Proteins

name	LOC675278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1041 ESTs, 10 Proteins

name	ORF34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207375 MGI:2387687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 236 ESTs, 9 Proteins pseudo : _no_value

name	LOC100039760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Phf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320595 MGI:2444341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins pseudo : _no_value

name	LOC237116 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:237116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Huwe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59026 MGI:1926884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 505 ESTs, 23 Proteins pseudo : _no_value

name	Hsd17b10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15108 MGI:1333871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ribc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66611 MGI:1913861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24061 MGI:1344345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 140 ESTs, 9 Proteins pseudo : _no_value

name	Iqsec2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245666 MGI:3528396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jarid1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20591 MGI:99781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC333588 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272484 GeneID:333588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC333588 transcript_id : XM_001474045.1

name	Tmem29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408378 GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein product : transmembrane protein 29, transcript variant 1 transcript_id : XM_356361.4

name	Tmem29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408377 GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 1 Protein product : transmembrane protein 29, transcript variant 2 transcript_id : XM_898013.2

name	LOC100040101 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272487 GeneID:100040101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040101 transcript_id : XM_001474106.1

name	Alas2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130319 GeneID:11656 MGI:87990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminolevulinic acid synthase 2, erythroid transcript_id : NM_009653.2

name	Apex2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21541817 GeneID:77622 MGI:1924872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apurinic/apyrimidinic endonuclease 2 transcript_id : NM_029943.1

name	Pfkfb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361607 GeneID:18639 MGI:107816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 1 transcript_id : NM_008824.2

name	Tro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110618257 GeneID:56191 MGI:1928994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophinin transcript_id : NM_019548.3

name	Tro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110618254 GeneID:56191 MGI:1928994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophinin transcript_id : NM_001002272.2

name	Maged2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507637 GeneID:80884 MGI:1933391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family D, 2 transcript_id : NM_030700.1

name	Gnl3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674223 GeneID:237107 MGI:2448557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein-like 3 (nucleolar)-like transcript_id : NM_198110.1

name	Fgd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131060 GeneID:14163 MGI:104566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 1 transcript_id : NM_008001.3

name	Tsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352950 GeneID:69499 MGI:1916749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) transcript_id : NM_175146.3

name	Wnk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408422 GeneID:279561 MGI:2652875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 5 Proteins product : WNK lysine deficient protein kinase 3, transcript variant 3 transcript_id : XM_909586.2

name	LOC675278 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272493 GeneID:675278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1040 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 1 transcript_id : XM_001474457.1

name	LOC675278 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272495 GeneID:675278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 612 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 2 transcript_id : XM_001474478.1

name	ORF34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723306 GeneID:207375 MGI:2387687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 34 transcript_id : NM_198105.2

name	LOC100039760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272439 GeneID:100039760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to ribosomal protein L39 transcript_id : XM_001473449.1

name	Phf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803266 GeneID:320595 MGI:2444341
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 8 transcript_id : NM_177201.3

name	Huwe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676189 GeneID:59026 MGI:1926884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HECT, UBA and WWE domain containing 1 transcript_id : NM_021523.3

name	Hsd17b10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61888837 GeneID:15108 MGI:1333871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 10 transcript_id : NM_016763.2

name	Ribc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385123 GeneID:66611 MGI:1913861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIB43A domain with coiled-coils 1 transcript_id : NM_025660.1

name	Smc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790236 GeneID:24061 MGI:1344345
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : structural maintenance of chromosomes 1A transcript_id : NM_019710.1

name	Iqsec2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53832027 GeneID:245666 MGI:3528396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif and Sec7 domain 2 transcript_id : NM_001005475.1

name	Jarid1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475590 GeneID:20591 MGI:99781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji, AT rich interactive domain 1C (Rbp2 like) transcript_id : NM_013668.2

name	LOC333588 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272485 GeneID:333588
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474095.1

name	Tmem29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004391 GeneID:382245 MGI:1923420
definition	codon_start : 1 product : similar to chromosome X open reading frame 44, isoform 1 protein_id : XP_356361.3

