MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-203L01
Chromosome	3 (Build37)
Map Location	92,638,326 - 92,769,370
singlet/doublet	doublet
Overlap gene	Lce1l, 2310050C09Rik, Lce3a, Lce3b, Lce3c, LOC630994
Upstream gene	Pglyrp3, EG619750, Lor, A030004J04Rik, Sprr2a, LOC100042999, LOC545543, LOC100043005, LOC545545, LOC100042514, LOC619984, Sprr2b, Sprr2c, Sprr2d, Sprr2e, Sprr2f, Sprr2g, Sprr2h, Sprr2i, Sprr2j, LOC100043022, Sprr2k, Sprr1b, Sprr3, LOC100042575, Sprr1a, Sprr4, LOC100042581, Ivl, Smcp, Lce1a1, Lce1b, LOC620325, Lce1a2, Lce1c, Lce1d, LOC100043062, Lce1e, Lce1f, LOC668264, Lce1g, Lce1h, Lce1i, LOC545547, LOC631101, Kprp
Downstream gene	2310001H18Rik, Lce3f, Crct1, Lce1m, EG229571, Crnn, EG229574, EG668300, LOC668304, Flg, LOC100042701, Hrnr, Rptn, EG383891, Tchh, Tchhl1, S100a11, S100a10, EG433623, Tdpoz2, Tdpoz1, LOC668325, LOC545550, EG436563, Tdpoz4, Tdpoz3, EG668341, LOC668344, EG668346, Tdpoz5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pglyrp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242100 MGI:2685266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG619750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619750 MGI:3648400
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 224 ESTs, 5 Proteins

name	Lor (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16939 MGI:96816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A030004J04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109314 MGI:1925680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20755 MGI:1330350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042999 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 28 ESTs pseudo : _no_value

name	LOC545543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1087 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043005 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs pseudo : _no_value

name	LOC545545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1131 ESTs, 4 Proteins pseudo : _no_value

name	LOC100042514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 221 ESTs

name	LOC619984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 7 Proteins pseudo : _no_value

name	Sprr2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20756 MGI:1330352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20757 MGI:1330351
definition	note : small proline-rich protein 2C pseudo : _no_value

name	Sprr2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20758 MGI:1330347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20759 MGI:1330346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20760 MGI:1330349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20761 MGI:1330348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Sprr2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20762 MGI:1330343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20763 MGI:1330309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2j (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20764 MGI:1330345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC100043022 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043022
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 325 ESTs, 6 Proteins

name	Sprr2k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20765 MGI:1330344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20754 MGI:106659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20766 MGI:1330237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Sprr1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20753 MGI:106660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229562 MGI:2654508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042581 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ivl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16447 MGI:96626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smcp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17235 MGI:96945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67127 MGI:1914377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68720 MGI:1915970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Lce1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73722 MGI:1920972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73719 MGI:1920969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69611 MGI:1916861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 655 ESTs, 37 Proteins pseudo : _no_value

name	Lce1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68694 MGI:1915944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67828 MGI:1915078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Lce1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66195 MGI:1913445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67718 MGI:1914968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76585 MGI:1923835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC631101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Kprp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433619 MGI:1920981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73730 MGI:1920980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310050C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66533 MGI:1913783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 1 Protein

name	Lce3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545548 MGI:3645650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66344 MGI:1913594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94060 MGI:2135932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC630994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	2310001H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69514 MGI:1916764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Lce3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69520 MGI:1916770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crct1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74175 MGI:1921425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66203 MGI:1913453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG229571 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229571 MGI:3645677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crnn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381457 MGI:2685861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG229574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229574 MGI:3645678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668300 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668300 MGI:3648599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1891 ESTs, 8 Proteins

name	LOC668304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Flg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14246 MGI:95553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 2 Proteins

name	LOC100042701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Hrnr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68723 MGI:3046938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	Rptn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20129 MGI:1099055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383891 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383891 MGI:3643701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Tchh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99681 MGI:2177944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 2 Proteins

name	Tchhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71325 MGI:1918575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20195 MGI:1338798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20194 MGI:1339468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433623 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433623 MGI:3645005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 14 Proteins

name	Tdpoz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399673 MGI:3027902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdpoz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207213 MGI:2449436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins pseudo : _no_value

name	LOC545550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins

name	EG436563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436563 MGI:3645792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 Proteins

name	Tdpoz4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399675 MGI:3027904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdpoz3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399674 MGI:3027903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668341 MGI:3648183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	LOC668344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 20 Proteins

name	EG668346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668346 MGI:3704095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins

name	Tdpoz5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399676 MGI:3027905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pglyrp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361343 GeneID:242100 MGI:2685266
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 3 transcript_id : NM_207247.2

name	EG619750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251330 GeneID:619750 MGI:3648400
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 224 ESTs, 5 Proteins product : predicted gene, EG619750 transcript_id : XM_883948.3

name	Lor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293270 GeneID:16939 MGI:96816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : loricrin transcript_id : NM_008508.2

name	A030004J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125991229 GeneID:109314 MGI:1925680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A030004J04 gene transcript_id : NM_175424.3

name	Sprr2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85785857 GeneID:20755 MGI:1330350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2A transcript_id : NM_011468.4

name	LOC100042514 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251276 GeneID:100042514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 221 ESTs product : hypothetical protein LOC100042514 transcript_id : XM_001478360.1

name	Sprr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485450 GeneID:20756 MGI:1330352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2B transcript_id : NM_011469.3

name	Sprr2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755631 GeneID:20758 MGI:1330347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2D transcript_id : NM_011470.1

name	Sprr2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981481 GeneID:20759 MGI:1330346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2E transcript_id : NM_011471.2

name	Sprr2f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49169822 GeneID:20760 MGI:1330349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2F transcript_id : NM_011472.2

name	Sprr2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352554 GeneID:20762 MGI:1330343
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2H transcript_id : NM_011474.3

name	Sprr2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981478 GeneID:20763 MGI:1330309
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2I transcript_id : NM_011475.2

