MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-509B07
Chromosome	X (Build37)
Map Location	47,025,248 - 47,025,919
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gpr119, Rbmx2, LOC665752, Gm595, EG637758, LOC100040295, Enox2, 1100001E04Rik, LOC100041697
Downstream gene	Olfr1320, Olfr1321, Igsf1, Olfr1322, LOC100040344, Olfr1323, EG665816, Olfr1324, LOC100041788, 6720401G13Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gpr119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236781 MGI:2668412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbmx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209003 MGI:1919414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Gm595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209005 MGI:2685441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG637758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637758 MGI:3645144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100040295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Enox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209224 MGI:2384799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1100001E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins pseudo : _no_value

name	Olfr1320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Olfr1322 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr1323 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665816 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665816 MGI:3646089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 157 ESTs, 8 Proteins pseudo : _no_value

name	Olfr1324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258289 MGI:3031158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	6720401G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103012 MGI:2147989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gpr119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186468 GeneID:236781 MGI:2668412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 119 transcript_id : NM_181751.2

name	Rbmx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374001 GeneID:209003 MGI:1919414
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein, X-linked 2 transcript_id : NM_173376.2

name	Gm595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407353 GeneID:209005 MGI:2685441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : gene model 595, (NCBI) transcript_id : XM_150403.6

name	EG637758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271530 GeneID:637758 MGI:3645144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG637758 transcript_id : XM_979282.2

name	LOC100040295 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271532 GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001474449.1

name	Enox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801702 GeneID:209224 MGI:2384799
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecto-NOX disulfide-thiol exchanger 2 transcript_id : NM_145951.3

name	1100001E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487452 GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1100001E04 gene transcript_id : NM_001081123.1

name	Olfr1320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529460 GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1320 transcript_id : NM_207240.2

name	Olfr1321 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421340 GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1321 transcript_id : NM_207631.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34330163 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177591.3

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281998 GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183336.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41282008 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183335.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343783 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177915.3

name	Olfr1322 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801353 GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1322 transcript_id : NM_001011794.1

name	Olfr1323 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239073 GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1323 transcript_id : NM_146390.1

name	Olfr1324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129700 GeneID:258289 MGI:3031158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1324 transcript_id : NM_146292.1

name	6720401G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271534 GeneID:103012 MGI:2147989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 6720401G13 gene transcript_id : XM_001474597.1

name	Gpr119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32306530 CCDS:CCDS30113.1 GeneID:236781 MGI:2668412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 119 product : G-protein coupled receptor 119 protein_id : NP_861416.1

name	Rbmx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734072 CCDS:CCDS30114.1 GeneID:209003 MGI:1919414
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein, X-linked 2 protein_id : NP_775552.1

name	Gm595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001004 GeneID:209005 MGI:2685441
definition	codon_start : 1 product : hypothetical protein protein_id : XP_150403.5

name	EG637758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271531 GeneID:637758 MGI:3645144
definition	codon_start : 1 product : similar to hCG2001000 protein_id : XP_984376.2

name	LOC100040295 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271533 GeneID:100040295
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001474499.1

name	Enox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122383 CCDS:CCDS30115.1 GeneID:209224 MGI:2384799
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence ISS] [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007624 - ultradian rhythm [Evidence ISS] codon_start : 1 product : cytosolic ovarian carcinoma antigen 1 protein_id : NP_666063.1

name	1100001E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487453 GeneID:75404 MGI:1922654
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Novel RhoGAP domain containing protein product : hypothetical protein LOC75404 protein_id : NP_001074592.1

name	Olfr1320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529461 CCDS:CCDS30116.1 GeneID:236784 MGI:3031154
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2Q64A-11736563-11737522 product : olfactory receptor 1320 protein_id : NP_997123.2

name	Olfr1321 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421341 CCDS:CCDS30117.1 GeneID:236785 MGI:3031155
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11768161-11767223; GA_x5J8B7W1V10-1157-554 product : olfactory receptor 1321 protein_id : NP_997514.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330164 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : long isoform is encoded by transcript variant 1; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 long isoform protein_id : NP_808259.2