name	Tmem29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004389 GeneID:382245 MGI:1923420
definition	codon_start : 1 product : similar to chromosome X open reading frame 44, isoform 2 protein_id : XP_903106.1

name	LOC100040101 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272488 GeneID:100040101
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474156.1

name	Alas2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859502 GeneID:11656 MGI:87990
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0003870 - 5-aminolevulinate synthase activity [Evidence IMP] [Evidence ISS] [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0006783 - heme biosynthesis [Evidence IEA] [Evidence IMP]; GO:0006879 - iron ion homeostasis [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : erythroid-specific ALAS; 5-aminolevulinate synthase product : aminolevulinic acid synthase 2, erythroid protein_id : NP_033783.1

name	Apex2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21541818 CCDS:CCDS30463.1 GeneID:77622 MGI:1924872
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : AP endonuclease 2 protein_id : NP_084219.1

name	Pfkfb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315988 CCDS:CCDS30464.1 GeneID:18639 MGI:107816
definition	GO_component : GO:0043540 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex [Evidence ISS] GO_function : GO:0003873 - 6-phosphofructo-2-kinase activity [Evidence ISS] [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004331 - fructose-2,6-bisphosphate 2-phosphatase activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006003 - fructose 2,6-bisphosphate metabolism [Evidence ISS] [Evidence IEA]; GO:0006094 - gluconeogenesis [Evidence ISS]; GO:0006096 - glycolysis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : PFK-2/FBPase-2 gene A; 6-phosphofructo-2-kinase/fructose-2,6-biphosphata se 1 product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 1 protein_id : NP_032850.1

name	Tro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50593514 GeneID:56191 MGI:1928994
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; necdin and trophinin like; trophinin-2; magphinin-alpha; magphinin-gamma; magphinin-beta 2; melanoma antigen, family D, 3-like product : trophinin isoform 3 protein_id : NP_062421.2

name	Tro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50593518 CCDS:CCDS30465.1 GeneID:56191 MGI:1928994
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; necdin and trophinin like; trophinin-2; magphinin-alpha; magphinin-gamma; magphinin-beta 2; melanoma antigen, family D, 3-like product : trophinin isoform 1 protein_id : NP_001002272.1

name	Maged2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507638 CCDS:CCDS30466.1 GeneID:80884 MGI:1933391
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 function : unknown product : melanoma antigen family D, 2 protein_id : NP_109625.1

name	Gnl3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674224 GeneID:237107 MGI:2448557
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein-like 3 (nucleolar)-like protein_id : NP_932778.1

name	Fgd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982367 CCDS:CCDS30467.1 GeneID:14163 MGI:104566
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : faciogenital dysplasia product : faciogenital dysplasia homolog protein_id : NP_032027.2

name	Tsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424736 CCDS:CCDS30468.1 GeneID:69499 MGI:1916749
definition	codon_start : 1 product : TSR2, 20S rRNA accumulation, homolog protein_id : NP_780355.1

name	Wnk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408423 GeneID:279561 MGI:2652875
definition	codon_start : 1 note : overriding stop codons product : similar to Serine/threonine-protein kinase WNK3 (Protein kinase with no lysine 3) (Protein kinase, lysine-deficient 3) isoform 3 protein_id : XP_914679.2 transl_except : (pos:147671256..147671258,aa:OTHER)

name	LOC675278 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272494 GeneID:675278
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474507.1

name	LOC675278 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272496 GeneID:675278
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474528.1

name	ORF34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723307 GeneID:207375 MGI:2387687
definition	codon_start : 1 note : C9orf10-like product : hypothetical protein LOC207375 protein_id : NP_932773.2

name	LOC100039760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272440 GeneID:100039760
definition	codon_start : 1 product : similar to ribosomal protein L39 protein_id : XP_001473499.1

name	Phf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893223 CCDS:CCDS30470.1 GeneID:320595 MGI:2444341
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PHD finger protein 8 protein_id : NP_796175.1

