MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-251B21
Chromosome	4 (Build37)
Map Location	134,624,606 - 134,799,355
singlet/doublet	doublet
Overlap gene	Runx3, Clic4
Upstream gene	Aim1l, Cd52, Ubxd5, Sh3bgrl3, Ccdc21, EG665186, Catsper4, Cnksr1, Zfp593, Grrp1, Pdik1l, Trim63, Slc30a2, Extl1, LOC434166, Pafah2, Stmn1, Paqr7, 2610002D18Rik, 2410166I05Rik, Sepn1, Man1c1, Ldlrap1, Tmem57, Rhd, Tmem50a, D4Wsu53e, Syf2
Downstream gene	LOC676072, Srrm1, A330049M08Rik, LOC665287, Dscr1l2, Npal3, 4930555I21Rik, Grhl3, 1700029M20Rik, Il28ra, Il22ra1, LOC665334, Myom3, Fusip1, Pnrc2, Cnr2, Fuca1, Hmgcl, Gale, Lypla2, 1110049F12Rik, LOC669445, Tceb3, Rpl11, Id3, E2f2, Ddefl1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aim1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230806 MGI:1334463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins

name	Cd52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23833 MGI:1346088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubxd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67586 MGI:1914836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bgrl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73723 MGI:1920973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70012 MGI:1917262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665186 MGI:3702974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Catsper4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329954 MGI:3043288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnksr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194231 MGI:2670958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp593 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68040 MGI:1915290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72690 MGI:1919940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins

name	Pdik1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230809 MGI:2385213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433766 MGI:2447992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc30a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230810 MGI:106637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Extl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56219 MGI:1888742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Pafah2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100163 MGI:2140321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stmn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16765 MGI:96739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paqr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71904 MGI:1919154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610002D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69885 MGI:1917135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410166I05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76824 MGI:1924074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sepn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74777 MGI:2151208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man1c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230815 MGI:2446214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldlrap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100017 MGI:2140175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66146 MGI:1913396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19746 MGI:1202882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem50a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71817 MGI:1919067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D4Wsu53e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27981 MGI:106498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68592 MGI:1915842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Runx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12399 MGI:102672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clic4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29876 MGI:1352754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676072 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Srrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51796 MGI:1858303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A330049M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230822 MGI:2444888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665287 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Dscr1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53902 MGI:1858220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74552 MGI:1921802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930555I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78806 MGI:1926056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grhl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230824 MGI:2655333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700029M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73937 MGI:1913597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Il28ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242700 MGI:2429859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il22ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230828 MGI:2663588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins pseudo : _no_value

name	Myom3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242702 MGI:2685280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 5 Proteins

name	Fusip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14105 MGI:1333805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pnrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52830 MGI:106512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12802 MGI:104650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fuca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71665 MGI:95593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmgcl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15356 MGI:96158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gale (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74246 MGI:1921496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lypla2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26394 MGI:1347000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110049F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66193 MGI:1913443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	Tceb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27224 MGI:1351315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67025 MGI:1914275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Id3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15903 MGI:96398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242705 MGI:1096341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddefl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230837 MGI:2684986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aim1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372629 GeneID:230806 MGI:1334463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : absent in melanoma 1-like, transcript variant 1 transcript_id : XM_131754.7

name	Cd52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14719423 GeneID:23833 MGI:1346088
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD52 antigen transcript_id : NM_013706.1

name	Ubxd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129822 GeneID:67586 MGI:1914836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UBX domain containing 5 transcript_id : NM_026257.2

name	Sh3bgrl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18017601 GeneID:73723 MGI:1920973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 domain binding glutamic acid-rich protein-like 3 transcript_id : NM_080559.1

name	Ccdc21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541891 GeneID:70012 MGI:1917262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 21 transcript_id : NM_144527.2

name	EG665186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123959719 GeneID:665186 MGI:3702974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG665186 transcript_id : NM_001080712.1

name	Catsper4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384331 GeneID:329954 MGI:3043288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : channel, sperm associated 4 transcript_id : NM_177866.3

name	Cnksr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486673 GeneID:194231 MGI:2670958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : connector enhancer of kinase suppressor of Ras 1 transcript_id : NM_001081047.1

