MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-243M18
Chromosome	4 (Build37)
Map Location	140,252,424 - 140,399,320
singlet/doublet	doublet
Overlap gene	Rcc2, Padi6, Padi4, Padi3, Padi1
Upstream gene	Pax7, Gm1667, Klhdc7a, Igsf21, LOC100040728, Arhgef10l
Downstream gene	Padi2, Sdhb, Atp13a2, Mfap2, Crocc, Necap2, LOC638991, Spata21, D4Ertd22e, Fbxo42, 6330545A04Rik, Arhgef19, Epha2, Gm693, Clcnka, Clcnkb, Hspb7, Gm694, Zbtb17, Spen, LOC100042951, B330016D10Rik, Fblim1, BC025833, Slc25a34, Plekhm2, Ddi2, Agmat, Dnajc16, Casp9, Ela2a, Ctrc
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pax7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18509 MGI:97491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381564 MGI:2686513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Klhdc7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242721 MGI:2444612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230868 MGI:2681842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Arhgef10l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72754 MGI:1920004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108911 MGI:1919784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242726 MGI:2655198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18602 MGI:1338898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18601 MGI:1338891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18599 MGI:1338893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18600 MGI:1338892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdhb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67680 MGI:1914930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp13a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74772 MGI:1922022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17150 MGI:99559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crocc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230872 MGI:3529431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Necap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66147 MGI:1913397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Spata21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329972 MGI:3607787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D4Ertd22e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213491 MGI:1098672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fbxo42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213499 MGI:1924992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330545A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76166 MGI:1923416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213649 MGI:1925912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epha2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13836 MGI:95278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm693 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277743 MGI:2685539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	Clcnka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12733 MGI:1329026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clcnkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56365 MGI:1930643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29818 MGI:1352494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm694 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277744 MGI:2685540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22642 MGI:107410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spen (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56381 MGI:1891706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	B330016D10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320456 MGI:2444063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 31 ESTs

name	Fblim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74202 MGI:1921452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213989 MGI:2384869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384071 MGI:2686215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69582 MGI:1916832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 2 Proteins

name	Ddi2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68817 MGI:1917244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agmat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75986 MGI:1923236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214063 MGI:2442146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12371 MGI:1277950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ela2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13706 MGI:95316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctrc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76701 MGI:1923951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pax7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502943 GeneID:18509 MGI:97491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired box gene 7 transcript_id : NM_011039.2

name	Gm1667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372602 GeneID:381564 MGI:2686513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 1667, (NCBI) transcript_id : XM_979440.1

name	Klhdc7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063541 GeneID:242721 MGI:2444612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 7A transcript_id : NM_173427.2

name	Igsf21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348465 GeneID:230868 MGI:2681842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobin superfamily, member 21 transcript_id : NM_198610.1

name	LOC100040728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253153 GeneID:100040728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040728 transcript_id : XM_001475143.1

name	Arhgef10l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254211 GeneID:72754 MGI:1920004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 10-like transcript_id : NM_172415.2

name	Rcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802188 GeneID:108911 MGI:1919784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of chromosome condensation 2 transcript_id : NM_173867.2

name	Padi6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372293 GeneID:242726 MGI:2655198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type VI transcript_id : NM_153106.2

name	Padi4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755017 GeneID:18602 MGI:1338898
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type IV transcript_id : NM_011061.1

name	Padi3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353909 GeneID:18601 MGI:1338891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type III transcript_id : NM_011060.2

name	Padi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130215 GeneID:18599 MGI:1338893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type I transcript_id : NM_011059.2

name	Padi2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679264 GeneID:18600 MGI:1338892
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type II transcript_id : NM_008812.1

name	Sdhb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328285 GeneID:67680 MGI:1914930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : succinate dehydrogenase complex, subunit B, iron sulfur (Ip) transcript_id : NM_023374.3

name	Atp13a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794173 GeneID:74772 MGI:1922022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase type 13A2 transcript_id : NM_029097.1

name	Mfap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982203 GeneID:17150 MGI:99559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 2 transcript_id : NM_008546.2

name	Crocc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006472 GeneID:230872 MGI:3529431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ciliary rootlet coiled-coil, rootletin transcript_id : NM_172122.1