name	Huwe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676190 GeneID:59026 MGI:1926884
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0016574 - histone ubiquitination [Evidence ISS]; GO:0051028 - mRNA transport [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0000209 - protein polyubiquitination [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : upstream regulatory element binding protein 1; Mcl-1 ubiquitin ligase product : HECT, UBA and WWE domain containing 1 protein_id : NP_067498.3

name	Hsd17b10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61888838 CCDS:CCDS30471.1 GeneID:15108 MGI:1333871
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0047015 - 3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity [Evidence IEA]; GO:0003857 - 3-hydroxyacyl-CoA dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : hydroxyacyl-Coenzyme A dehydrogenase, type II product : hydroxyacyl-Coenzyme A dehydrogenase type II protein_id : NP_058043.3

name	Ribc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385124 CCDS:CCDS30472.1 GeneID:66611 MGI:1913861
definition	GO_component : GO:0019861 - flagellum [Evidence IEA] codon_start : 1 product : RIB43A domain with coiled-coils 1 protein_id : NP_079936.1

name	Smc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790237 CCDS:CCDS30473.1 GeneID:24061 MGI:1344345
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0008280 - cohesin core heterodimer [Evidence ISS]; GO:0000776 - kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0003777 - microtubule motor activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0000075 - cell cycle checkpoint [Evidence ISS]; GO:0051301 - cell division [Evidence IEA]; GO:0051276 - chromosome organization and biogenesis [Evidence IEA]; GO:0042770 - DNA damage response, signal transduction [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS] [Evidence IEA]; GO:0007126 - meiosis [Evidence IPI] [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA]; GO:0007064 - mitotic sister chromatid cohesion [Evidence ISS]; GO:0007052 - mitotic spindle organization and biogenesis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0009314 - response to radiation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : chromosome segregation protein SmcB; segregation of mitotic chromosomes b; SMC; SMC (segregation of mitotic chromosomes 1)-like 1 product : SMC1 structural maintenance of chromosomes 1-like 1 protein_id : NP_062684.1

name	Iqsec2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53832028 GeneID:245666 MGI:3528396
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : IQ motif and Sec7 domain 2 protein_id : NP_001005475.1

name	Jarid1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094117 GeneID:20591 MGI:99781
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : selected mouse cDNA on the X product : jumonji, AT rich interactive domain 1C (Rbp2 like) protein_id : NP_038696.1

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 6 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 5 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 4 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 3 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 2 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 1 pseudo : _no_value

name	LOC100040221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040221
definition	number : 1 pseudo : _no_value

name	EG667027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667027
definition	number : 1 pseudo : _no_value

name	LOC385448 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385448
definition	number : 1 pseudo : _no_value

name	LOC237116 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:237116
definition	number : 1 pseudo : _no_value

name	LOC100039716 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272438 GeneID:100039716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to ribosomal protein L13 pseudo : _no_value transcript_id : XR_031183.1

name	Itih5l (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272489 GeneID:634882 MGI:2685232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins product : inter-alpha (globulin) inhibitor H5-like pseudo : _no_value transcript_id : XR_031663.1

name	LOC623804 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272497 GeneID:623804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 236 ESTs, 9 Proteins product : similar to CDK105 pseudo : _no_value transcript_id : XR_031778.1

name	LOC675514 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272501 GeneID:675514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 505 ESTs, 23 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_031853.1

name	LOC100040394 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272502 GeneID:100040394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 140 ESTs, 9 Proteins product : similar to ubiquitin-conjugating enzyme E2L 3 pseudo : _no_value transcript_id : XR_031871.1