name	Zfp593 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195641 GeneID:68040 MGI:1915290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 593 transcript_id : NM_024215.1

name	Grrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253169 GeneID:72690 MGI:1919940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins product : glycine/arginine rich protein 1 transcript_id : XM_485455.5

name	Pdik1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254185 GeneID:230809 MGI:2385213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDLIM1 interacting kinase 1 like transcript_id : NM_146156.2

name	Trim63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244069 GeneID:433766 MGI:2447992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 63 transcript_id : NM_001039048.2

name	Slc30a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89179311 GeneID:230810 MGI:106637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 30 (zinc transporter), member 2 transcript_id : NM_001039677.1

name	Extl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9624985 GeneID:56219 MGI:1888742
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exostoses (multiple)-like 1 transcript_id : NM_019578.1

name	LOC434166 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253171 GeneID:434166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to hypothetical protein MGC37588 transcript_id : XM_001478477.1

name	Pafah2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527095 GeneID:100163 MGI:2140321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor acetylhydrolase 2 transcript_id : NM_133880.1

name	Stmn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892615 GeneID:16765 MGI:96739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stathmin 1 transcript_id : NM_019641.3

name	Paqr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388621 GeneID:71904 MGI:1919154
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progestin and adipoQ receptor family member VII transcript_id : NM_027995.2

name	2610002D18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487373 GeneID:69885 MGI:1917135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610002D18 gene transcript_id : NM_001081099.1

name	2410166I05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892380 GeneID:76824 MGI:1924074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410166I05 gene transcript_id : NM_029759.3

name	Sepn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111118963 GeneID:74777 MGI:2151208
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenoprotein N, 1 transcript_id : NM_029100.2

name	Man1c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131038 GeneID:230815 MGI:2446214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase, alpha, class 1C, member 1 transcript_id : NM_207237.2

name	Ldlrap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704091 GeneID:100017 MGI:2140175
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor adaptor protein 1 transcript_id : NM_145554.1

name	Tmem57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365976 GeneID:66146 MGI:1913396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 57 transcript_id : NM_025382.5

name	Rhd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982765 GeneID:19746 MGI:1202882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rh blood group, D antigen transcript_id : NM_011270.2

name	Tmem50a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990167 GeneID:71817 MGI:1919067
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 50A transcript_id : NM_027935.2

name	D4Wsu53e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560077 GeneID:27981 MGI:106498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, Wayne State University 53, expressed transcript_id : NM_023665.2

name	Syf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803100 GeneID:68592 MGI:1915842
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SYF2 homolog, RNA splicing factor (S. cerevisiae) transcript_id : NM_026780.2

name	Runx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579890 GeneID:12399 MGI:102672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : runt related transcription factor 3 transcript_id : NM_019732.2

name	Clic4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130925 GeneID:29876 MGI:1352754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride intracellular channel 4 (mitochondrial) transcript_id : NM_013885.2

name	Srrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354391 GeneID:51796 MGI:1858303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/arginine repetitive matrix 1 transcript_id : NM_016799.2

name	A330049M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704093 GeneID:230822 MGI:2444888
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A330049M08 gene transcript_id : NM_145555.1

name	Dscr1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802845 GeneID:53902 MGI:1858220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Down syndrome critical region gene 1-like 2 transcript_id : NM_022980.4

name	Npal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364504 GeneID:74552 MGI:1921802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIPA-like domain containing 3 transcript_id : NM_028995.3

name	4930555I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801735 GeneID:78806 MGI:1926056
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930555I21 gene transcript_id : NM_030189.2

name	Grhl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480135 GeneID:230824 MGI:2655333
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : grainyhead-like 3 (Drosophila) transcript_id : NM_001013756.1

name	Il28ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254284 GeneID:242700 MGI:2429859
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 28 receptor alpha transcript_id : NM_174851.2

name	Il22ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30142708 GeneID:230828 MGI:2663588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 22 receptor, alpha 1 transcript_id : NM_178257.1

name	Myom3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372579 GeneID:242702 MGI:2685280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 5 Proteins product : myomesin family, member 3 transcript_id : XM_144099.7

name	Fusip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937375 GeneID:14105 MGI:1333805
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUS interacting protein (serine-arginine rich) 1 transcript_id : NM_010178.2