name	LOC100043022 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251338 GeneID:100043022
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 244 ESTs, 1 Protein product : similar to Adhesion regulating molecule 1, transcript variant 2 transcript_id : XM_001479765.1

name	LOC100043022 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251336 GeneID:100043022
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 323 ESTs, 6 Proteins product : similar to Adhesion regulating molecule 1, transcript variant 1 transcript_id : XM_001479759.1

name	Sprr2k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778909 GeneID:20765 MGI:1330344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2K transcript_id : NM_011477.3

name	Sprr1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801970 GeneID:20754 MGI:106659
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 1B transcript_id : NM_009265.3

name	Sprr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755647 GeneID:20766 MGI:1330237
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 3 transcript_id : NM_011478.1

name	LOC100042575 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251279 GeneID:100042575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to hCG1782414 transcript_id : XM_001478452.1

name	Sprr1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61675694 GeneID:20753 MGI:106660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 1A transcript_id : NM_009264.2

name	Sprr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414498 GeneID:229562 MGI:2654508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 4 transcript_id : NM_173070.1

name	LOC100042581 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251281 GeneID:100042581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : similar to CG4877-PA transcript_id : XM_001478461.1

name	Ivl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627714 GeneID:16447 MGI:96626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : involucrin transcript_id : NM_008412.2

name	Smcp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110832841 GeneID:17235 MGI:96945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm mitochondria-associated cysteine-rich protein transcript_id : NM_008574.3

name	Lce1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842380 GeneID:67127 MGI:1914377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1A1 transcript_id : NM_025984.2

name	Lce1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386169 GeneID:68720 MGI:1915970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1B transcript_id : NM_026822.1

name	Lce1a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270956 GeneID:73722 MGI:1920972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1A2 transcript_id : NM_028625.2

name	Lce1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353719 GeneID:73719 MGI:1920969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1C transcript_id : NM_028622.2

name	Lce1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802815 GeneID:69611 MGI:1916861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1D transcript_id : NM_027137.2

name	Lce1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358924 GeneID:68694 MGI:1915944
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1E transcript_id : NM_026811.2

name	Lce1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347665 GeneID:67828 MGI:1915078
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1F transcript_id : NM_026394.2

name	Lce1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107617 GeneID:66195 MGI:1913445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1G transcript_id : NM_025413.2

name	Lce1h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367779 GeneID:67718 MGI:1914968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1H transcript_id : NM_026335.2

name	Lce1i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351738 GeneID:76585 MGI:1923835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1I transcript_id : NM_029667.2

name	LOC545547 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251284 GeneID:545547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC545547 transcript_id : XM_622329.4

name	LOC631101 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251286 GeneID:631101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical LOC631101 transcript_id : XM_001478521.1

name	Kprp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195681 GeneID:433619 MGI:1920981
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratinocyte expressed, proline-rich transcript_id : NM_028629.1

name	Lce1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379551 GeneID:73730 MGI:1920980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1L transcript_id : NM_028628.2

name	2310050C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251288 GeneID:66533 MGI:1913783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 1 Protein product : RIKEN cDNA 2310050C09 gene transcript_id : XM_001478535.1

name	Lce3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853566 GeneID:545548 MGI:3645650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 3A transcript_id : NM_001039594.1

name	Lce3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382788 GeneID:66344 MGI:1913594
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 3B transcript_id : NM_025501.2

name	Lce3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371396 GeneID:94060 MGI:2135932
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 3C transcript_id : NM_033175.2

name	LOC630994 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251292 GeneID:630994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical LOC630994 transcript_id : XM_001478579.1

name	2310001H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251294 GeneID:69514 MGI:1916764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 2310001H18 gene transcript_id : XM_001478585.1

name	Lce3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66267724 GeneID:69520 MGI:1916770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 3F transcript_id : NM_001018079.1

name	Crct1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801668 GeneID:74175 MGI:1921425
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich C-terminal 1 transcript_id : NM_028798.2

name	Lce1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865967 GeneID:66203 MGI:1913453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1M transcript_id : NM_025420.2

name	EG229571 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801996 GeneID:229571 MGI:3645677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG229571 transcript_id : NM_001034860.2

name	Crnn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487100 GeneID:381457 MGI:2685861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornulin transcript_id : NM_001081200.1

name	EG229574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370014 GeneID:229574 MGI:3645678
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG229574 transcript_id : NM_001013804.1

name	EG668300 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369747 GeneID:668300 MGI:3648599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1891 ESTs, 8 Proteins product : predicted gene, EG668300 transcript_id : XM_001000750.1

name	LOC668304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369749 GeneID:668304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to filaggrin transcript_id : XM_001000758.1

name	Flg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251298 GeneID:14246 MGI:95553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 2 Proteins product : filaggrin transcript_id : XM_485270.5

name	Hrnr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369753 GeneID:68723 MGI:3046938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : hornerin transcript_id : XM_001000796.1

name	Rptn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421059 GeneID:20129 MGI:1099055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : repetin transcript_id : NM_009100.2

name	EG383891 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251356 GeneID:383891 MGI:3643701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG383891 transcript_id : XM_357312.4

name	Tchh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251301 GeneID:99681 MGI:2177944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 2 Proteins product : trichohyalin transcript_id : XM_001000857.2

name	Tchhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802435 GeneID:71325 MGI:1918575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trichohyalin-like 1 transcript_id : NM_027762.2

name	S100a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930755 GeneID:20195 MGI:1338798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A11 (calgizzarin) transcript_id : NM_016740.3

name	S100a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930762 GeneID:20194 MGI:1339468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A10 (calpactin) transcript_id : NM_009112.2

name	EG433623 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369758 GeneID:433623 MGI:3645005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 14 Proteins product : predicted gene, EG433623 transcript_id : XM_485272.3

name	Tdpoz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124126980 GeneID:399673 MGI:3027902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 2 transcript_id : NM_001007222.2