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281999 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 4 protein_id : NP_899179.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41282009 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 3 protein_id : NP_899178.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244558 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : short isoform is encoded by transcript variant 2; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 short isoform protein_id : NP_808583.1

name	Olfr1322 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801354 CCDS:CCDS30118.1 GeneID:257978 MGI:3031156
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11927171-11926215; olfactory receptor MOR264-16P product : olfactory receptor 1322 protein_id : NP_001011794.1

name	Olfr1323 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239074 CCDS:CCDS30119.1 GeneID:258385 MGI:3031157
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-12051754-12050825; olfactory receptor MOR216-1 product : olfactory receptor 1323 protein_id : NP_666502.1

name	Olfr1324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129701 CCDS:CCDS30120.1 GeneID:258289 MGI:3031158
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-12454598-12453654; olfactory receptor MOR128-2 product : olfactory receptor 1324 protein_id : NP_666404.1

name	6720401G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271535 GeneID:103012 MGI:2147989
definition	codon_start : 1 product : hypothetical protein LOC103012 protein_id : XP_001474647.1

name	LOC665752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665752
definition	number : 1 pseudo : _no_value

name	LOC665752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665752
definition	number : 2 pseudo : _no_value

name	LOC100040344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040344
definition	number : 1 pseudo : _no_value

name	LOC100041788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041788
definition	number : 1 pseudo : _no_value

name	LOC100041697 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271560 GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins product : hypothetical protein LOC100041697 pseudo : _no_value transcript_id : XR_032928.1

name	EG665816 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407360 GeneID:665816 MGI:3646089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 157 ESTs, 8 Proteins product : predicted gene, EG665816 pseudo : _no_value transcript_id : XR_001793.1