name	Necap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560260 GeneID:66147 MGI:1913397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NECAP endocytosis associated 2 transcript_id : NM_025383.2

name	Spata21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802358 GeneID:329972 MGI:3607787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 21 transcript_id : NM_177867.3

name	D4Ertd22e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043938 GeneID:213491 MGI:1098672
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 22, expressed transcript_id : NM_174996.2

name	D4Ertd22e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043933 GeneID:213491 MGI:1098672
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 22, expressed transcript_id : NM_001025608.1

name	Fbxo42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254216 GeneID:213499 MGI:1924992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 42 transcript_id : NM_172518.2

name	6330545A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487178 GeneID:76166 MGI:1923416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330545A04 gene transcript_id : NM_001081174.1

name	Arhgef19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361383 GeneID:213649 MGI:1925912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 19 transcript_id : NM_172520.2

name	Epha2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32484982 GeneID:13836 MGI:95278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor A2 transcript_id : NM_010139.2

name	Gm693 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372608 GeneID:277743 MGI:2685539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : gene model 693, (NCBI) transcript_id : XM_204104.5

name	Clcnka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981385 GeneID:12733 MGI:1329026
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel Ka transcript_id : NM_024412.2

name	Clcnkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789908 GeneID:56365 MGI:1930643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel Kb transcript_id : NM_019701.1

name	Hspb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351368 GeneID:29818 MGI:1352494
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein family, member 7 (cardiovascular) transcript_id : NM_013868.3

name	Gm694 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385298 GeneID:277744 MGI:2685540
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 694, (NCBI) transcript_id : NM_001033374.2

name	Zbtb17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678626 GeneID:22642 MGI:107410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 17 transcript_id : NM_009541.1

name	Spen (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587000 GeneID:56381 MGI:1891706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPEN homolog, transcriptional regulator (Drosophila) transcript_id : NM_019763.2

name	LOC100042951 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253190 GeneID:100042951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100042951 transcript_id : XM_001479696.1

name	Fblim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343869 GeneID:74202 MGI:1921452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : filamin binding LIM protein 1 transcript_id : NM_133754.4

name	BC025833 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77020278 GeneID:213989 MGI:2384869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025833 transcript_id : NM_145987.2

name	Slc25a34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719317 GeneID:384071 MGI:2686215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 34 transcript_id : NM_001013780.1

name	Plekhm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372609 GeneID:69582 MGI:1916832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 2 Proteins product : pleckstrin homology domain containing, family M (with RUN domain) member 2 transcript_id : XM_980218.1

name	Ddi2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404398 GeneID:68817 MGI:1917244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA-damage inducible protein 2 transcript_id : NM_001017966.2

name	Agmat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487168 GeneID:75986 MGI:1923236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : agmatine ureohydrolase (agmatinase) transcript_id : NM_001081408.1

name	Dnajc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892867 GeneID:214063 MGI:2442146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 16 transcript_id : NM_172338.2

name	Casp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131034 GeneID:12371 MGI:1277950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 9 transcript_id : NM_015733.4

name	Ela2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892984 GeneID:13706 MGI:95316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elastase 2A transcript_id : NM_007919.2

name	Ctrc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053930 GeneID:76701 MGI:1923951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chymotrypsin C (caldecrin) transcript_id : NM_001033875.2

name	Pax7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328055 CCDS:CCDS18850.1 GeneID:18509 MGI:97491
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : paired box transcription factor PAX7 product : paired box gene 7 protein_id : NP_035169.1

name	Gm1667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372603 GeneID:381564 MGI:2686513
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984534.1

name	Klhdc7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063542 GeneID:242721 MGI:2444612
definition	codon_start : 1 note : novel kelch domain containing protein product : kelch domain containing 7A protein_id : NP_775603.2

name	Igsf21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348466 CCDS:CCDS18851.1 GeneID:230868 MGI:2681842
definition	codon_start : 1 note : novel protein containing immunoglobulin domains product : immunoglobin superfamily, member 21 protein_id : NP_941012.1

name	LOC100040728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253154 GeneID:100040728
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475193.1