name	Tdpoz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24233505 GeneID:207213 MGI:2449436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 1 transcript_id : NM_148949.1

name	LOC545550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251358 GeneID:545550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479894.1

name	EG436563 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82890378 GeneID:436563 MGI:3645792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 Proteins product : predicted gene, EG436563 transcript_id : XM_489896.3

name	Tdpoz4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130492353 GeneID:399675 MGI:3027904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 4 transcript_id : NM_207272.2

name	Tdpoz3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402298 GeneID:399674 MGI:3027903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 3 transcript_id : NM_207271.1

name	EG668341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369760 GeneID:668341 MGI:3648183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG668341 transcript_id : XM_001001011.1

name	LOC668344 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251360 GeneID:668344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 20 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479907.1

name	EG668346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369762 GeneID:668346 MGI:3704095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins product : predicted gene, EG668346 transcript_id : XM_001001033.1

name	Tdpoz5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402302 GeneID:399676 MGI:3027905
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 5 transcript_id : NM_207273.1

name	Pglyrp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402249 CCDS:CCDS17545.1 GeneID:242100 MGI:2685266
definition	GO_function : GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peptidoglycan recognition protein 3 protein_id : NP_997130.1

name	EG619750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890314 GeneID:619750 MGI:3648400
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor protein_id : XP_889041.1

name	Lor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293271 CCDS:CCDS17546.1 GeneID:16939 MGI:96816
definition	GO_component : GO:0001533 - cornified envelope [Evidence IDA]; GO:0009898 - internal side of plasma membrane [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IDA]; GO:0030280 - structural constituent of epidermis [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : loricrin protein_id : NP_032534.2

name	A030004J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425138 GeneID:109314 MGI:1925680
definition	codon_start : 1 product : proline rich 9 protein_id : NP_780633.1

name	Sprr2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560549 CCDS:CCDS17548.1 GeneID:20755 MGI:1330350
definition	GO_component : GO:0001533 - cornified envelope [Evidence TAS] [Evidence NAS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS]; GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence TAS] codon_start : 1 product : small proline-rich protein 2A protein_id : NP_035598.2

name	LOC100042514 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251277 GeneID:100042514
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478410.1

name	Sprr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485451 GeneID:20756 MGI:1330352
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2B protein_id : NP_035599.2

name	Sprr2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755632 GeneID:20758 MGI:1330347
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 function : cornified cell envelope precursor product : small proline-rich protein 2D protein_id : NP_035600.1

name	Sprr2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755634 GeneID:20759 MGI:1330346
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2E protein_id : NP_035601.1

name	Sprr2f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755636 GeneID:20760 MGI:1330349
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2F protein_id : NP_035602.1

name	Sprr2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755640 CCDS:CCDS17553.1 GeneID:20762 MGI:1330343
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2H protein_id : NP_035604.1

name	Sprr2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755642 GeneID:20763 MGI:1330309
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2I protein_id : NP_035605.1

name	LOC100043022 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251339 GeneID:100043022
definition	codon_start : 1 product : similar to Adhesion regulating molecule 1 isoform 2 protein_id : XP_001479815.1

name	LOC100043022 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251337 GeneID:100043022
definition	codon_start : 1 product : similar to Adhesion regulating molecule 1 isoform 1 protein_id : XP_001479809.1

name	Sprr2k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778910 GeneID:20765 MGI:1330344
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2K protein_id : NP_035607.2

name	Sprr1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678117 CCDS:CCDS17557.1 GeneID:20754 MGI:106659
definition	GO_component : GO:0001533 - cornified envelope [Evidence TAS] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence TAS] codon_start : 1 product : small proline-rich protein 1B protein_id : NP_033291.1

name	Sprr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755648 CCDS:CCDS17558.1 GeneID:20766 MGI:1330237
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : small proline-rich protein 3 protein_id : NP_035608.1

name	LOC100042575 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251280 GeneID:100042575
definition	codon_start : 1 product : similar to hCG1782414 protein_id : XP_001478502.1

name	Sprr1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678115 CCDS:CCDS17559.1 GeneID:20753 MGI:106660
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : small proline-rich protein 1A protein_id : NP_033290.1

name	Sprr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414499 GeneID:229562 MGI:2654508
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : small proline-rich protein 4 protein_id : NP_775093.1

name	LOC100042581 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251282 GeneID:100042581
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478511.1

name	Ivl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627715 CCDS:CCDS17561.1 GeneID:16447 MGI:96626
definition	GO_component : GO:0001533 - cornified envelope [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence IEA] codon_start : 1 product : involucrin protein_id : NP_032438.2

name	Smcp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011842 GeneID:17235 MGI:96945
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005741 - mitochondrial outer membrane [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA]; GO:0007341 - penetration of zona pellucida [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP] [Evidence IDA] codon_start : 1 note : mitochondrial capsule selenoprotein product : sperm mitochondria-associated cysteine-rich protein protein_id : NP_032600.2 transl_except : (pos:complement(92392872..92392874),aa:Sec) transl_except : (pos:complement(92392842..92392844),aa:Sec) transl_except : (pos:complement(92392791..92392793),aa:Sec)

name	Lce1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385486 CCDS:CCDS17562.1 GeneID:67127 MGI:1914377
definition	codon_start : 1 product : small proline rich-like 3 protein_id : NP_080260.1

name	Lce1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386170 CCDS:CCDS17563.1 GeneID:68720 MGI:1915970
definition	codon_start : 1 note : small proline rich-like 5 product : late cornified envelope 1B protein_id : NP_081098.1

name	Lce1a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386334 CCDS:CCDS17564.1 GeneID:73722 MGI:1920972
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : small proline rich-like 2 protein_id : NP_082901.1

name	Lce1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539629 GeneID:73719 MGI:1920969
definition	codon_start : 1 product : late cornified envelope 1C protein_id : NP_082898.1

name	Lce1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386200 CCDS:CCDS17566.1 GeneID:69611 MGI:1916861
definition	codon_start : 1 note : small proline rich-like 7 product : late cornified envelope 1D protein_id : NP_081413.1

