MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-235P15
Chromosome	4 (Build37)
Map Location	121,887,429 - 122,004,740
singlet/doublet	doublet
Overlap gene	none
Upstream gene	OTTMUSG00000008911, EG666914, LOC666921, LOC666927, LOC666931, LOC666937
Downstream gene	LOC633269, LOC633279, 9530002B09Rik, Ppt1, Cap1, Mfsd2, Mycl1, Trit1, Bmp8b, Oxct2b, Ppie, Hpcal4, Nt5c1a, Heyl, LOC194197, LOC622334, Pabpc4, Bmp8a, Oxct2a
Link	Open Mouse BAC browser

Click to get alignment info.

name	OTTMUSG00000008911 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545677 MGI:3652130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666914 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666914 MGI:3648197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666927 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC666937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 79 ESTs, 23 Proteins pseudo : _no_value

name	LOC633269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC633279 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	9530002B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77432 MGI:1924682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19063 MGI:1298204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12331 MGI:88262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfsd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76574 MGI:1923824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mycl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16918 MGI:96799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66966 MGI:1914216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmp8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12164 MGI:107335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oxct2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353371 MGI:2664115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppie (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56031 MGI:1917118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpcal4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170638 MGI:2157521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5c1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230718 MGI:2155700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	Heyl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56198 MGI:1860511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC194197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC622334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	Pabpc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230721 MGI:2385206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Bmp8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12163 MGI:104515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oxct2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64059 MGI:1891061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000008911 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386171 GeneID:545677 MGI:3652130
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000008911 transcript_id : NM_001033791.2

name	EG666914 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252887 GeneID:666914 MGI:3648197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG666914 transcript_id : XM_986980.2

name	LOC666921 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372249 GeneID:666921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC666921 transcript_id : XM_987018.1

name	LOC666927 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252889 GeneID:666927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC666927 transcript_id : XM_987049.2

name	LOC666931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253078 GeneID:666931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : hypothetical LOC666931 transcript_id : XM_987080.2

name	LOC633269 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372500 GeneID:633269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to urea transporter transcript_id : XM_987282.1

name	LOC633279 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372502 GeneID:633279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to AUMP transcript_id : XM_987307.1

name	9530002B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292435 GeneID:77432 MGI:1924682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530002B09 gene transcript_id : NM_023865.3

name	Ppt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674796 GeneID:19063 MGI:1298204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : palmitoyl-protein thioesterase 1 transcript_id : NM_008917.2

name	Cap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560729 GeneID:12331 MGI:88262
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAP, adenylate cyclase-associated protein 1 (yeast) transcript_id : NM_007598.2

name	Mfsd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037448 GeneID:76574 MGI:1923824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major facilitator superfamily domain containing 2 transcript_id : NM_029662.1

name	Mycl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328139 GeneID:16918 MGI:96799
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) transcript_id : NM_008506.2

name	Trit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354403 GeneID:66966 MGI:1914216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA isopentenyltransferase 1 transcript_id : NM_025873.2

name	Bmp8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387766 GeneID:12164 MGI:107335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 8b transcript_id : NM_007559.3

name	Oxct2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372607 GeneID:353371 MGI:2664115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-oxoacid CoA transferase 2B transcript_id : NM_181859.2

name	Ppie (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372418 GeneID:56031 MGI:1917118
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase E (cyclophilin E) transcript_id : NM_019489.3

name	Hpcal4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379792 GeneID:170638 MGI:2157521
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hippocalcin-like 4 transcript_id : NM_174998.2

name	Nt5c1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51709445 GeneID:230718 MGI:2155700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : 5'-nucleotidase, cytosolic IA transcript_id : XM_112246.3

name	Heyl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606342 GeneID:56198 MGI:1860511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairy/enhancer-of-split related with YRPW motif-like transcript_id : NM_013905.3

name	Pabpc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34419621 GeneID:230721 MGI:2385206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly A binding protein, cytoplasmic 4 transcript_id : NM_130881.2