clone name	MSMg01-139P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-509B07.T7 (MSMg01no509_b07.b1)	MSMg01-509B07.TJ (MSMg01no509_b07.g1)
ACC	AG582842	AG582843
length	747	759
length of high quality (start - end)	676 (50 - 725)	560 (82 - 641)
definition	CHROMAT_FILE: MSMg01no509_b07.b1 PHD_FILE: MSMg01no509_b07.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:38:13 2005	CHROMAT_FILE: MSMg01no509_b07.g1 PHD_FILE: MSMg01no509_b07.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:38:13 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NNAACTTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXC GCGGAATTCTCCTATTCTTTAGGTCAGTTCATCTTTGTGACCCAGGAACA GAACTGGTGAGGTGACCACACAGAAGTTTCAAGTGTGGTCCAGATTTCCC TATACAATGTTACAATTGGTCCCAAAGAGCTCAAAACCTCTATCTAGGCC TCATTAATGCTACCTATTCTTTTGGGCTATACAACCCCTAGGGTATTCTT TGGGATAACTGTGCTATATTTCTTGGAATCCCTGATTTCCATCTCTGTTC TCTTTATATGATATAGGAAGATCAACTTTATAGAGACAAGAAAGTGGAAC ACATTCTAATATAAAGCAAAATAAGCTTGCATAATCGGGATTGGATTCCA AAAGTCATCTCTTTGTCTGGAAGAATATTAGGAACTGAATCAAGAGTGGA AGATATGGGAATAGCTACAGGCAGGAATTAGTAATAACTAACCCTATGGA AAGAAGTAGGCTGGGGTATTACCTGCCAACAGGTATGGTCATTGATCTAT GTATCAGTGGGCCTGAAAAGAAGAGTGGATGACAGAACCAATTGTGGAGG CAACTTCCTGACTTGAAAATAATCTTATAAGACTTATCAAATCCTTTTAG TGTTTTTCTTTAACAGAAAGAATCCTACTTCTAGAACTAGAAATTGGTTT CAATATAGGAGGCCTTATGTTGGTCTAATAGTTGTGATGTACACAAG	NNNNCCCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGTTTTATCATGGAATACT TTGGTTTCTCCATCTATGGTAATTGAAAGTTTTGCTGGGTACAGTAGCCT GGGCTGGCATTTGTGTTCTCTTAGGGTCTGCATAACATCTGTCCAGGATC TTCTGGCTTTCATAGTCTCTGGTGAGAAATCCAGAGTAATTCTAATAGGC CTGCTTTTATATGTTACTTGACCCCTTTCCCTTACTGCTTTTAATATTCT GTCTTTATTTAGTGTATTTGTTGTTCTGATTATTATGTGTCAGGAGGAAT TTCTTTTCTGGTCTAGTGTATTTGGAGTTCTGTAGGCTTCTTATATGTTC ATGGGCATCTCTTTCTTTAGGTTAGGGAAGTTTTCTTCTATAATTTTGTT GAAGATATCTATTGGCCCTTTAAAATCTTCATTCTCATCTACTCCTATTA TCCGTAGTTTTGGTCTTCTCGTTGTGTCCTGGATTTCCTGGATGTTTTGA GTTAGGATCTTTTTGCATTTTGCATTTTCTTTGATTGTTGTGTTCATATT CCCTGTGGAATCTTCTGACCCTGAGATTCTCTCTTCCATCTCTTATATTC TGTTGCTGATGCTTGAATATATGGTTCCTGATTTTCTTTCTAGGGTTTCT ATCTCCAGAGATGTCTCCCTTTGGATTTTCTTCATTGGTGAAACTTCCAT TTTTAGATT
quality values	Open. Hide. 0 0 3 6 6 6 8 6 8 11 16 14 19 28 24 15 15 18 14 12 15 10 10 8 13 13 33 39 41 30 20 22 17 17 8 11 8 11 9 8 8 8 10 12 11 11 16 16 20 20 37 43 46 33 33 36 33 33 33 47 39 39 23 23 9 9 9 9 15 18 18 16 19 26 26 30 37 36 28 33 33 34 34 43 44 44 59 47 44 40 39 26 26 13 26 26 26 23 29 25 43 43 39 39 43 46 46 68 68 68 68 68 44 44 37 33 28 28 28 19 21 15 32 35 57 68 35 34 26 35 35 43 43 68 68 68 44 44 25 20 31 19 34 34 34 34 39 37 35 35 35 44 44 43 35 35 50 50 68 43 44 37 35 35 44 44 68 44 44 29 27 38 33 28 44 44 59 59 43 43 33 38 31 44 44 43 27 33 35 35 35 57 42 42 42 44 44 38 33 33 42 35 35 59 44 68 57 57 52 52 43 43 39 39 43 59 59 39 35 35 59 44 68 59 59 35 35 43 41 44 39 31 27 35 35 35 35 24 24 34 34 68 68 68 43 43 35 35 35 44 41 68 68 68 68 44 44 52 43 43 62 62 45 52 52 62 62 68 62 62 43 41 41 43 43 68 44 44 43 52 52 52 52 62 62 62 62 52 52 52 52 52 52 52 43 43 59 59 35 43 43 52 52 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 43 43 35 29 29 29 29 29 44 44 68 68 68 68 44 44 39 39 39 44 59 68 68 68 68 68 68 62 62 52 52 52 52 43 44 43 39 39 59 59 68 68 68 68 62 62 52 52 52 62 62 68 68 62 62 39 39 43 62 52 52 52 62 62 44 39 31 31 44 44 68 68 68 68 68 59 59 43 43 35 35 44 44 59 59 35 35 43 35 43 43 41 41 44 44 62 41 41 43 62 44 68 68 68 68 68 68 68 68 68 68 68 43 43 