name	Lce1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386166 CCDS:CCDS17567.1 GeneID:68694 MGI:1915944
definition	codon_start : 1 product : late cornified envelope protein family member protein_id : NP_081087.1

name	Lce1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385880 GeneID:67828 MGI:1915078
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : late cornified envelope 1F protein_id : NP_080670.1

name	Lce1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107618 CCDS:CCDS17569.1 GeneID:66195 MGI:1913445
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : RIKEN cDNA 1110058A15 protein_id : NP_079689.2

name	Lce1h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385838 CCDS:CCDS17570.1 GeneID:67718 MGI:1914968
definition	codon_start : 1 note : small proline rich-like 9 product : late cornified envelope 1H protein_id : NP_080611.1

name	Lce1i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386428 GeneID:76585 MGI:1923835
definition	codon_start : 1 product : late cornified envelope 1I protein_id : NP_083943.1

name	LOC545547 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251285 GeneID:545547
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622329.3

name	LOC631101 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251287 GeneID:631101
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478571.1

name	Kprp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195682 GeneID:433619 MGI:1920981
definition	codon_start : 1 note : keratinocytes proline-rich protein-like product : keratinocyte expressed, proline-rich protein_id : NP_082905.1

name	Lce1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386336 GeneID:73730 MGI:1920980
definition	codon_start : 1 product : late cornified envelope 1L protein_id : NP_082904.1

name	2310050C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251289 GeneID:66533 MGI:1913783
definition	codon_start : 1 product : hypothetical protein LOC66533 protein_id : XP_001478585.1

name	Lce3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853567 GeneID:545548 MGI:3645650
definition	codon_start : 1 product : late cornified envelope 3A protein_id : NP_001034683.1

name	Lce3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539595 GeneID:66344 MGI:1913594
definition	codon_start : 1 product : small proline rich-like 6A protein_id : NP_079777.1

name	Lce3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15042955 GeneID:94060 MGI:2135932
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : small proline rich-like 1 product : late cornified envelope 3C protein_id : NP_149410.1

name	LOC630994 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251293 GeneID:630994
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478629.1

name	2310001H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251295 GeneID:69514 MGI:1916764
definition	codon_start : 1 product : hypothetical protein LOC69514 protein_id : XP_001478635.1

name	Lce3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66267725 GeneID:69520 MGI:1916770
definition	codon_start : 1 note : late cornified envelope product : late cornified envelope protein protein_id : NP_001018089.1

name	Crct1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311957 CCDS:CCDS17578.1 GeneID:74175 MGI:1921425
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : cysteine-rich C-terminal 1 protein_id : NP_083074.1

name	Lce1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536218 CCDS:CCDS17579.1 GeneID:66203 MGI:1913453
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : late cornified envelope 5A product : small proline rich-like 10 protein_id : NP_079696.1

name	EG229571 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702195 GeneID:229571 MGI:3645677
definition	codon_start : 1 product : hypothetical protein LOC229571 protein_id : NP_001030032.1

name	Crnn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487101 GeneID:381457 MGI:2685861
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : cornulin protein_id : NP_001074669.1

name	EG229574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370015 GeneID:229574 MGI:3645678
definition	codon_start : 1 exception : unclassified translation discrepancy product : filaggrin 2 protein_id : NP_001013826.1

name	EG668300 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369748 GeneID:668300 MGI:3648599
definition	codon_start : 1 product : similar to Acidic ribosomal phosphoprotein P0 protein_id : XP_001000750.1

name	LOC668304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94369750 GeneID:668304
definition	codon_start : 1 product : similar to filaggrin protein_id : XP_001000758.1

name	Flg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251299 GeneID:14246 MGI:95553
definition	codon_start : 1 product : filaggrin protein_id : XP_485270.5

name	Hrnr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369754 GeneID:68723 MGI:3046938
definition	codon_start : 1 product : hornerin protein_id : XP_001000796.1

name	Rptn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421060 CCDS:CCDS17581.1 GeneID:20129 MGI:1099055
definition	GO_component : GO:0001533 - cornified envelope [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : repetin protein_id : NP_033126.2

name	EG383891 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38076713 GeneID:383891 MGI:3643701
definition	codon_start : 1 product : similar to ferritin light chain 2 protein_id : XP_357312.1

name	Tchh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251302 GeneID:99681 MGI:2177944
definition	codon_start : 1 product : trichohyalin protein_id : XP_001000857.2

name	Tchhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313246 CCDS:CCDS17582.1 GeneID:71325 MGI:1918575
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : S100 calcium binding protein A17 product : trichohyalin-like 1 protein_id : NP_082038.1

name	S100a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21886811 GeneID:20195 MGI:1338798
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : calizzarin; endothelial monocyte activating polypeptide 1; calgizzarin; S100 calcium binding protein A14 product : S100 calcium binding protein A11 (calizzarin) protein_id : NP_058020.1

name	S100a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677833 GeneID:20194 MGI:1339468
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : calcium binding protein A11 (calgizzarin); S100 calcium binding protein A10 (calgizzarin) product : S100 calcium binding protein A10 protein_id : NP_033138.1

name	EG433623 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51708253 GeneID:433623 MGI:3645005
definition	codon_start : 1 product : similar to TD and POZ domain containing 4 protein_id : XP_485272.1

name	Tdpoz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124126981 GeneID:399673 MGI:3027902
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TD and POZ domain containing gene 2 product : TD and POZ domain containing 2 protein_id : NP_001007223.2

name	Tdpoz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233506 GeneID:207213 MGI:2449436
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : POZ 56 protein; MATH- and POZ-encompassing protein 2 product : TD and POZ domain containing 1 protein_id : NP_683751.1

name	LOC545550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251359 GeneID:545550
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479944.1

name	EG436563 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890379 GeneID:436563 MGI:3645792
definition	codon_start : 1 product : similar to TDPOZ2 protein_id : XP_489896.3