name	Fusip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937371 GeneID:14105 MGI:1333805
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUS interacting protein (serine-arginine rich) 1 transcript_id : NM_001080387.1

name	Pnrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374269 GeneID:52830 MGI:106512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich nuclear receptor coactivator 2 transcript_id : NM_026383.2

name	Cnr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981836 GeneID:12802 MGI:104650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cannabinoid receptor 2 (macrophage) transcript_id : NM_009924.2

name	Fuca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802500 GeneID:71665 MGI:95593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosidase, alpha-L- 1, tissue transcript_id : NM_024243.3

name	Hmgcl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680232 GeneID:15356 MGI:96158
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-hydroxy-3-methylglutaryl-Coenzyme A lyase transcript_id : NM_008254.1

name	Gale (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130587 GeneID:74246 MGI:1921496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-4-epimerase, UDP transcript_id : NM_178389.3

name	Lypla2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242155 GeneID:26394 MGI:1347000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysophospholipase 2 transcript_id : NM_011942.1

name	1110049F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802905 GeneID:66193 MGI:1913443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110049F12 gene transcript_id : NM_025411.3

name	Tceb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801340 GeneID:27224 MGI:1351315
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor B (SIII), polypeptide 3 transcript_id : NM_013736.3

name	Rpl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359456 GeneID:67025 MGI:1914275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L11 transcript_id : NM_025919.2

name	Id3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680340 GeneID:15903 MGI:96398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of DNA binding 3 transcript_id : NM_008321.1

name	E2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803420 GeneID:242705 MGI:1096341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E2F transcription factor 2 transcript_id : NM_177733.3

name	Ddefl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711263 GeneID:230837 MGI:2684986
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : development and differentiation enhancing factor-like 1 transcript_id : NM_001008232.1

name	Aim1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895232 GeneID:230806 MGI:1334463
definition	codon_start : 1 product : similar to absent in melanoma 1-like isoform 1 protein_id : XP_131754.6

name	Cd52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14719424 GeneID:23833 MGI:1346088
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : CD52 antigen protein_id : NP_038734.1

name	Ubxd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385766 CCDS:CCDS18763.1 GeneID:67586 MGI:1914836
definition	codon_start : 1 product : socius protein_id : NP_080533.1

name	Sh3bgrl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18017602 GeneID:73723 MGI:1920973
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : SH3 domain binding glutamic acid-rich protein-like 3 protein_id : NP_542126.1

name	Ccdc21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541892 CCDS:CCDS18765.1 GeneID:70012 MGI:1917262
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 21 protein_id : NP_653110.2

name	EG665186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123959720 GeneID:665186 MGI:3702974
definition	codon_start : 1 product : uromodulin precursor-like protein_id : NP_001074181.1

name	Catsper4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244466 CCDS:CCDS18766.1 GeneID:329954 MGI:3043288
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : cation channel of sperm 4 product : channel, sperm associated 4 protein_id : NP_808534.1

name	Cnksr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486674 GeneID:194231 MGI:2670958
definition	GO_component : GO:0005938 - cell cortex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence ISS] GO_process : GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS] codon_start : 1 product : connector enhancer of kinase suppressor of Ras 1 protein_id : NP_001074516.1

name	Zfp593 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195642 GeneID:68040 MGI:1915290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 593 protein_id : NP_077177.1

name	Grrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253170 GeneID:72690 MGI:1919940
definition	codon_start : 1 product : glycine/arginine rich protein 1 protein_id : XP_485455.4

name	Pdik1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122689 CCDS:CCDS18768.1 GeneID:230809 MGI:2385213
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : PDLIM1 interacting kinase 1 like protein_id : NP_666268.1

name	Trim63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244070 GeneID:433766 MGI:2447992
definition	GO_component : GO:0043292 - contractile fiber [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006936 - muscle contraction [Evidence ISS]; GO:0043161 - proteasomal ubiquitin-dependent protein catabolism [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ring finger protein 28; muscle ring finger protein 1 product : tripartite motif-containing 63 protein_id : NP_001034137.2

name	Slc30a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179312 GeneID:230810 MGI:106637
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : zinc transporter 2 product : solute carrier family 30 (zinc transporter), member 2 protein_id : NP_001034766.1