name	Arhgef10l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254212 GeneID:72754 MGI:1920004
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005829 - cytosol [Evidence ISS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005622 - intracellular [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS]; GO:0005100 - Rho GTPase activator activity [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0035104 - positive regulation of sterol regulatory element binding-protein target gene transcription [Evidence ISS]; GO:0051496 - positive regulation of stress fiber formation [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : Rho guanine nucleotide exchange factor (GEF) 10-like protein_id : NP_766003.2

name	Rcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239431 CCDS:CCDS18852.1 GeneID:108911 MGI:1919784
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : RCC1-like protein_id : NP_776292.1

name	Padi6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372294 GeneID:242726 MGI:2655198
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0045111 - intermediate filament cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004668 - protein-arginine deiminase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : arginine deiminase-like protein; peptidylarginine deiminase, type VI product : peptidyl arginine deiminase, egg and embryo abundant protein_id : NP_694746.2

name	Padi4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755018 CCDS:CCDS18854.1 GeneID:18602 MGI:1338898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence TAS] [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAD type IV; peptidylarginine deiminase, type IV product : peptidyl arginine deiminase, type IV protein_id : NP_035191.1

name	Padi3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755016 CCDS:CCDS18855.1 GeneID:18601 MGI:1338891
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence TAS] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAD type III; peptidylarginine deiminase, type III product : peptidyl arginine deiminase, type III protein_id : NP_035190.1

name	Padi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755014 CCDS:CCDS18856.1 GeneID:18599 MGI:1338893
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence TAS] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : PAD type I; Pad type 1; peptidylarginine deiminase, type I product : peptidyl arginine deiminase, type I protein_id : NP_035189.1

name	Padi2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679265 CCDS:CCDS18857.1 GeneID:18600 MGI:1338892
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAD type II; peptidylarginine deiminase, type II product : peptidyl arginine deiminase, type II protein_id : NP_032838.1

name	Sdhb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328286 CCDS:CCDS18858.1 GeneID:67680 MGI:1914930
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051537 - 2 iron, 2 sulfur cluster binding [Evidence IEA]; GO:0051538 - 3 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008177 - succinate dehydrogenase (ubiquinone) activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : succinate dehydrogenase complex subunit B product : succinate dehydrogenase complex, subunit B, iron sulfur (Ip) protein_id : NP_075863.2

name	Atp13a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794174 CCDS:CCDS18859.1 GeneID:74772 MGI:1922022
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATPase type 13A2 protein_id : NP_083373.1

name	Mfap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678784 CCDS:CCDS18860.1 GeneID:17150 MGI:99559
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0001527 - microfibril [Evidence IEA] codon_start : 1 note : microfibril-associated glycoprotein; microfibril-associated glycoprotein 1 product : microfibril-associated glycoprotein 2 protein_id : NP_032572.1

name	Crocc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006473 CCDS:CCDS18861.1 GeneID:230872 MGI:3529431
definition	GO_component : GO:0005814 - centriole [Evidence IDA]; GO:0035253 - ciliary rootlet [Evidence IDA] GO_function : GO:0019894 - kinesin binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051297 - centrosome organization and biogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : rootletin product : ciliary rootlet coiled-coil, rootletin protein_id : NP_742120.1

name	Necap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384758 CCDS:CCDS18862.1 GeneID:66147 MGI:1913397
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : clathrin-coated vesicle coat protein; likely ortholog of H. sapiens adaptin-ear-binding coat-associated protein 2 (NECAP2) product : adaptin-ear-binding coat-associated protein 2 protein_id : NP_079659.1

name	Spata21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244468 CCDS:CCDS18863.1 GeneID:329972 MGI:3607787
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : novel protein containing an EF hand domain product : spermatogenesis associated 21 protein_id : NP_808535.1

name	D4Ertd22e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043934 CCDS:CCDS18864.1 GeneID:213491 MGI:1098672
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : putative MAPK activating protein PM20,PM21 isoform 1 protein_id : NP_001020779.1

name	D4Ertd22e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239391 CCDS:CCDS18865.1 GeneID:213491 MGI:1098672
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : putative MAPK activating protein PM20,PM21 isoform 2 protein_id : NP_778161.1

name	Fbxo42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254217 CCDS:CCDS18866.1 GeneID:213499 MGI:1924992
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 42 protein_id : NP_766106.2