name	Tdpoz4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130492354 GeneID:399675 MGI:3027904
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : TD and POZ domain containing 4 protein_id : NP_997155.2

name	Tdpoz3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402299 CCDS:CCDS17586.1 GeneID:399674 MGI:3027903
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : TD and POZ domain containing gene 3 product : TD and POZ domain containing 3 protein_id : NP_997154.1

name	EG668341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369761 GeneID:668341 MGI:3648183
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001011.1

name	LOC668344 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251361 GeneID:668344
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479957.1

name	EG668346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369763 GeneID:668346 MGI:3704095
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001033.1

name	Tdpoz5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402303 CCDS:CCDS17588.1 GeneID:399676 MGI:3027905
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : TD and POZ domain containing gene 5 product : TD and POZ domain containing 5 protein_id : NP_997156.1

name	LOC620325 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620325
definition	number : 1 pseudo : _no_value

name	LOC668264 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668264
definition	number : 1 pseudo : _no_value

name	LOC100042701 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042701
definition	number : 1 pseudo : _no_value

name	LOC100042701 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042701
definition	number : 2 pseudo : _no_value

name	LOC100042701 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042701
definition	number : 3 pseudo : _no_value

name	LOC100042999 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251331 GeneID:100042999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 28 ESTs product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_034369.1

name	LOC545543 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251274 GeneID:545543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1087 ESTs, 4 Proteins product : similar to Ribosomal protein L3 pseudo : _no_value transcript_id : XR_033644.1

name	LOC100043005 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251332 GeneID:100043005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_034371.1

name	LOC545545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251275 GeneID:545545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1131 ESTs, 4 Proteins product : similar to Ribosomal protein L3 pseudo : _no_value transcript_id : XR_033653.1

name	LOC619984 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251278 GeneID:619984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 7 Proteins product : similar to hCG2016451 pseudo : _no_value transcript_id : XR_033666.1

name	Sprr2g (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251131 GeneID:20761 MGI:1330348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2G pseudo : _no_value transcript_id : XR_035715.1

name	Sprr2j (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:114688037 GeneID:20764 MGI:1330345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2J pseudo : _no_value transcript_id : NR_003185.1

name	LOC100043062 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251346 GeneID:100043062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 655 ESTs, 37 Proteins product : similar to 14-3-3 zeta pseudo : _no_value transcript_id : XR_034395.1

name	LOC668325 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251303 GeneID:668325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_002165.2