name	Extl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9624986 CCDS:CCDS18770.1 GeneID:56219 MGI:1888742
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050508 - glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation note : multiple exostoses-like 1 product : exostoses (multiple)-like 1 protein_id : NP_062524.1

name	LOC434166 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253172 GeneID:434166
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478527.1

name	Pafah2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527096 CCDS:CCDS18771.1 GeneID:100163 MGI:2140321
definition	GO_component : GO:0008247 - 2-acetyl-1-alkylglycerophosphocholine esterase complex [Evidence IEA] GO_function : GO:0003847 - 1-alkyl-2-acetylglycerophosphocholine esterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : platelet-activating factor acetylhydrolase 2 protein_id : NP_598641.1

name	Stmn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789995 CCDS:CCDS18772.1 GeneID:16765 MGI:96739
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0015631 - tubulin binding [Evidence ISS] GO_process : GO:0007409 - axonogenesis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007019 - microtubule depolymerization [Evidence ISS]; GO:0007052 - mitotic spindle organization and biogenesis [Evidence ISS]; GO:0031115 - negative regulation of microtubule polymerization [Evidence IDA]; GO:0051272 - positive regulation of cell motility [Evidence IGI] codon_start : 1 note : leukemia associated phosphoprotein p18; metablastin; oncoprotein18; prosolin; leukemia-associated product : stathmin 1 protein_id : NP_062615.1

name	Paqr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313652 CCDS:CCDS18773.1 GeneID:71904 MGI:1919154
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : membrane progestin receptor alpha product : progestin and adipoQ receptor family member VII protein_id : NP_082271.1

name	2610002D18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487374 GeneID:69885 MGI:1917135
definition	codon_start : 1 product : hypothetical protein LOC69885 protein_id : NP_001074568.1

name	2410166I05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313286 CCDS:CCDS18775.1 GeneID:76824 MGI:1924074
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76824 protein_id : NP_084035.1

name	Sepn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111118964 GeneID:74777 MGI:2151208
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : selenoprotein N, 1 protein_id : NP_083376.2 transl_except : (pos:complement(134098253..134098255),aa:Sec)

name	Man1c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402229 CCDS:CCDS18776.1 GeneID:230815 MGI:2446214
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0004571 - mannosyl-oligosaccharide 1,2-alpha-mannosidase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0006013 - mannose metabolism [Evidence ISS]; GO:0030166 - proteoglycan biosynthesis [Evidence ISS] codon_start : 1 product : mannosidase, alpha, class 1C, member 1 protein_id : NP_997120.1

name	Ldlrap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704092 GeneID:100017 MGI:2140175
definition	GO_component : GO:0030121 - AP-1 adaptor complex [Evidence ISS]; GO:0030122 - AP-2 adaptor complex [Evidence ISS]; GO:0009925 - basal plasma membrane [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0005769 - early endosome [Evidence IDA] GO_function : GO:0030276 - clathrin binding [Evidence ISS]; GO:0001784 - phosphotyrosine binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0030674 - protein binding, bridging [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS]; GO:0015460 - transport accessory protein activity [Evidence ISS] GO_process : GO:0042632 - cholesterol homeostasis [Evidence ISS] [Evidence IMP]; GO:0008203 - cholesterol metabolism [Evidence IEA] [Evidence ISS]; GO:0006897 - endocytosis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0048260 - positive regulation of receptor mediated endocytosis [Evidence ISS]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : LDL receptor adaptor protein product : low density lipoprotein receptor adaptor protein 1 protein_id : NP_663529.1

name	Tmem57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254350 CCDS:CCDS18777.1 GeneID:66146 MGI:1913396
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : macoilin product : transmembrane protein 57 protein_id : NP_079658.2

name	Rhd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982766 CCDS:CCDS18778.1 GeneID:19746 MGI:1202882
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] codon_start : 1 exception : mismatches in translation note : Rh-like polypeptide product : Rhesus blood group CE and D protein_id : NP_035400.2

name	Tmem50a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34610239 CCDS:CCDS18779.1 GeneID:71817 MGI:1919067
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : small membrane protein 1 protein_id : NP_082211.1

name	D4Wsu53e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560078 GeneID:27981 MGI:106498
definition	codon_start : 1 product : hypothetical protein LOC27981 protein_id : NP_076154.2