name	6330545A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487179 GeneID:76166 MGI:1923416
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76166 protein_id : NP_001074643.1

name	Arhgef19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369718 CCDS:CCDS18868.1 GeneID:213649 MGI:1925912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : Rho guanine nucleotide exchange factor (GEF) 19 protein_id : NP_766108.1

name	Epha2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32484983 CCDS:CCDS18869.1 GeneID:13836 MGI:95278
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0048013 - ephrin receptor signaling pathway [Evidence IDA]; GO:0030182 - neuron differentiation [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : Eph receptor A2 protein_id : NP_034269.2

name	Gm693 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51709559 GeneID:277743 MGI:2685539
definition	codon_start : 1 product : hypothetical protein protein_id : XP_204104.3

name	Clcnka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981386 CCDS:CCDS18871.1 GeneID:12733 MGI:1329026
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0050878 - regulation of body fluids [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : putative basolateral cTAL chloride channel ClC-Ka; chloride channel K1 product : chloride channel Ka protein_id : NP_077723.2

name	Clcnkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789909 CCDS:CCDS18872.1 GeneID:56365 MGI:1930643
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : putative basolateral mTAL chloride channel ClC-Ka; chloride channel K1-like product : chloride channel Kb protein_id : NP_062675.1

name	Hspb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542970 CCDS:CCDS18873.1 GeneID:29818 MGI:1352494
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006950 - response to stress [Evidence IDA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 note : heat shock protein 25 kDa 2 (cardiovascular); heat shock 27kDa protein family, member 7 (cardiovascular) product : heat shock protein family, member 7 (cardiovascular) protein_id : NP_038896.2

name	Gm694 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701868 GeneID:277744 MGI:2685540
definition	codon_start : 1 product : hypothetical protein LOC277744 protein_id : NP_001028546.1

name	Zbtb17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678627 CCDS:CCDS18875.1 GeneID:22642 MGI:107410
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007398 - ectoderm development [Evidence IMP]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger protein 100 product : zinc finger and BTB domain containing 17 protein_id : NP_033567.1

name	Spen (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587001 GeneID:56381 MGI:1891706
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Msx2 interacting nuclear target protein product : SPEN homolog, transcriptional regulator protein_id : NP_062737.2

name	LOC100042951 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253191 GeneID:100042951
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479746.1

name	Fblim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625770 CCDS:CCDS18876.1 GeneID:74202 MGI:1921452
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 product : CSX-associated LIM protein_id : NP_598515.3

name	BC025833 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77020279 CCDS:CCDS18877.1 GeneID:213989 MGI:2384869
definition	codon_start : 1 product : hypothetical protein LOC213989 protein_id : NP_666099.2

name	Slc25a34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719318 CCDS:CCDS18878.1 GeneID:384071 MGI:2686215
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein containing Mitochondrial carrier protein domains product : solute carrier family 25, member 34 protein_id : NP_001013802.1

name	Plekhm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372610 GeneID:69582 MGI:1916832
definition	codon_start : 1 product : pleckstrin homology domain containing, family M (with RUN domain) member 2 protein_id : XP_985312.1

name	Ddi2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63003917 CCDS:CCDS18880.1 GeneID:68817 MGI:1917244
definition	codon_start : 1 product : DNA-damage inducible protein 2 protein_id : NP_001017966.1

name	Agmat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487169 GeneID:75986 MGI:1923236
definition	GO_function : GO:0016813 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : agmatine ureohydrolase (agmatinase) protein_id : NP_001074877.1

name	Dnajc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27261818 CCDS:CCDS18882.1 GeneID:214063 MGI:2442146
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : DnaJ (Hsp40) homolog, subfamily C, member 16 protein_id : NP_758841.1

name	Casp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560479 CCDS:CCDS18883.1 GeneID:12371 MGI:1277950
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : caspase 9 protein_id : NP_056548.2

name	Ela2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681297 CCDS:CCDS18884.1 GeneID:13706 MGI:95316
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004281 - pancreatic elastase II activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : neutrophilic elastase product : elastase 2 protein_id : NP_031945.1

name	Ctrc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443665 GeneID:76701 MGI:1923951
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004263 - chymotrypsin activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : chymotrypsin C (caldecrin) protein_id : NP_001029047.1