name	Pabpc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130218 GeneID:230721 MGI:2385206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly A binding protein, cytoplasmic 4 transcript_id : NM_148917.2

name	Bmp8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892640 GeneID:12163 MGI:104515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 8a transcript_id : NM_007558.2

name	Oxct2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802949 GeneID:64059 MGI:1891061
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-oxoacid CoA transferase 2A transcript_id : NM_022033.2

name	OTTMUSG00000008911 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702113 GeneID:545677 MGI:3652130
definition	codon_start : 1 product : hypothetical protein LOC545677 protein_id : NP_001028963.1

name	EG666914 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252888 GeneID:666914 MGI:3648197
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992074.2

name	LOC666921 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372250 GeneID:666921
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992112.1

name	LOC666927 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252890 GeneID:666927
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992143.2

name	LOC666931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253079 GeneID:666931
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992174.2

name	LOC633269 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372501 GeneID:633269
definition	codon_start : 1 product : similar to urea transporter protein_id : XP_992376.1

name	LOC633279 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372503 GeneID:633279
definition	codon_start : 1 product : similar to AUMP protein_id : XP_992401.1

name	9530002B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14010845 CCDS:CCDS18603.1 GeneID:77432 MGI:1924682
definition	codon_start : 1 note : palmitoyl protein thioesterase-like protein; ventral prostrate predominant 1 product : palmitoyl-protein thioesterase-like protein protein_id : NP_076354.1

name	Ppt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674797 GeneID:19063 MGI:1298204
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA] [Evidence IMP] [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008474 - palmitoyl-(protein) hydrolase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0008306 - associative learning [Evidence IMP]; GO:0044257 - cellular protein catabolism [Evidence IMP]; GO:0007625 - grooming behavior [Evidence IMP]; GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0007269 - neurotransmitter secretion [Evidence IMP]; GO:0006907 - pinocytosis [Evidence ISS]; GO:0002084 - protein depalmitoylation [Evidence IMP]; GO:0006464 - protein modification [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 product : palmitoyl-protein thioesterase 1 protein_id : NP_032943.2

name	Cap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671666 CCDS:CCDS18604.1 GeneID:12331 MGI:88262
definition	GO_component : GO:0030864 - cortical actin cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IMP]; GO:0001667 - ameboidal cell migration [Evidence IMP]; GO:0000902 - cell morphogenesis [Evidence IGI]; GO:0006898 - receptor mediated endocytosis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : adenylyl cyclase-associated CAP protein, yeast homolog 1; adenylyl cyclase-associated CAP protein homolog 1 (S. cerevisiae, S. Pombe) iae product : CAP, adenylate cyclase-associated protein 1 protein_id : NP_031624.1

name	Mfsd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037449 CCDS:CCDS18605.1 GeneID:76574 MGI:1923824
definition	codon_start : 1 exception : mismatches in translation product : major facilitator superfamily domain containing 2 protein_id : NP_083938.1

name	Mycl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678704 CCDS:CCDS18606.1 GeneID:16918 MGI:96799
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : lung carcinoma myc related oncogene 1 protein_id : NP_032532.1

name	Trit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229019 CCDS:CCDS18607.1 GeneID:66966 MGI:1914216
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004811 - tRNA isopentenyltransferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : tRNA isopentenyltransferase 1 protein_id : NP_080149.2

name	Bmp8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560733 CCDS:CCDS18608.1 GeneID:12164 MGI:107335
definition	GO_function : GO:0005125 - cytokine activity [Evidence TAS]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0051216 - cartilage development [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0040007 - growth [Evidence IEA]; GO:0001503 - ossification [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence TAS] codon_start : 1 product : bone morphogenetic protein 8b protein_id : NP_031585.2