clone name	MSMg01-083G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-496H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236F15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-505M17.T7 (MSMg01no505_m17.b1)	MSMg01-505M17.TJ (MSMg01no505_m17.g1)
ACC	AG580344	AG580345
length	773	788
length of high quality (start - end)	691 (47 - 737)	244 (78 - 321)
definition	CHROMAT_FILE: MSMg01no505_m17.b1 PHD_FILE: MSMg01no505_m17.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:33:47 2005	CHROMAT_FILE: MSMg01no505_m17.g1 PHD_FILE: MSMg01no505_m17.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:33:47 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCG GAATTCCAGTATTTCCACACTGATTCCAAACAAGAATAGGCAAAGCTGTA TTTTTGCAGTAGTAGTTTCTTTACATAGGACATAGTGTTCTAGGATTTAG TTATTTGAAATAAATGGGTCCATAAGGCATTTTGAATCAGAATATCTCTC TTTGGGCAGATTTCATGTGTTTTGTATTTCCTCTCCATAATTAAGATATT CCCTGGCAACTTATTTGAAAATCTTTAGAGATCAGAATAGGTGAATATAA CCTTATATCTTAAATTGTATTATTAATTTTTGTTATATAATTCTCTATTA CAAGCCTACTTTGGTAATCAGGTTGAGCTTGAAGGCTGTAGCTTTTCTAT TTGATACAGAATATTACTTCATTGTTTTATTGCCATCTTATTTCCTGATG CATTTCAAAGGTGAAGTAATTTAACTGTAACATAGGTATCCTTAAGTAGG AATCAGTATTTTTTGTTTAAATTTATATCCAGTAAAAAACATACATCATA ATTCAGTAAATTTTGACAAATGCTAAGCAGCCAAAGCATATATGCAACCA AAGCTATTGTCAGGATGGGTATATTTCACACATTGATAAACTTCCTGTAA AAATCTAGACAGTGGCTTAAGATTTGTATAGCTTATAATCTTTGGTGCAA CTTCTTTAGTTGTGCTATTTTATACATGAAAGGAATCATAGATAAATTGT AAGCATACTAGCATCACTGTCTT	NACGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXAAGGCAAGTTTGAGCTATATACT GAGTTCTAGGTCAGCCAGGGATACACAGTGAGACCATGTCTCAATACAAA AACAAATAATAAATCAAAAGTAAGAGGTAGGCTGGGGAATCAGGCCTGGC AACTCATAGCTGTACTCCCAGCACTTGGGAGGCTGAGAAAGGGAGTGAGG GAAGGAGGGAGGGAAGGAGAGAGGGAGGGAAAGACTAGAAGGAAATGAGG GAAGAAAGAATAAAGAAGATTTTTTTTTTGAAAGAAAAGGGCTGAGCAGG NACCTGCATGGTACAGCATTTGCCTATCGTGTGAAGGACCCTACGTCCCA CCCTAGTACTACATAAATAAGTAAGTAAATAGATAAAGCGTAAGGTCTAT TGAGAACACTTGAGAAAGCCTAACTATATAGGAAGGGGGTCAATGAAATG TAATTTCTCCTCCCCTGAACATGACCCCCACGGGAATACTTACCATGTAT TTAAACTAACAAATTCTTTATACATTTCTACCCGCTAACTTATATGTTAT GAGGTTCCGCTACATGGAATCAACAGGCACTGTGTTGCTTGCTATGGTAA CCTGGCAAACTGATATCCTTTTTTTGCATCCTCTATTATTTGTAAGCCTA GATCATCTCTCTTATACGGTTTTTAGATTTCATTCTTGTATAACTGCGTG GAAGCCCCAATCCTTGTTCACCTTATACTCCTTTTCCN
quality values	Open. Hide. 10 10 10 10 9 9 14 15 18 24 39 37 37 37 31 31 37 37 37 35 29 41 37 37 41 46 28 25 23 19 15 9 9 9 15 11 13 14 17 24 22 19 17 18 14 16 21 37 48 48 35 31 31 28 31 28 30 21 21 10 12 11 12 10 12 10 12 12 22 21 30 33 33 33 28 28 28 32 32 36 36 38 38 42 53 53 53 53 53 53 50 57 57 57 57 68 68 68 68 68 68 68 68 68 51 51 50 50 68 68 68 68 68 68 68 54 54 57 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 50 50 50 50 51 68 68 68 68 68 51 51 51 68 51 51 68 68 68 68 68 68 68 68 57 59 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 57 57 50 50 37 50 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 48 57 57 54 54 48 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 57 48 48 42 59 59 68 68 68 68 68 68 57 57 57 57 57 57 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 23 19 8 8 8 10 16 34 41 59 59 59 59 59 53 53 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 57 57 57 57 57 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 59 59 59 