name	LOC638991 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253155 GeneID:638991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_001796.2

name	B330016D10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253192 GeneID:320456 MGI:2444063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 31 ESTs product : RIKEN cDNA B330016D10 gene transcript_id : XR_035407.1

clone name	MSMg01-499L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338A08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-243M18.b	B6Ng01-243M18.g
ACC	GA053087	GA053088
length	715	1,064
definition	B6Ng01-243M18.b	B6Ng01-243M18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(140,398,608 - 140,399,320)	(140,252,424 - 140,253,476)
sequence	gaattctcctgcccagaggcagtggcagtgggaaaggtaccttgaatgga caagccagtgggacttccaggagcctgaggctcccccaggggctgggtta gagccaggccacacatgatggtgtgatgaacttggggctcctccacccct ttgcttggtgactggctccagtggaggccaaggggctcaaaactggtctt gcttgctgataagcctggggaagatccccccaagtatgaggtatgctggt catctgagctgcccagagtttgaacctccagatgatagtgtataaggtga catcagaggaaatgattaatctccccagaggccacatggcctggcaattt gaaaaaatgtttgtatgtggggttaattgtgtgccatgaggtaactagtc tcaacaggggctgtaggccgtcctacagccacagggctagcttaatgcct ctctcctggtgggtcatctcaccacatcaactcccatccccaataggctg cctgcttcagcaccctgaccccttcaggccgttgggctactttcagcaaa gtgaaataagatgttcggggatttagggcaaggagtatggcggaacagtg gggggaggggtgggcgggatgcatgaaactctccgatgagctacaggaaa ggaccaggcctgagcatctcctgtgcttcttgaattccaaaaccaaccat gccctaccagtgtat	gaattccatgactcactgtcagaaatagaacagttggttttttaaaaatt aaattacttctatgtgtatggatgttttgcttgcatgtatatctgtgcac cacctgctgtgcatttctggtgcctaaggaagccagaggaggtattggat cccctaggactggagttaaagataataatgagccactatgtggatgctgg gaatagaacccaggtcctctaaaagagcagtcagggatcttaacttctga gcatctttccagatcctagaacagaatctttatctcttgactattaggac agggatgctgggacccaccgatctgggtataaggaaatattaaattcaga acgaactccagatccatgctgccattttacagacagaggaaatcagacag gaagcagaactctttcttagttgcagattaaccaactggttttccagttg ctcttgcaaaggcagtgttaggtctcaaagtcaggatggtaggctgagcg agtttcagaacagccagggttacacagagaaaccctgtctgaaaaacaaa gaaaaaaagaaaagaaaagaaaaaaaaagaaaagaagaaaagaaaagagg aaaggaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaagg aaaggaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaagg aaaggaaaggaaaggaaaggaaaggaaaggagccgggcatggtggcgcat gccttttaatcccagcacttgggaggcagaagcaaggcaaatttctgagt tcgaaggccagcctgggtctataaagtgagttccaggacagtccagggct acacagaagaaaccctgtctcaaaaaaacaaaacaaaacaaaaaacaaca cctaccctccccaaaaaaaacaaaagaaagaaagaaagagcaaagtaaat gggtcatttttagactagctatactaagtatattataatactatattaga ccagatgttatcattcacgcagaatcatgttacgttaatattcatttgaa aatgtagaatctgt