name	Oxct2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348588 CCDS:CCDS18609.1 GeneID:353371 MGI:2664115
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0008410 - CoA-transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006091 - generation of precursor metabolites and energy [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : succinyl CoA:3-oxoacid CoA-transferase product : 3-oxoacid CoA transferase 2B protein_id : NP_862907.1

name	Ppie (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14196340 CCDS:CCDS18610.1 GeneID:56031 MGI:1917118
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : peptidylprolyl isomerase E protein_id : NP_062362.1

name	Hpcal4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27923929 CCDS:CCDS18611.1 GeneID:170638 MGI:2157521
definition	codon_start : 1 note : neural visinin-like protein 2 product : hippocalcin-like 4 protein_id : NP_778163.1

name	Nt5c1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51709446 GeneID:230718 MGI:2155700
definition	codon_start : 1 product : similar to 5-nucleotidase, cytosolic IA protein_id : XP_112246.3

name	Heyl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560486 CCDS:CCDS18613.1 GeneID:56198 MGI:1860511
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : hairy and enhance of split related 3; hairy-related transcription factor 3 product : hairy/enhancer-of-split related with YRPW motif-like protein_id : NP_038933.2

name	Pabpc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34419622 CCDS:CCDS18614.1 GeneID:230721 MGI:2385206
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence ISS]; GO:0017130 - poly(rC) binding [Evidence ISS]; GO:0008266 - poly(U) binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : poly(A) binding protein, cytoplasmic 4 isoform 1 protein_id : NP_570951.2

name	Pabpc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507391 CCDS:CCDS18615.1 GeneID:230721 MGI:2385206
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence ISS]; GO:0017130 - poly(rC) binding [Evidence ISS]; GO:0008266 - poly(U) binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : poly(A) binding protein, cytoplasmic 4 isoform 2 protein_id : NP_683717.1

name	Bmp8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671644 CCDS:CCDS18616.1 GeneID:12163 MGI:104515
definition	GO_function : GO:0005125 - cytokine activity [Evidence TAS]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0051216 - cartilage development [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0040007 - growth [Evidence IEA]; GO:0001503 - ossification [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence TAS] codon_start : 1 note : osteogenic protein 2 product : bone morphogenetic protein 8a protein_id : NP_031584.1

name	Oxct2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11968160 CCDS:CCDS18617.1 GeneID:64059 MGI:1891061
definition	GO_component : GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0008260 - 3-oxoacid CoA-transferase activity [Evidence ISS]; GO:0008410 - CoA-transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006104 - succinyl-CoA metabolism [Evidence ISS] codon_start : 1 note : haploid germ cell specific succinyl CoA transferase; succinyl-CoA:3-oxoacid CoA-transferase product : 3-oxoacid CoA transferase 2A protein_id : NP_071316.1

name	LOC194197 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194197
definition	number : 1 pseudo : _no_value

name	LOC194197 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194197
definition	number : 2 pseudo : _no_value

name	LOC666937 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253080 GeneID:666937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 79 ESTs, 23 Proteins product : similar to creatine kinase pseudo : _no_value transcript_id : XR_030521.1

name	LOC622334 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253084 GeneID:622334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to ribosomal protein S7 pseudo : _no_value transcript_id : XR_030761.1