clone name	MSMg01-071D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-052K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546M15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-311E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-297L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-161I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132M12
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-026K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095K18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-203L01.b	B6Ng01-203L01.g
ACC	GA023836	GA023837
length	1,146	1,112
definition	B6Ng01-203L01.b	B6Ng01-203L01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(92,768,213 - 92,769,370)	(92,638,326 - 92,639,278)
sequence	gaattctgggttgcatataaggcaagcatctgctttctagtctaagatcc tggtgagcgagcaccttctatcatctttcaccagtttagtgtagcctgag ttcctgtagtagaatgaatatttgctttctcttaaactcatgtggaaact ctaacccctaattttatagtattagaagagtaaactccaggagaacatgt gaattttaagaatgttgtgataaatacatcttagctgttttgatgccatc tgttatagcagcctgaaggaaccaagaaagccctcaactttccgaaggtg actgtctttaggaacaccccctcccccttttcttgaaggctttctagatg agagtttctctcatggaagccattcatctctctgtatttaagttaaacac atttgatggagcatgcctcatgaggcaggcagcatggactgcactgtgaa tgcacctgggaaccaaggggagtttatgtaggacagacagcaagagaata agcattttgttgtctagagctgggactcacagttctctcaattgtgctgt aaaaatcctggagcttcagatgattggcagaagtcagacactgatttcac ctactttataatcctttagaagcaagaacaggcactgtttttgaccaggt ggatagaatcttaagttactgggaaccaaacttgaaaggtcacctctgtc atttttttgcaagcttcccaacaaaatattcagaaactataggcaaagaa tctgcacatgaaatgcaagccatcttctgttgttctttcagatgctccat ccctacctgcctatggagtcttatatcctagagaagaaactgtccgtccc tggaaaggcaaaggatatgaggactgcattgcagggtttccagatgggaa aagtgtcatctcaggagaatgggcatcctgttacccatacaaggcagcag ctggtctagaagatggcttagaggagttctggacttaactgatgcccaca tgtgctatgatagaagcctgtagccattcagtttacttccttggtgattc tgttcagatcatatactcctaagttggggggtgattctcccccaactgag cagaactattgccattcaggactctctgtacatagtggcactgatt	gaattctttgtatatattgcatattagccttctatcagatgtagggttgg taaagatcttttcccactctgttagttgtcattttgtactattgacactg tcctttgccttatagaagctttgcaattttatgaggtcccatttgtcaat tcttgatcttaggacataagccattggtgttctgttcaggaaattttccc ctgtgcccatgtcctcgaggctcttcccctttttcttttcttttagtttc agtgtatctggttttatgtggaggtccttgatccacttagacttgagctt tgtacaaggagatatgaatggatcaatttgcatttttctatatgcttact tatagttgagccagcaccatttgttgaaaatgctgtcttttttttccact ggagggttttagctcctttgtcaaagatcaagaaccatatgcgcgtgggt ccatttcttcaattctattccattgatctacctgcctgtttctgtaccag taccatgcagttttatcactactgctctgtaatacagcttgaggtcaggg atggtgattcccccagaaatgtttttattgttgatagtattttttgctgt cctgggttttttgttattccagatgaatttgcaaattgctctttctaaca gtgaagacttgagttggaaattttttaacagaagaaaatgttagcaagca ttgaatccatttagtggagcctgtatgtgcatggaaatgggaccatctcc tgaagaaaggaaaagcccttacgacctgcatccttaaagaaagctgactt tccctatctcaggcagccctcaactgcttagatgaggattagactcccta tctcagcagctctcaactgcttagatgaggatgagactccataacccttt ccaaatctatgctgaatttgctagctctctgcatactgtctgggttcatg tatgaagctaactatgctgtcatgtctggcaaatactggttttgctgagt cactattttctctggctcttacatctttctgtcttctcatatggtcactg gggctgctagaggaatcaggttatatgtttcattagacctggatacctgg ccatctttattc
quality values	Open. Hide. 62 47 28 39 62 62 47 62 62 62 62 62 54 56 47 62 62 62 59 59 62 49 59 62 59 62 62 62 59 62 62 62 59 59 49 43 49 42 35 56 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 54 62 59 62 62 59 59 62 62 62 62 62 59 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 54 62 59 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 52 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 58 54 58 58 58 58 58 38 41 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 48 52 58 58 58 58 58 58 52 58 58 58 54 48 52 58 54 58 54 35 58 58 58 52 58 54 58 58 49 58 51 58 52 58 50 53 51 58 58 46 47 58 58 51 52 49 58 58 51 58 58 58 45 50 51 52 58 51 54 58 54 49 38 51 49 58 58 46 53 49 58 50 58 50 50 53 51 58 51 52 49 51 58 53 58 58 58 58 51 41 25 49 50 47 49 52 58 58 39 34 53 52 58 54 41 51 54 53 50 51 53 51 51 37 54 58 58 58 51 58 50 40 49 50 58 44 50 51 51 50 43 58 50 39 58 28 53 45 39 51 47 53 41 51 49 45 37 54 54 54 49 49 54 54 45 43 49 39 41 50 51 49 29 54 33 18 52 45 38 54 54 52 52 34 49 54 52 38 32 51 54 37 35 41 42 53 42 30 54 40 38 36 51 35 36 33 40 53 42 51 37 37 45 37 53 39 54 54 52 40 47 32 45 45 32 51 47 27 45 53 44 36 45 34 46 27 31 45 28 42 41 31 53 31 31 26 22 53 33 43 33 41 32 53 26 34 33 53 47 32 31 31 35 31 45 30 46 32 34 31 41 37 33 29 33 31 31 30 31 31 30 36 38 42 31 39 31 42 29 42 46 23 51 46 14 22 31 46 30 28 38 28 31 31 46 38 29 30 40 37 48 37 27 31 13 31 46 24 18 19 34 29 33 33 34 42 19 30 30 24 32 32 24 32 31 31 31 26 30 15 46 28 8 46 8 29 31 24 21 37 18 33 41 28 27 46 46 38 28 31 37 24 32 33 34 34 31 32 6 10 8 8 11 26 30 30 31 48 37 31 31 37 18 24 25 32 10 19 18 34 36 26 25 30 21 32 16 17 21 28 31 42 24 33 29 18 33 36 21 31 19 29 31 31 24 25 19 4 6 16 17 26 31 25 29 10 4 8 6 15 22 16 26 22 34 32 18 19 8 11 22 24 13 17 22 31 32 28 24 21 25 37 16 19 9 16 32 21 14 33 32 15 24 27 28 28 15 12 10 13 24 22 17 14 24 28 13 18 16 16 16 6 14 18 19 6 20 8 47 18 13 14 14 15 10 18 13 5 17 13 9 9 3 6 10 26 13 22 8 9 26 20 13 28 16 18 24 24 31 11 9 8 27 5 12 12 13 23 4 13 4 21 26 27 28 28 12 11 10 21 7 8 3 3 3 17 26 9 13 6 5 21 15 7 5 5 18 6 4 7 17 16 14 16 6 7 13 6 8 11 17 13 13 23 5 6 23 16 14 9 7 6 8 4 2 4 22 6 6 16 8 8 7 3 2 2 6 6 10 3 3 3	Open. Hide. 62 59 59 44 62 62 62 62 62 62 62 59 59 59 59 54 62 59 54 62 62 62 62 62 59 59 62 62 62 62 54 62 54 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 54 49 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 58 54 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 54 54 58 58 58 58 58 47 58 54 54 54 54 58 58 42 39 58 58 54 58 54 52 58 54 58 58 58 48 52 40 58 58 58 47 58 46 58 58 58 49 49 51 58 58 50 58 58 58 40 47 51 49 51 47 58 58 58 58 58 58 53 58 58 50 58 58 50 58 47 58 50 58 58 58 58 58 58 37 50 46 39 49 50 50 50 50 54 46 49 58 46 41 58 58 51 50 37 58 53 51 58 58 50 58 53 53 58 48 41 41 50 58 50 30 50 38 35 32 41 33 42 31 50 51 51 58 37 49 58 50 38 54 58 53 29 58 58 58 58 42 37 51 49 41 50 58 53 39 58 58 54 54 45 51 25 50 52 34 52 37 44 39 42 29 35 52 45 53 39 52 39 51 27 54 54 51 37 52 53 39 16 51 35 51 49 38 51 34 42 37 54 45 38 39 38 37 30 42 26 54 22 35 37 54 44 34 18 42 25 45 40 45 31 49 29 38 49 51 28 51 54 40 35 46 42 53 52 32 27 32 47 31 33 31 28 32 22 42 17 32 32 32 32 23 42 28 39 31 32 26 53 36 33 52 52 42 32 29 45 37 34 16 32 51 46 26 46 30 31 36 43 33 34 29 24 10 6 18 30 33 42 51 27 14 26 26 27 30 38 45 31 51 9 18 17 32 14 25 31 24 33 31 31 31 31 25 31 31 42 34 47 30 30 32 34 32 20 28 31 24 38 32 28 28 27 31 31 23 13 32 27 24 39 24 30 30 31 21 30 25 31 39 21 22 31 24 26 31 17 21 20 31 24 32 20 31 20 20 19 46 33 28 39 32 10 18 26 44 31 24 33 31 31 31 31 26 22 31 30 21 19 11 11 5 22 32 34 24 27 32 31 23 13 29 7 17 20 26 23 31 18 13 6 8 26 34 39 25 14 10 14 10 31 34 18 24 31 24 28 26 14 26 34 19 21 32 32 28 32 32 32 31 32 19 32 28 22 33 19 22 18 14 29 22 26 48 24 28 21 20 13 28 27 9 34 34 22 20 18 19 14 34 9 5 6 27 8 18 19 14 21 13 6 6 4 9 17 26 25 7 7 8 8 23 9 6 11 6 18 20 40 24 6 4 11 9 21 21 22 3 6 3 5 7 7 5 18 16 6 14 9 14 5 12 25 25 9 3 2 5 11 21 8 15 3 7 12 3 4 4 7 4 5 11 7 5 15 3 5 13 15 5 29 7 15 13 26 25 8 5 24 5 10 16 13 5 6 4 10 8 7 22 6 10 4 3 14 13 7 16 30 18 6 6 7 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_92768213_92769370
seq2: B6Ng01-203L01.b_44_1189 (reverse)