quality values	Open. Hide. 49 22 27 31 58 54 58 58 58 62 62 62 62 33 28 62 47 47 62 62 62 62 62 62 49 62 62 62 62 62 39 42 44 32 32 27 31 51 43 35 62 59 62 59 44 62 62 62 62 59 62 62 62 62 62 59 59 62 59 59 62 62 59 59 62 62 62 59 59 62 62 59 59 62 62 59 59 54 35 42 38 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 56 47 62 62 62 62 62 62 62 62 62 48 62 52 62 62 62 62 54 53 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 54 38 54 58 58 58 58 49 49 58 36 30 58 54 54 58 58 58 54 58 54 58 38 54 46 58 52 54 58 58 52 58 52 58 42 38 41 40 54 58 58 58 58 58 58 45 30 58 58 58 52 54 58 54 54 58 58 42 52 34 39 38 26 32 30 32 23 9 9 15 9 5 9 25 12 29 33 35 38 12 22 17 29 34 20 16 30 25 23 9 12 33 39 16 28 11 12 10 10 20 18 28 23 17 27 27 37 27 17 11 10 12 15 9 22 21 21 32 23 15 17 15 27 15 24 13 15 9 18 9 13 9 9 9 13 6 10 10 14 10 29 25 13 13 13 14 6 6 10 6 10 19 6 9 6	Open. Hide. 62 47 32 44 62 62 44 30 62 62 44 43 45 29 12 24 28 28 27 19 20 59 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 56 62 62 62 62 62 62 62 62 62 62 62 62 56 43 43 43 33 56 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 42 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 56 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 58 58 58 58 58 58 58 54 58 54 58 54 58 58 58 54 58 50 58 54 54 54 52 54 52 52 52 52 58 58 54 54 58 52 54 52 52 49 41 54 54 40 44 41 47 54 54 48 47 52 52 58 52 54 54 52 58 44 36 52 52 58 58 52 52 47 41 52 50 58 58 58 58 51 58 58 58 58 54 58 58 47 47 48 50 49 49 48 48 58 49 51 58 49 58 58 49 58 51 51 58 48 58 41 39 44 50 58 47 58 58 41 41 43 41 43 58 50 58 58 58 58 43 43 58 58 46 46 48 54 58 58 48 49 58 58 49 50 49 58 49 50 51 52 58 42 44 50 47 58 43 41 39 44 58 44 54 50 50 54 44 58 49 58 41 30 58 51 58 58 43 44 44 40 58 50 58 37 43 58 51 58 49 50 49 46 50 49 40 54 44 50 50 40 54 32 35 39 44 51 49 42 44 42 49 42 34 44 42 51 44 50 44 44 54 53 51 49 50 54 44 44 39 36 54 38 44 49 31 39 38 44 44 54 54 46 52 33 37 54 37 31 42 42 12 46 45 32 32 24 37 25 10 15 27 32 27 44 29 40 35 26 46 13 31 24 18 13 18 32 21 19 22 14 14 23 12 28 9 31 47 40 33 33 13 28 13 29 6 27 12 14 9 6 29 19 24 9 13 6 11 26 33 31 29 24 19 8 6 18 13 29 6 11 21 30 27 28 23 16 23 20 23 14 13 26 13 12 17 9 6 21 11 25 14 29 30 24 28 10 11 14 18 22 9 9 12 8 7 16 27 7 25 25 18 13 11 14 25 27 11 12 6 7 9 6 10 16 6 6 9 23 12 25 24 22 11 7 9 6 7 19 16 22 28 14 31 16 14 7 11 11 11 11 12 14 13 23 19 10 6 29 20 28 19 10 14 21 20 12 8 13 6 19 23 16 17 5 8 16 18 10 7 16 14 21 22 27 16 11 5 11 17 13 9 13 17 11 5 9 7 13 12 5 8 24 8 8 11 10 11 6 13 14 17 12 14 22 10 5 11 7 12 6 11 6 7 18 10 19 23 24 29 15 20 14 7 5 5 4 8 19 11 25 23 17 7 5 7 11 6 4 6 8 7 11 6 5 10 5 9 8 5 6 5 16 26 14 9 11 7 6 5 3 3 7 22 16 8 9 18 5 3 7 15 13 11 3 6 6 4 4 17 17 14 6 5 5 12 14 14 12 19 11 13 7 3 4 5 4 7 14 7 7 5 10 10 6 5 9 16 17 9 6 5 5 5 8 13 15 12 7 11 25