clone name	MSMg01-181N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-490C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151N23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-137L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404I14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-475E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305C01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345O12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-236N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-192H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533D14
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-014B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298K20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-235P15.b	B6Ng01-235P15.g
ACC	GA047315	GA047316
length	1,044	1,100
definition	B6Ng01-235P15.b	B6Ng01-235P15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(122,003,696 - 122,004,740)	(121,887,429 - 121,888,520)
sequence	gaattcagagcattttaaagcaaagccccatattttgatctataaatact tgtctgtgagagactaaactgtgggaaactaggtcccaccagtaactctc accctaaagattcggctgacctttgaagggaattatgtcaccccctcctc attgcctctacctggagcctgagactgccagcctcatccccttcttcatg tctccattccgagcctagaactgcttagattaaggcagctttacctcctc ctccatgcctctgtttggtgcccgagactgtttagtcaggacaggtaatc caggataaactgcagaatgtttgaaggccactcgtgacccttttagggcc gacattgcaagaaaagctgctagaagcttgtaatcagcatccaccccaga tgtccatccctttctctgtattttattatgccccctcgacccctccctat tttctctcactgtgtgcttataacctggcttttagccttcattaaacaga ccttgacaactctttgattggtcttgctcccctttctccacctgcttctc ttgcaggcctcggtcctccttgacccacggaataactaggtcctgctaga caggacacttgtcaactaaaaggaagaagcacaaaaatattggtggtgac acatgtcagtaatactgggacttaggagatggaggatctgaaattcaagg ttaaccttgactacaaagtcagtttgatgtgagcctcggacacaaaatgc agtggctcagtaaacaaaaccaagaacctaacatgggttttaattttgac atctagatgcagagtttgatcaaattttgttcaacagtagttagaaaagt tttgtgtatcaacctatgccttttgtcccaggacttgcagaacagagaga gacagaattctacttttgaagaaagactggactatacaatgatttccagg gaagttaaagttacagattgagaccttgtgttagggggtggtagctgagt ttggtagcggtttaacttggagaaatagctcagatgtccactgg	gaattccagttatggagatttgtgagtgaccatatgggtactgagaagag cagtctttactttaaactgtgaaccagtatatttatttattttgagacac tgtctctctatctagcccagaatggactggaactcaatatatagaacaag atggccttgaattatagagaccacccacactctctgtctctgcctccaga atgtgggaagaaagaatgctatggcttggtaagattgaattcttttagtc ttttactggcctgaagagatgacagagtggttataagctttagattctct tatagagaatgcagggtgattctccaggtctaacactcattttaaaacca ctgtcccttcatcttcagagaattcagcaaactatccttgacttttcagg caccagaaccacaggtagtgcacacaaattcatgcaggcaacatgcccac atttaaaatttatgagtatttgtgtgaattttttatgtacagtttcccac agaggcaagaaaaaataaataacaagctttctttggttggtttttttgtt ttgttttgttttgttttgttttgtttttgcttgtttctttgttgttacat atggtttctctttgtcactgtcctggttgttctggaaatcagtttgtagc ccatacttgtcttgattcacaaattttcatgtgttaagggcatgtaccac tggaggaaagatgcaatacacaatattaaacacttaaacattcctttatt ctcctagacaccacaccacacacacacacacacacacacacacacacaca cacacacacacacacacaatttgctaatatttgtttggcaagttgtaaga aatttttatatcttctggagattgaacttgcatacatgttttacattttt tttctttattctgaattctggaggctggtctcatgaacaagcatttcacc ctcctatattgtgggttgggattccatgtgggttgtggaactgaatttgg catgagccaaatgttggaaaagaattcttaaacacaaatgggtcaaatgt ttaatttcaaaatcaagaatgagtgaatagaaatggtcctgcactcatta