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 48 48 57 57 68 68 68 68 57 57 43 43 41 57 57 68 68 68 68 68 68 68 68 57 57 43 43 43 57 57 59 59 68 57 57 54 54 57 57 54 54 54 57 57 57 59 59 57 48 46 43 43 48 48 57 57 54 54 54 57 48 48 39 39 39 43 59 48 48 42 59 47 59 48 43 37 39 35 35 35 59 47 48 48 48 59 47 47 39 41 36 36 30 30 25 30 30 37 37 47 46 46 39 43 31 31 31 37 29 31 35 37 37 39 39 41 41 43 43 48 43 43 43 43 43 43 43 48 48 57 48 48 48 48 59 48 46 46 46 46 37 39 31 31 25 31 39 39 41 41 34 34 28 28 28 28 28 28 28 24 30 34 39 39 31 22 26 14 15 14 27 24 31 30 37 33 39 39 39 37 32 32 26 27 32 31 28 28 31 28 17 16 15 21 18 22 30 34 37 32 25 20 23 21 21 17 24 14 14 17 25 25 39 32 37 39 37 41 34 34 25 25 25 34 29 32 39 32 29 29 22 30 23 16 18 26 22 15 21 17 24 26 26 30 28 22 22 31 31 35 36 36 39 34 34 23 23 28 23 25 17 17 17 29 21 21 16 19 19	Open. Hide. 0 3 6 6 6 13 10 8 8 8 8 13 23 30 29 32 32 29 29 35 39 30 37 37 37 39 37 37 37 44 27 23 7 6 6 7 6 6 8 8 8 8 8 10 11 12 11 18 28 34 33 36 33 33 33 33 42 33 25 15 9 6 6 6 6 6 6 17 21 30 28 16 18 24 28 30 30 33 33 36 48 53 53 53 57 57 57 57 59 59 57 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 53 50 50 50 50 54 57 50 46 46 48 48 48 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 46 43 57 57 68 68 68 68 57 57 57 57 50 50 51 51 51 51 68 51 50 50 50 50 41 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 43 59 59 59 59 59 59 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 59 59 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 59 57 57 57 68 68 68 68 68 68 57 57 47 48 46 46 46 47 48 54 54 54 54 59 57 57 57 57 57 57 57 50 50 53 50 47 47 50 57 59 59 59 59 59 59 59 59 59 41 24 27 9 9 9 16 16 28 28 37 41 39 37 37 47 47 59 59 48 48 48 59 48 57 48 48 48 47 47 48 46 46 47 29 21 11 10 12 9 11 9 11 11 11 9 10 11 11 11 12 20 28 37 43 48 48 47 47 48 48 30 30 18 15 15 18 18 3 0 3 23 23 41 47 47 46 46 28 27 14 14 12 12 12 13 18 21 34 37 36 39 43 40 40 19 19 13 15 15 41 32 42 43 37 30 22 17 14 19 21 15 13 13 19 21 24 28 30 29 25 21 21 16 16 16 24 15 20 15 19 11 11 11 15 15 12 12 11 12 11 11 12 12 19 24 21 15 10 10 10 11 17 25 13 10 6 6 8 12 8 11 10 12 9 8 8 7 6 8 8 12 12 12 18 15 15 11 12 11 12 11 13 13 10 10 6 6 6 6 6 10 10 11 12 12 13 18 12 10 10 12 16 13 16 19 14 12 18 11 11 11 22 19 19 17 11 11 11 11 9 10 10 13 14 17 10 9 9 9 12 22 28 31 32 23 18 15 11 11 10 10 10 10 9 14 15 11 11 11 13 9 9 9 10 9 10 10 10 10 10 10 11 9 7 6 7 7 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 7 10 10 8 8 8 8 8 9 9 13 10 8 8 8 8 10 12 11 8 8 7 6 8 8 8 8 8 8 8 9 9 9 12 18 23 12 10 10 10 9 9 9 10 12 10 8 8 8 9 8 8 9 9 10 10 10 10 10 9 15 15 14 10 12 8 8 8 11 11 10 10 8 8 8 8 8 8 8 8 9 9 11 12 8 8 8 8 8 8 10 9 11 9 6 8 6 6 8 8 10 10 10 10 9 8 8 8 8 8 8 8 12 10 8 8 8 9 11 11 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 8 8 8 8 8 10 10 10 10 8 6 6 8 8 11 11 11 16 14 20 20 19 19 12 10 10 8 8 10 15 8 8 9 9 9 11 10 12 13 12 10 10 10 9 9 9 9 10 10 8 6 6 6 8 8 8 8 6 6 8 6 6 6 6 8 8 9 10 10 12 16 9 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no505_m17.b1 MSMg01no505_m17.b1 CHROMAT_FILE:
MSMg01no505_m17.b1 PHD_FILE: MSMg01no505_m17.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:33:47 2005
         (691 letters)