seq1  AATCAGTGCCATTATGGTAACAAGAGAGTCTTGAATTGGCAATTAGTTCT  50
      ||||||||||| ||| |||   |||||||| |||| |||||| |||||||
seq2  AATCAGTGCCACTAT-GTA--CAGAGAGTCCTGAA-TGGCAA-TAGTTCT  45

seq1  GCTCAGTTGGGGGGAAGGAATCA-CCCCCAACTTAGAAGTATTATGATCT  99
      |||||||||||||    |||||| |||||||||||| |||| ||||||||
seq2  GCTCAGTTGGGGG---AGAATCACCCCCCAACTTAGGAGTA-TATGATCT  91

seq1  GAACAGAATCCACCAAGGAAGTAAACCTGAATGGCTACAGGCTTCTATCA  149
      ||||||||| ||||||||||||||| ||||||||||||||||||||||||
seq2  GAACAGAAT-CACCAAGGAAGTAAA-CTGAATGGCTACAGGCTTCTATCA  139

seq1  TAGCACATGTGGGCATCAGTTAAGTCCAGAACTCCTCCTAAGCCATCCTT  199
      |||||||||||||||||||||||||||||||||||| ||||||||| |||
seq2  TAGCACATGTGGGCATCAGTTAAGTCCAGAACTCCT-CTAAGCCAT-CTT  187

seq1  CTAGACCAGCTGCTGCCTTGTATGGGTAACAGGATGCCCATTCTCCCTGA  249
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  CTAGACCAGCTGCTGCCTTGTATGGGTAACAGGATGCCCATTCT-CCTGA  236

seq1  GATGACACTTTTCCCATCTGG-AACCCTGCAATGCAGTCCTCATATCCTT  298
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GATGACACTTTTCCCATCTGGAAACCCTGCAATGCAGTCCTCATATCCTT  286

seq1  TGCCTTTCCAGGGACGGACAGTTTCTTCTCTAGGATATAAGACTCCATAG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTTCCAGGGACGGACAGTTTCTTCTCTAGGATATAAGACTCCATAG  336

seq1  GCAGGTAGGGATGGAGCATCTGAAAGAACAACAGAAGATGGCTTGCATTT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGTAGGGATGGAGCATCTGAAAGAACAACAGAAGATGGCTTGCATTT  386

seq1  CATGTGCAGATTCTTTGCCTATAGTTTCTGAATATTTTGTTGGGAAGCTT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGCAGATTCTTTGCCTATAGTTTCTGAATATTTTGTTGGGAAGCTT  436

seq1  GCAAAAAAATGACAGAGGTGACCTTTCAAGTTTGGTTCCCAGTAACTTAA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAAAAATGACAGAGGTGACCTTTCAAGTTTGGTTCCCAGTAACTTAA  486

seq1  GATTCTATCCACCTGGTCAAAAACAGTGCCTGTTCTTGCTTCTAAAGGAT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCTATCCACCTGGTCAAAAACAGTGCCTGTTCTTGCTTCTAAAGGAT  536

seq1  TATAAAGTAGGTGAAATCAGTGTCTGACTTCTGCCAATCATCTGAAGCTC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAAGTAGGTGAAATCAGTGTCTGACTTCTGCCAATCATCTGAAGCTC  586

seq1  CAGGATTTTTACAGCACAATTGAGAGAACTGTGAGTCCCAGCTCTAGACA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGATTTTTACAGCACAATTGAGAGAACTGTGAGTCCCAGCTCTAGACA  636

seq1  ACAAAATGCTTATTCTCTTGCTGTCTGTCCTACATAAACTCCCCTTGGTT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAATGCTTATTCTCTTGCTGTCTGTCCTACATAAACTCCCCTTGGTT  686

seq1  CCCAGGTGCATTCACAGTGCAGTCCATGCTGCCTGCCTCATGAGGCATGC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGTGCATTCACAGTGCAGTCCATGCTGCCTGCCTCATGAGGCATGC  736

seq1  TCCATCAAATGTGTTTAACTTAAATACAGAGAGATGAATGGCTTCCATGA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATCAAATGTGTTTAACTTAAATACAGAGAGATGAATGGCTTCCATGA  786

seq1  GAGAAACTCTCATCTAGAAAGCCTTCAAGAAAAGGGGGAGGGGGTGTTCC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAACTCTCATCTAGAAAGCCTTCAAGAAAAGGGGGAGGGGGTGTTCC  836

seq1  TAAAGACAGTCACCTTCGGAAAGTTGAGGGCTTTCTTGGTTCCTTCAGGC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGACAGTCACCTTCGGAAAGTTGAGGGCTTTCTTGGTTCCTTCAGGC  886

seq1  TGCTATAACAGATGGCATCAAAACAGCTAAGATGTATTTATCACAACATT  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTATAACAGATGGCATCAAAACAGCTAAGATGTATTTATCACAACATT  936

seq1  CTTAAAATTCACATGTTCTCCTGGAGTTTACTCTTCTAATACTATAAAAT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAAATTCACATGTTCTCCTGGAGTTTACTCTTCTAATACTATAAAAT  986