quality values	Open. Hide. 54 41 35 37 62 31 22 43 62 62 42 46 47 62 62 47 56 62 47 47 62 56 62 62 62 62 62 62 59 44 59 44 50 32 32 28 29 28 35 46 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 43 49 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 54 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 54 41 54 54 54 47 58 58 58 58 45 58 58 58 52 58 58 58 58 58 52 54 54 54 54 54 58 54 54 54 58 54 58 58 58 54 49 54 54 58 46 58 58 52 52 52 58 44 58 58 52 52 54 54 54 54 54 52 54 48 58 58 58 52 58 51 46 53 53 53 41 58 58 58 51 58 50 49 51 51 37 50 58 58 50 58 42 47 37 53 53 58 49 38 54 48 48 51 50 58 50 51 58 53 53 58 58 29 39 58 52 40 25 58 39 24 39 33 51 58 51 48 58 36 25 53 54 58 47 39 40 39 39 35 32 37 43 58 30 32 50 39 40 51 50 39 46 31 31 39 39 53 18 58 52 39 50 50 30 37 33 58 58 52 40 39 51 50 51 49 39 54 44 32 35 42 52 38 23 37 53 29 54 54 39 42 51 35 42 34 29 52 50 37 53 42 37 39 33 25 54 53 41 28 54 54 47 37 54 37 43 32 54 21 21 53 21 13 28 51 31 39 53 54 51 35 54 54 49 34 52 53 54 54 45 42 31 42 22 31 46 29 53 34 43 35 32 37 32 31 35 31 32 51 32 32 28 37 35 26 49 27 52 53 53 33 37 52 22 39 32 31 32 32 31 25 30 14 33 25 32 28 45 46 46 30 21 32 46 51 33 25 18 41 35 35 32 32 33 19 18 20 31 36 38 32 33 19 17 48 46 17 31 25 31 42 26 21 22 28 30 25 33 30 31 21 28 32 46 36 22 32 21 32 12 26 22 42 31 18 14 28 27 31 20 18 21 14 25 20 32 34 44 31 34 25 25 32 21 35 32 21 16 31 21 24 30 31 32 23 31 31 38 28 29 14 26 22 31 23 20 41 38 16 25 19 19 38 8 44 23 14 18 33 12 41 7 12 10 31 11 31 11 22 9 16 29 34 29 12 26 22 22 33 21 17 19 32 22 9 22 15 34 43 43 26 16 8 28 9 17 8 11 6 8 4 10 32 37 30 33 14 4 12 24 14 7 25 10 37 32 23 21 18 13 21 21 7 7 7 28 47 10 9 12 5 4 11 20 14 6 18 9 7 14 23 21 17 20 24 19 21	Open. Hide. 62 47 51 47 62 62 44 30 62 45 30 18 19 27 27 23 23 20 20 32 38 54 59 62 62 62 62 62 59 49 59 59 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 59 59 62 62 62 62 59 59 48 43 33 45 40 48 48 59 62 62 54 62 62 62 59 59 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 59 54 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 49 45 58 58 58 52 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 48 58 49 58 58 54 58 58 58 58 58 58 58 54 58 58 58 45 58 58 58 58 58 51 58 58 42 52 47 53 39 53 58 58 58 49 49 58 58 58 58 58 58 58 54 58 51 58 52 46 49 51 46 58 58 51 58 58 51 58 58 39 58 51 58 58 58 58 54 51 54 52 51 50 58 58 49 58 52 51 42 53 58 41 41 53 52 54 51 58 51 51 53 58 49 54 39 47 58 50 52 50 51 58 41 51 58 58 52 52 37 46 58 51 58 58 50 42 52 41 58 31 33 40 40 54 52 39 33 31 23 41 49 54 54 38 42 44 50 54 51 42 37 26 42 38 18 51 50 43 49 42 49 20 54 31 52 50 37 32 33 51 49 35 39 54 54 25 50 40 44 23 51 51 40 40 39 54 42 40 31 34 40 40 25 22 18 11 9 23 18 49 37 47 47 47 32 29 32 47 51 54 47 54 53 34 40 32 32 32 41 51 52 34 46 51 47 25 25 29 32 27 33 32 40 27 36 32 52 32 29 10 32 23 32 21 51 26 53 22 52 24 51 26 40 17 40 45 37 33 21 46 40 26 38 18 8 9 41 31 31 30 51 30 40 26 46 27 41 33 11 9 14 31 29 30 30 16 12 38 23 46 46 16 12 46 46 46 30 31 32 22 40 27 25 43 32 25 29 40 31 27 36 26 21 31 22 23 31 30 21 31 25 17 20 22 32 27 31 39 20 46 46 19 31 32 24 31 46 46 46 39 41 39 18 30 27 46 30 31 29 26 19 21 24 31 27 14 21 25 13 32 29 31 24 31 24 21 16 12 5 17 33 34 35 31 34 31 17 7 6 25 19 29 14 19 32 23 31 23 24 28 22 8 6 25 14 24 24 20 29 14 33 22 33 48 32 24 20 22 43 31 21 8 19 8 21 17 23 20 16 23 24 16 9 7 28 16 21 17 23 28 23 26 12 19 14 10 36 18 12 9 4 18 21 10 23 11 28 23 27 34 7 6 9 6 6 20 13 3 40 33 25 8 19 14 20 7 11 5 15 19 28 9 12 10 14 21 34 17 9 16 28 15 6 7 13 40 16 14 27 7 31 11 13 16 15 26 9 13 7 40 34 17 10 22 8 14 3 6 10 4 14 21 2 5 10 11 16 6 5 17 13 28 13 14 4 6 17 11 13 6 6 10 9 6 8 6 14 14 11 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_122003696_122004740
seq2: B6Ng01-235P15.b_51_1094 (reverse)