43 52 52 57 57 44 39 35 35 44 44 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 52 43 43 39 27 23 44 43 52 52 59 57 68 68 68 68 68 68 68 68 68 59 59 52 52 52 44 43 33 33 42 43 59 59 68 68 68 68 68 68 68 68 68 68 50 50 39 50 50 59 59 68 68 68 68 44 44 43 43 42 42 42 32 32 32 36 36 35 59 47 57 57 59 44 44 31 30 42 44 57 57 57 44 43 43 59 59 68 59 59 32 32 20 34 41 48 35 40 32 32 39 43 46 54 68 68 59 59 59 47 43 43 43 48 48 47 43 43 33 28 25 37 34 29 24 22 22 31 34 43 48 47 47 59 47 41 39 35 31 31 30 30 31 30 30 28 34 37 48 43 43 59 59 57 57 48 48 37 37 28 28 28 40 40 43 48 40 40 25 29 29 43 43 35 35 35 39 39 39 39 40 43 40 37 41 39 32 32 20 18 18 28 30 30 28 23 32 32 37 30 30 25 32 29 39 41 32 25 23 28 25 25 33 37 37 34 31 21 21 28 27 37 37 37 37 33 35 32 29 27 31 29 30 31 26 26 28 20 18 22 32 28 32 20 21 21 15 14 18 19 19 32 37 39 39 41 32 31 27 20 14 14 26 24 16 25 17 24 18 24 21 23 25 28 28 20 19 16 24 24 24 22 22 22	Open. Hide. 0 0 0 0 3 6 6 6 10 10 10 8 8 7 8 7 7 7 6 8 9 16 28 41 27 27 3 0 3 21 16 24 30 18 18 9 10 10 10 7 8 8 8 8 10 10 11 26 17 24 19 21 34 37 32 33 33 33 33 33 46 27 23 9 9 9 6 6 6 6 8 11 20 28 28 22 29 29 30 29 29 28 33 36 53 57 57 57 48 48 48 47 47 47 47 42 42 42 42 54 48 48 68 68 43 43 39 39 36 33 31 31 33 42 47 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 48 48 44 57 59 44 44 32 37 37 40 40 34 20 13 24 32 44 44 48 50 50 57 57 57 57 57 57 68 68 68 50 50 43 43 42 43 30 38 38 59 44 44 38 38 43 50 52 52 57 57 52 43 43 37 43 43 59 43 37 35 35 43 43 43 43 43 52 52 52 43 59 43 52 43 44 43 39 39 44 44 59 35 35 43 43 43 44 44 68 68 68 68 68 44 44 52 43 39 35 44 44 68 68 68 43 43 52 52 52 62 44 68 62 44 43 39 39 43 43 52 52 62 62 68 68 68 68 68 68 62 62 52 62 62 62 62 62 52 52 52 52 52 62 62 52 52 52 52 62 62 62 62 62 62 62 62 62 68 68 68 68 62 62 52 43 43 62 41 41 43 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 52 38 38 31 35 35 44 44 62 62 68 68 68 68 68 68 62 62 43 43 39 62 62 68 68 68 68 68 62 62 52 45 45 62 62 52 52 43 44 44 35 35 43 59 59 68 68 68 68 68 68 68 68 68 68 59 59 52 52 52 44 44 57 59 52 38 38 42 39 39 59 59 68 68 68 59 59 45 43 43 44 44 59 52 43 47 43 43 52 52 52 59 52 52 52 41 38 52 52 52 57 57 57 57 57 59 57 57 57 57 44 44 41 43 42 42 37 35 44 44 68 68 68 68 59 59 57 57 57 59 59 57 57 47 44 44 47 47 47 59 59 59 59 59 43 43 46 46 59 59 68 59 59 57 54 54 54 54 54 54 54 48 48 48 48 48 48 54 54 48 59 48 48 48 59 48 54 54 54 54 43 43 37 42 47 48 48 59 59 59 43 43 28 23 34 32 37 32 28 23 32 41 59 59 47 32 32 37 39 31 36 35 37 37 41 41 39 39 43 44 43 43 43 43 46 59 59 59 48 48 46 57 46 37 37 37 37 48 48 48 59 57 48 43 43 43 48 48 57 48 48 48 48 48 43 59 43 43 43 43 37 43 28 21 21 15 15 20 20 20 23 28 28 34 34 41 37 43 36 32 34 28 28 14 14 14 27 28 25 25 23 28 28 28 21 27 15 15 15 24 25 28 12 12 11 12 12 26 28 30 30 30 32 23 22 18 20 20 26 32 25 15 15 13 13 13 18 18 18 18 17 17 17 28 28 22 23 11 11 11 23 17 31 25 20 12 12 12 15 15 25 18 19 19 15 19 19 22 25 11 11 11 21 13 19 12 11 11 12 12 10 10 12 17 16 16 13 19 22 28 20 20 15 14 11 11 6 6 6 6 11 6 9 9 8 8 9 8 9 10 15 24 25 14 10 8 10 8 9 12 15 14 17 15 14 18 14 10 10 10 10 13 9 15 12 12 8 8 8 8 15 9 15 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no509_b07.b1 MSMg01no509_b07.b1 CHROMAT_FILE:
MSMg01no509_b07.b1 PHD_FILE: MSMg01no509_b07.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:38:13 2005
         (676 letters)