seq1  TAGGGGTTAGAGTTTCCACATGAGTTTAAGAGAAAGCAAATATTCATTCT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGGGTTAGAGTTTCCACATGAGTTTAAGAGAAAGCAAATATTCATTCT  1036

seq1  ACTACAGGAACTCAGGCTACACTAAACTGGTGAAAGATGATAGAAGGTGC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACAGGAACTCAGGCTACACTAAACTGGTGAAAGATGATAGAAGGTGC  1086

seq1  TCGCTCACCAGGATCTTAGACTAGAAAGCAGATGCTTGCCTTATATGCAA  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGCTCACCAGGATCTTAGACTAGAAAGCAGATGCTTGCCTTATATGCAA  1136

seq1  CCCAGAATTC  1158
      ||||||||||
seq2  CCCAGAATTC  1146

seq1: chr3_92638326_92639278
seq2: B6Ng01-203L01.g_238_1173

seq1  GTGTTCTGTTCAGGAAATTTTCCCCTGTGCCCATGTCCTCGAGGCTCTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTCTGTTCAGGAAATTTTCCCCTGTGCCCATGTCCTCGAGGCTCTTC  50

seq1  CCCTTTTTCTTTTCTTTTAGTTTCAGTGTATCTGGTTTTATGTGGAGGTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTTTTCTTTTCTTTTAGTTTCAGTGTATCTGGTTTTATGTGGAGGTC  100

seq1  CTTGATCCACTTAGACTTGAGCTTTGTACAAGGAGATATGAATGGATCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGATCCACTTAGACTTGAGCTTTGTACAAGGAGATATGAATGGATCAA  150

seq1  TTTGCATTTTTCTATATGCTTACTTATAGTTGAGCCAGCACCATTTGTTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCATTTTTCTATATGCTTACTTATAGTTGAGCCAGCACCATTTGTTG  200

seq1  AAAATGCTGTCTTTTTTTTCCACTGGAGGGTTTTAGCTCCTTTGTCAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATGCTGTCTTTTTTTTCCACTGGAGGGTTTTAGCTCCTTTGTCAAAG  250

seq1  ATCAAGAACCATATGCGCGTGGGTCCATTTCTTCAATTCTATTCCATTGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGAACCATATGCGCGTGGGTCCATTTCTTCAATTCTATTCCATTGA  300

seq1  TCTACCTGCCTGTTTCTGTACCAGTACCATGCAGTTTTATCACTACTGCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACCTGCCTGTTTCTGTACCAGTACCATGCAGTTTTATCACTACTGCT  350

seq1  CTGTAATACAGCTTGAGGTCAGGGATGGTGATTCCCCCAGAAATGTTTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAATACAGCTTGAGGTCAGGGATGGTGATTCCCCCAGAAATGTTTTT  400

seq1  ATTGTTGATAGTATTTTTTGCTGTCCTGGGTTTTTTGTTATTCCAGATGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTGATAGTATTTTTTGCTGTCCTGGGTTTTTTGTTATTCCAGATGA  450

seq1  ATTTGCAAATTGCTCTTTCTAACAGTGAAGACTTGAGTTGGAAATTTTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGCAAATTGCTCTTTCTAACAGTGAAGACTTGAGTTGGAAATTTTTT  500

seq1  AACAGAAGAAAATGTTAGCAAGCATTGAATCCATTTAGTGGAGCCTGTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGAAGAAAATGTTAGCAAGCATTGAATCCATTTAGTGGAGCCTGTAT  550

seq1  GTGCATGGAAATGGGACCATCTCCTGAAGAAAGGAAAAGCCCTTACGACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCATGGAAATGGGACCATCTCCTGAAGAAAGGAAAAGCCCTTACGACC  600

seq1  TGCATCCTTAAAGAAAGCTGACTTTCCCTATCTCA-GCAGCCCTCAACTG  649
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  TGCATCCTTAAAGAAAGCTGACTTTCCCTATCTCAGGCAGCCCTCAACTG  650

seq1  CTTAGATGAGGATTAGACTCCCTATCTCAGCAGCTCTCAACTGCTTAGAT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGATGAGGATTAGACTCCCTATCTCAGCAGCTCTCAACTGCTTAGAT  700

seq1  GAGGATGAGACTCCATAACCCTTTCCAAATCTATGCTGAATTTTTGCTAG  749
      ||||||||||||||||||||||||||||||||||||||||  ||||||||
seq2  GAGGATGAGACTCCATAACCCTTTCCAAATCTATGCTGAA--TTTGCTAG  748

seq1  CTCTCTTGCATACTGTTCTGGGTTCATGTATGAAGCTAACTATGCTGTCA  799
      ||||| ||||||||| ||||||||||||||||||||||||||||||||||
seq2  CTCTC-TGCATACTG-TCTGGGTTCATGTATGAAGCTAACTATGCTGTCA  796

seq1  TGTCTGGCAAATACTGGTTTTGCTGAAGTCAACTATTTTCTCTGGCTCTT  849
      ||||||||||||||||||||||||| |||| |||||||||||||||||||
seq2  TGTCTGGCAAATACTGGTTTTGCTG-AGTC-ACTATTTTCTCTGGCTCTT  844

seq1  ACAATCTTTCTGTCCTTTCTTTCCATATGGTCACTGGGCCTTGCTAGGAA  899
      || |||||||||||  ||||   ||||||||||||||| | ||||||  |
seq2  AC-ATCTTTCTGTC--TTCT---CATATGGTCACTGGGGC-TGCTAG--A  885

seq1  GGGATACAGTAAATATGTTTCATTTAGAACTGAGTACTTGGCCATCTTTT  949
      || || |||   |||||||||| ||||| |||  ||| |||||||| |||
seq2  GGAAT-CAGGTTATATGTTTCA-TTAGACCTGGATACCTGGCCATC-TTT  932

seq1  ATTC  953
      ||||
seq2  ATTC  936

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information