seq1  CCAGTGGGACATCTGAGCTATTTCT-CAAGTTAAACCGCTACCCAAACTC  49
      ||||| ||||||||||||||||||| ||||||||||||||| ||||||| 
seq2  CCAGT-GGACATCTGAGCTATTTCTCCAAGTTAAACCGCTA-CCAAACT-  47

seq1  CAGCTACCA-CCCCTAACACAAGGTCTCAATCTGTAACCTTAACTTTCCT  98
      ||||||||| |||||||||||||||||||||||||||| ||||||| |||
seq2  CAGCTACCACCCCCTAACACAAGGTCTCAATCTGTAACTTTAACTTCCCT  97

seq1  GGAAATCATTGTATAGTCCAGTCTTTCTTCAAAAGTAGAATTCTGTCTCT  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATCATTGTATAGTCCAGTCTTTCTTCAAAAGTAGAATTCTGTCTCT  147

seq1  CTCTGTTCTGCAAGTCCTGGGACAAAAGGCATAGGTTGATACACAAAACT  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTTCTGCAAGTCCTGGGACAAAAGGCATAGGTTGATACACAAAACT  197

seq1  TTTCTAACTACTGTTGAACAAAATTTGATCAAACTCTGCATCTAGATGTC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTAACTACTGTTGAACAAAATTTGATCAAACTCTGCATCTAGATGTC  247

seq1  AAAATTAAAACCCATGTTAGGTTCTTGGTTTTGTTTACTGAGCCACTGCA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTAAAACCCATGTTAGGTTCTTGGTTTTGTTTACTGAGCCACTGCA  297

seq1  TTTTGTGTCCGAGGCTCACATCAAACTGACTTTGTAGTCAAGGTTAACCT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGTGTCCGAGGCTCACATCAAACTGACTTTGTAGTCAAGGTTAACCT  347

seq1  TGAATTTCAGATCCTCCATCTCCTAAGTCCCAGTATTACTGACATGTGTC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATTTCAGATCCTCCATCTCCTAAGTCCCAGTATTACTGACATGTGTC  397

seq1  ACCACCAATATTTTTGTGCTTCTTCCTTTTAGTTGACAAGTGTCCTGTCT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACCAATATTTTTGTGCTTCTTCCTTTTAGTTGACAAGTGTCCTGTCT  447

seq1  AGCAGGACCTAGTTATTCCGTGGGTCAAGGAGGACCGAGGCCTGCAAGAG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGACCTAGTTATTCCGTGGGTCAAGGAGGACCGAGGCCTGCAAGAG  497

seq1  AAGCAGGTGGAGAAAGGGGAGCAAGACCAATCAAAGAGTTGTCAAGGTCT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGGTGGAGAAAGGGGAGCAAGACCAATCAAAGAGTTGTCAAGGTCT  547