>mm_chrX_147682946_147684036
          Length = 1091

 Score = 1297 bits (671), Expect = 0.0
 Identities = 683/687 (99%)
 Strand = Plus / Plus

                                                                       
Query: 5   gaattccagtatttccacactgattccaaacaagaataggcaaagctgtatttttgcagt 64
           |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 205 gaattccagtatgtacacactgattccaaacaagaataggcaaagctgtatttttgcagt 264

                                                                       
Query: 65  agtagtttctttacataggacatagtgttctaggatttagttatttgaaataaatgggtc 124
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 265 agtagtttctttacataggacatagtgttctaggattgagttatttgaaataaatgggtc 324

                                                                       
Query: 125 cataaggcattttgaatcagaatatctctctttgggcagatttcatgtgttttgtatttc 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 325 cataaggcattttgaatcagaatatctctctttgggcagatttcatgtgttttgtatttc 384

                                                                       
Query: 185 ctctccataattaagatattccctggcaacttatttgaaaatctttagagatcagaatag 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 385 ctctccataattaagatattccctggcaacttatttgaaaatctttagagatcagaatag 444

                                                                       
Query: 245 gtgaatataaccttatatcttaaattgtattattaatttttgttatataattctctatta 304
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 445 gtgaatataaccttatatcttaaattgtataattaatttttgttatataattctctatta 504

                                                                       
Query: 305 caagcctactttggtaatcaggttgagcttgaaggctgtagcttttctatttgatacaga 364
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 505 caagcctactttggtaatcaggttgagcttgaaggctgtagcttttctatttgatacaga 564

                                                                       
Query: 365 atattacttcattgttttattgccatcttatttcctgatgcatttcaaaggtgaagtaat 424
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 565 atattacttcattgttttattgccatcttatttcctgatgcatttcaaaggtgaagtaat 624

                                                                       
Query: 425 ttaactgtaacataggtatccttaagtaggaatcagtattttttgtttaaatttatatcc 484
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 625 ttaactgtaacataggtatccttaagtaggaatcagtattttttgtttaaatttatatcc 684

                                                                       
Query: 485 agtaaaaaacatacatcataattcagtaaattttgacaaatgctaagcagccaaagcata 544
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 685 agtaaaaaacatacatcataattcagtaaattttgacaaatgctaagcagccaaagcata 744

                                                                       
Query: 545 tatgcaaccaaagctattgtcaggatgggtatatttcacacattgataaacttcctgtaa 604
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 745 tatgcaaccaaagctattgtcaggatgggtatatttcacacattgataaacttcctgtaa 804

                                                                       
Query: 605 aaatctagacagtggcttaagatttgtatagcttataatctttggtgcaacttctttagt 664
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 805 aaatctagacagtggcttaagatttgtatagcttataatctttggtgcaacttctttagt 864

                                      
Query: 665 tgtgctattttatacatgaaaggaatc 691
           |||||||||||||||||||||||||||
Sbjct: 865 tgtgctattttatacatgaaaggaatc 891


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 37
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 691
Length of database: 1091
Length adjustment: 10
Effective length of query: 681
Effective length of database: 1081
Effective search space:   736161
Effective search space used:   736161
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information