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_140398608_140399320
seq2: B6Ng01-243M18.b_49_763 (reverse)

seq1  ATACACT-GTAGGGCATGGTTGGTTTTGGAATTCAAGAAGCCCAGGAGAT  49
      ||||||| ||||||||||||||||||||||||||||||||| ||||||||
seq2  ATACACTGGTAGGGCATGGTTGGTTTTGGAATTCAAGAAGCACAGGAGAT  50

seq1  GCTCAGGCCTGGTCC-TTCCTGTAGCTCATCGGAGAGTTTCATGCATCCC  98
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  GCTCAGGCCTGGTCCTTTCCTGTAGCTCATCGGAGAGTTTCATGCATCCC  100

seq1  GCCCACCCCTCCCCCCACTGTTCCGCCATACTCCTTGCCCTAAATCCCCG  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCACCCCTCCCCCCACTGTTCCGCCATACTCCTTGCCCTAAATCCCCG  150

seq1  AACATCTTATTTCACTTTGCTGAAAGTAGCCCAACGGCCTGAAGGGGTCA  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATCTTATTTCACTTTGCTGAAAGTAGCCCAACGGCCTGAAGGGGTCA  200

seq1  GGGTGCTGAAGCAGGCAGCCTATTGGGGATGGGAGTTGATGTGGTGAGAT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGCTGAAGCAGGCAGCCTATTGGGGATGGGAGTTGATGTGGTGAGAT  250

seq1  GACCCACCAGGAGAGAGGCATTAAGCTAGCCCTGTGGCTGTAGGACGGCC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCACCAGGAGAGAGGCATTAAGCTAGCCCTGTGGCTGTAGGACGGCC  300

seq1  TACAGCCCCTGTTGAGACTAGTTACCTCATGGCACACAATTAACCCCACA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGCCCCTGTTGAGACTAGTTACCTCATGGCACACAATTAACCCCACA  350

seq1  TACAAACATTTTTTCAAATTGCCAGGCCATGTGGCCTCTGGGGAGATTAA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAAACATTTTTTCAAATTGCCAGGCCATGTGGCCTCTGGGGAGATTAA  400

seq1  TCATTTCCTCTGATGTCACCTTATACACTATCATCTGGAGGTTCAAACTC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTCCTCTGATGTCACCTTATACACTATCATCTGGAGGTTCAAACTC  450

seq1  TGGGCAGCTCAGATGACCAGCATACCTCATACTTGGGGGGATCTTCCCCA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAGCTCAGATGACCAGCATACCTCATACTTGGGGGGATCTTCCCCA  500

seq1  GGCTTATCAGCAAGCAAGACCAGTTTTGAGCCCCTTGGCCTCCACTGGAG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTATCAGCAAGCAAGACCAGTTTTGAGCCCCTTGGCCTCCACTGGAG  550

seq1  CCAGTCACCAAGCAAAGGGGTGGAGGAGCCCCAAGTTCATCACACCATCA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTCACCAAGCAAAGGGGTGGAGGAGCCCCAAGTTCATCACACCATCA  600

seq1  TGTGTGGCCTGGCTCTAACCCAGCCCCTGGGGGAGCCTCAGGCTCCTGGA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGGCCTGGCTCTAACCCAGCCCCTGGGGGAGCCTCAGGCTCCTGGA  650

seq1  AGTCCCACTGGCTTGTCCATTCAAGGTACCTTTCCCACTGCCACTGCCTC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCCACTGGCTTGTCCATTCAAGGTACCTTTCCCACTGCCACTGCCTC  700

seq1  TGGGCAGGAGAATTC  713
      |||||||||||||||
seq2  TGGGCAGGAGAATTC  715

seq1: chr4_140252424_140253476
seq2: B6Ng01-243M18.g_67_1130

seq1  GAATTCCATGACTCACTGTCAGAAATAGAACAGTTGGTTTTTTAAAAATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATGACTCACTGTCAGAAATAGAACAGTTGGTTTTTTAAAAATT  50

seq1  AAATTACTTCTATGTGTATGGATGTTTTGCTTGCATGTATATCTGTGCAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTACTTCTATGTGTATGGATGTTTTGCTTGCATGTATATCTGTGCAC  100

seq1  CACCTGCTGTGCATTTCTGGTGCCTAAGGAAGCCAGAGGAGGTATTGGAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTGCTGTGCATTTCTGGTGCCTAAGGAAGCCAGAGGAGGTATTGGAT  150

seq1  CCCCTAGGACTGGAGTTAAAGATAATAATGAGCCACTATGTGGATGCTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTAGGACTGGAGTTAAAGATAATAATGAGCCACTATGTGGATGCTGG  200

seq1  GAATAGAACCCAGGTCCTCTAAAAGAGCAGTCAGGGATCTTAACTTCTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATAGAACCCAGGTCCTCTAAAAGAGCAGTCAGGGATCTTAACTTCTGA  250