seq1  GTTTAATGAAGGCTAAAAGCCAGGTTATAAGCACACAGTGAGAGAAAATA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAATGAAGGCTAAAAGCCAGGTTATAAGCACACAGTGAGAGAAAATA  597

seq1  GGGAGGGGTCGAGGGGGCATAATAAAATACAGAGAAAGGGATGGACATCT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGGGTCGAGGGGGCATAATAAAATACAGAGAAAGGGATGGACATCT  647

seq1  GGGGTGGATGCTGATTACAAGCTTCTAGCAGCTTTTCTTGCAATGTCGGC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTGGATGCTGATTACAAGCTTCTAGCAGCTTTTCTTGCAATGTCGGC  697

seq1  CCTAAAAGGGTCACGAGTGGCCTTCAAACATTCTGCAGTTTATCCTGGAT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAAAAGGGTCACGAGTGGCCTTCAAACATTCTGCAGTTTATCCTGGAT  747

seq1  TACCTGTCCTGACTAAACAGTCTCGGGCACCAAACAGAGGCATGGAGGAG  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTGTCCTGACTAAACAGTCTCGGGCACCAAACAGAGGCATGGAGGAG  797

seq1  GAGGTAAAGCTGCCTTAATCTAAGCAGTTCTAGGCTCGGAATGGAGACAT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTAAAGCTGCCTTAATCTAAGCAGTTCTAGGCTCGGAATGGAGACAT  847

seq1  GAAGAAGGGGATGAGGCTGGCAGTCTCAGGCTCCAGGTAGAGGCAATGAG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAGGGGATGAGGCTGGCAGTCTCAGGCTCCAGGTAGAGGCAATGAG  897

seq1  GAGGGGGTGACATAATTCCCTTCAAAGGTCAGCCGAATCTTTAGGGTGAG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGGGTGACATAATTCCCTTCAAAGGTCAGCCGAATCTTTAGGGTGAG  947

seq1  AGTTACTGGTGGGACCTAGTTTCCCACAGTTTAGTCTCTCACAGACAAGT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTACTGGTGGGACCTAGTTTCCCACAGTTTAGTCTCTCACAGACAAGT  997

seq1  ATTTATAGATCAAAATATGGGGCTTTGCTTTAAAATGCTCTGAATTC  1045
      |||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATAGATCAAAATATGGGGCTTTGCTTTAAAATGCTCTGAATTC  1044

seq1: chr4_121887429_121888520
seq2: B6Ng01-235P15.g_67_1166

seq1  GAATTCCAGTTATGGAGATTTGTGAGTGACCATATGGGTACTGAGAAGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGTTATGGAGATTTGTGAGTGACCATATGGGTACTGAGAAGAG  50

seq1  CAGTCTTTACTTTAAACTGTGAACCAGTATATTTATTTATTTTGAGACAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTTTACTTTAAACTGTGAACCAGTATATTTATTTATTTTGAGACAC  100

seq1  TGTCTCTCTATCTAGCCCAGAATGGACTGGAACTCAATATATAGAACAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTCTATCTAGCCCAGAATGGACTGGAACTCAATATATAGAACAAG  150

seq1  ATGGCCTTGAATTATAGAGACCACCCACACTCTCTGTCTCTGCCTCCAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCCTTGAATTATAGAGACCACCCACACTCTCTGTCTCTGCCTCCAGA  200

seq1  ATGTGGGAAGAAAGAATGCTATGGCTTGGTAAGATTGAATTCTTTTAGTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGGGAAGAAAGAATGCTATGGCTTGGTAAGATTGAATTCTTTTAGTC  250

seq1  TTTTACTGGCCTGAAGAGATGACAGAGTGGTTATAAGCTTTAGATTCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTACTGGCCTGAAGAGATGACAGAGTGGTTATAAGCTTTAGATTCTCT  300

seq1  TATAGAGAATGCAGGGTGATTCTCCAGGTCTAACACTCATTTTAAAACCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGAGAATGCAGGGTGATTCTCCAGGTCTAACACTCATTTTAAAACCA  350