>mm_chrX_47025044_47026119
          Length = 1076

 Score = 1268 bits (656), Expect = 0.0
 Identities = 668/672 (99%)
 Strand = Plus / Plus

                                                                       
Query: 5   gaattctcctattctttaggtcagttcatctttgtgacccaggaacagaactggtgaggt 64
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 205 gaattctcctatgctttaggtcagttcatctttgtgacccaggaacagaactggtgaggt 264

                                                                       
Query: 65  gaccacacagaagtttcaagtgtggtccagatttccctatacaatgttacaattggtccc 124
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 265 gaccacacagaagtttcaagtgtggcccagatttccctatacaatgttacaattggtccc 324

                                                                       
Query: 125 aaagagctcaaaacctctatctaggcctcattaatgctacctattcttttgggctataca 184
           |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 325 aaagagctcaaaacctctctctaggcctcattaatgttacctattcttttgggctataca 384

                                                                       
Query: 185 acccctagggtattctttgggataactgtgctatatttcttggaatccctgatttccatc 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 385 acccctagggtattctttgggataactgtgctatatttcttggaatccctgatttccatc 444

                                                                       
Query: 245 tctgttctctttatatgatataggaagatcaactttatagagacaagaaagtggaacaca 304
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 445 tctgttctctttatatgatataggaagatcaactttatagagacaagaaagtggaacaca 504

                                                                       
Query: 305 ttctaatataaagcaaaataagcttgcataatcgggattggattccaaaagtcatctctt 364
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 505 ttctaatataaagcaaaataagcttgcataatcgggattggattccaaaagtcatctctt 564

                                                                       
Query: 365 tgtctggaagaatattaggaactgaatcaagagtggaagatatgggaatagctacaggca 424
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 565 tgtctggaagaatattaggaactgaatcaagagtggaagatatgggaatagctacaggca 624

                                                                       
Query: 425 ggaattagtaataactaaccctatggaaagaagtaggctggggtattacctgccaacagg 484
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 625 ggaattagtaataactaaccctatggaaagaagtaggctggggtattacctgccaacagg 684

                                                                       
Query: 485 tatggtcattgatctatgtatcagtgggcctgaaaagaagagtggatgacagaaccaatt 544
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 685 tatggtcattgatctatgtatcagtgggcctgaaaagaagagtggatgacagaaccaatt 744

                                                                       
Query: 545 gtggaggcaacttcctgacttgaaaataatcttataagacttatcaaatccttttagtgt 604
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 745 gtggaggcaacttcctgacttgaaaataatcttataagacttatcaaatccttttagtgt 804

                                                                       
Query: 605 ttttctttaacagaaagaatcctacttctagaactagaaattggtttcaatataggaggc 664
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 805 ttttctttaacagaaagaatcctacttctagaactagaaattggtttcaatataggaggc 864

                       
Query: 665 cttatgttggtc 676
           ||||||||||||
Sbjct: 865 cttatgttggtc 876


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 29
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 676
Length of database: 1076
Length adjustment: 10
Effective length of query: 666
Effective length of database: 1066
Effective search space:   709956
Effective search space used:   709956
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information