seq1  GCATCTTTCCAGATCCTAGAACAGAATCTTTATCTCTTGACTATTAGGAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATCTTTCCAGATCCTAGAACAGAATCTTTATCTCTTGACTATTAGGAC  300

seq1  AGGGATGCTGGGACCCACCGATCTGGGTATAAGGAAATATTAAATTCAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGATGCTGGGACCCACCGATCTGGGTATAAGGAAATATTAAATTCAGA  350

seq1  ACGAACTCCAGATCCATGCTGCCATTTTACAGACAGAGGAAATCAGACAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGAACTCCAGATCCATGCTGCCATTTTACAGACAGAGGAAATCAGACAG  400

seq1  GAAGCAGAACTCTTTCTTAGTTGCAGATTAACCAACTGGTTTTCCAGTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCAGAACTCTTTCTTAGTTGCAGATTAACCAACTGGTTTTCCAGTTG  450

seq1  CTCTTGCAAAGGCAGTGTTAGGTCTCAAAGTCAGGATGGTAGGCTGAGCG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGCAAAGGCAGTGTTAGGTCTCAAAGTCAGGATGGTAGGCTGAGCG  500

seq1  AGTTTCAGAACAGCCAGGGTTACACAGAGAAACCCTGTCTGAAAAACAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTCAGAACAGCCAGGGTTACACAGAGAAACCCTGTCTGAAAAACAAA  550

seq1  GAAAAAAAGAAAAGAAAAGAAAAAAAAAGAAAAGAAGAAAAGAAAAG---  597
      |||||||||||||||||||||||||||||||||||||||||||||||   
seq2  GAAAAAAAGAAAAGAAAAGAAAAAAAAAGAAAAGAAGAAAAGAAAAGAGG  600

seq1  ------------AGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGG  635
                  ||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGG  650

seq1  AAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGG  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGG  700

seq1  AAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAGCCGGGCATGGTGGCGCAT  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAGCCGGGCATGGTGGCGCAT  750

seq1  GCC-TTTAATCCCAGCACTTGGGAGGCAGAGGC-AGGCAGATTTCTGAGT  783
      ||| |||||||||||||||||||||||||| || ||||| ||||||||||
seq2  GCCTTTTAATCCCAGCACTTGGGAGGCAGAAGCAAGGCAAATTTCTGAGT  800

seq1  TCG-AGGCCAGCCT-GGTCTATAAAGTGAGTTCCAGGACAG-CCAGGGCT  830
      ||| |||||||||| |||||||||||||||||||||||||| ||||||||
seq2  TCGAAGGCCAGCCTGGGTCTATAAAGTGAGTTCCAGGACAGTCCAGGGCT  850

seq1  ACACAG-AGAAACCCTGTCTCAAAAAAACAAAACAAAACAAAAAACAACA  879
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAGAAGAAACCCTGTCTCAAAAAAACAAAACAAAACAAAAAACAACA  900

seq1  ACAACCCCCCCCAAAAAAAAAACAAAAGAGAGAAAAGAAAGAGCAAAGTA  929
       | |||| ||||  ||||||||||||||| || |||||||||||||||| 
seq2  CCTACCCTCCCC--AAAAAAAACAAAAGAAAG-AAAGAAAGAGCAAAGT-  946

seq1  AAATGGGTCATTTTTAGACTAGTATATACTAATTATTATTATAATACTAT  979
      ||||||||||||||||||||||  |||||||| || ||||||||||||||
seq2  AAATGGGTCATTTTTAGACTAG-CTATACTAAGTA-TATTATAATACTAT  994

seq1  A-TAGACAAGATGTTATCATTTCAACGTAGAATCAATGTTACTTTAAATA  1028
      | ||||| |||||||||||||   ||| |||||| ||||||| || ||||
seq2  ATTAGACCAGATGTTATCATT--CACGCAGAATC-ATGTTACGTT-AATA  1040

seq1  TTCACTTTAAAATGTTAAGATCTGT  1053
      |||| || |||||| ||  ||||||
seq2  TTCATTTGAAAATG-TAGAATCTGT  1064

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information