seq1  CTGTCCCTTCATCTTCAGAGAATTCAGCAAACTATCCTTGACTTTTCAGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCCCTTCATCTTCAGAGAATTCAGCAAACTATCCTTGACTTTTCAGG  400

seq1  CACCAGAACCACAGGTAGTGCACACAAATTCATGCAGGCAACATGCCCAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCAGAACCACAGGTAGTGCACACAAATTCATGCAGGCAACATGCCCAC  450

seq1  ATTTAAAATTTATGAGTATTTGTGTGAATTTTTTATGTACAGTTTCCCAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAAAATTTATGAGTATTTGTGTGAATTTTTTATGTACAGTTTCCCAC  500

seq1  AGAGGCAAGAAAAAATAAATAACAAGCTTTCTTTGGTTGGTTTTTTTGTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCAAGAAAAAATAAATAACAAGCTTTCTTTGGTTGGTTTTTTTGTT  550

seq1  TTGTTTTGTTTTGTTTTGTTTTGTTTTTGCTTGTTTCTTTGTTGTTACAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTGTTTTGTTTTGTTTTGTTTTTGCTTGTTTCTTTGTTGTTACAT  600

seq1  ATGGTTTCTCTTTGTCACTGTCCTGGTTGTTCTGGAAATCAGTTTGTAGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTTTCTCTTTGTCACTGTCCTGGTTGTTCTGGAAATCAGTTTGTAGC  650

seq1  CCATACTTGTCTTGATTCACAAATTTTCATGTGTTAAGGGCATGTACCAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATACTTGTCTTGATTCACAAATTTTCATGTGTTAAGGGCATGTACCAC  700

seq1  TGGAGGAAAGATGCAATACACAATATTAAACACTTAAACATTCCTTTATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGGAAAGATGCAATACACAATATTAAACACTTAAACATTCCTTTATT  750

seq1  CTCCTAGACACCACAC----CACACACACACACACACACACACACACACA  796
      ||||||||||||||||    ||||||||||||||||||||||||||||||
seq2  CTCCTAGACACCACACCACACACACACACACACACACACACACACACACA  800

seq1  CACACACACACACACACAATTTGCTAATATTTGTTTGGCAAGTTGTAAGA  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACACACACACACAATTTGCTAATATTTGTTTGGCAAGTTGTAAGA  850

seq1  AATTTTTATATCTTCTGGAGATTGAACTTGCATACATGTTTTACA-TTTT  895
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  AATTTTTATATCTTCTGGAGATTGAACTTGCATACATGTTTTACATTTTT  900

seq1  TTTCTTTATTCTGAATTCTGGAGGCTGGTCTCATGAACAAGCA-TTCACC  944
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  TTTCTTTATTCTGAATTCTGGAGGCTGGTCTCATGAACAAGCATTTCACC  950

seq1  CTCCTATATTGTGGGTTGGGATTCCATGTGGGTTGTGGAACTGAATTTGG  994
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  CTCCTATATTGTGGGTTGGGATTCCATGTGGGTTGTGGAACTGAATTT-G  999

seq1  GCATGAGCCAAATGTGGGAAAAGAATTC-TAAACACAAAATGGTCAAATG  1043
      ||||||||||||||| |||||||||||| ||||||||||  |||||||||
seq2  GCATGAGCCAAATGTTGGAAAAGAATTCTTAAACACAAATGGGTCAAATG  1049

seq1  TT--AATTCAAAATCAAAGATGAAGTGAATAG-AATTGTCCTGCACTCAT  1090
      ||  | |||||||||||  ||| ||||||||| ||| |||||||||||||
seq2  TTTAATTTCAAAATCAAGAATG-AGTGAATAGAAATGGTCCTGCACTCAT  1098

seq1  TA  1092
      ||
seq2  TA  1100

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information