name	Syf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312064 CCDS:CCDS18781.1 GeneID:68592 MGI:1915842
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : CCNDBP1 interactor; GCIP-interacting protein p29 (Gcipip) product : SYF2 homolog, RNA splicing factor protein_id : NP_081056.1

name	Runx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579891 CCDS:CCDS18782.1 GeneID:12399 MGI:102672
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IMP]; GO:0048469 - cell maturation [Evidence IGI]; GO:0031069 - hair follicle morphogenesis [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IMP]; GO:0050680 - negative regulation of epithelial cell proliferation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IMP]; GO:0031175 - neurite development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription factor AML2/CBFA3; core binding factor alpha 3; runt domain, alpha subunit 3 product : runt related transcription factor 3 protein_id : NP_062706.2

name	Clic4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304963 CCDS:CCDS18783.1 GeneID:29876 MGI:1352754
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005902 - microvillus [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0005254 - chloride channel activity [Evidence ISS]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence ISS]; GO:0006821 - chloride transport [Evidence IEA] [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : chloride intracellular channel 4 (mitochondrial) protein_id : NP_038913.1

name	Srrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949115 GeneID:51796 MGI:1858303
definition	GO_component : GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA]; GO:0031202 - RNA splicing factor activity, transesterification mechanism [Evidence ISS] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : plenty-of-prolines-101; serine/arginine repetitive matrix protein 1 product : Ser/Arg-related nuclear matrix protein protein_id : NP_058079.1

name	A330049M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704094 CCDS:CCDS18784.1 GeneID:230822 MGI:2444888
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC230822 protein_id : NP_663530.1

name	Dscr1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12667790 CCDS:CCDS18785.1 GeneID:53902 MGI:1858220
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0019722 - calcium-mediated signaling [Evidence IEA] codon_start : 1 product : Down syndrome critical region gene 1-like 2 protein_id : NP_075356.1

name	Npal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037383 CCDS:CCDS18786.1 GeneID:74552 MGI:1921802
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : novel protein containing a DUF803 domain product : NIPA-like domain containing 3 protein_id : NP_083271.1

name	4930555I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313496 CCDS:CCDS18787.1 GeneID:78806 MGI:1926056
definition	codon_start : 1 product : hypothetical protein LOC78806 protein_id : NP_084465.1

name	Grhl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480136 GeneID:230824 MGI:2655333
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007398 - ectoderm development [Evidence IMP]; GO:0008544 - epidermis development [Evidence IMP]; GO:0007389 - pattern specification [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0042060 - wound healing [Evidence IMP] codon_start : 1 note : grainy head-like 3; transcription factor hSOM1; sister-of-mammalian grainyhead product : transcription factor CP2-like 4 protein_id : NP_001013778.1

name	Il28ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254285 CCDS:CCDS18788.1 GeneID:242700 MGI:2429859
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004907 - interleukin receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : class II cytokine receptor 12; interferon-lambda receptor 1 product : interleukin 28 receptor alpha protein_id : NP_777276.2

name	Il22ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142709 CCDS:CCDS18789.1 GeneID:230828 MGI:2663588
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : interleukin-22 receptor alpha chain product : interleukin 22 receptor, alpha 1 protein_id : NP_839988.1

name	Myom3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895260 GeneID:242702 MGI:2685280
definition	codon_start : 1 product : myomesin family, member 3 protein_id : XP_144099.6

name	Fusip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753820 CCDS:CCDS18791.1 GeneID:14105 MGI:1333805
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC] [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] [Evidence IC] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0031202 - RNA splicing factor activity, transesterification mechanism [Evidence IDA]; GO:0051082 - unfolded protein binding [Evidence NAS] GO_process : GO:0016482 - cytoplasmic transport [Evidence IDA]; GO:0006406 - mRNA export from nucleus [Evidence NAS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0048025 - negative regulation of nuclear mRNA splicing, via spliceosome [Evidence IDA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence NAS] [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Fus-associated protein with serine-arginine repeats; neural-salient serine/arginine-rich product : FUS interacting protein (serine-arginine rich) 1 isoform 1 protein_id : NP_034308.1

name	Fusip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937372 GeneID:14105 MGI:1333805
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC] [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] [Evidence IC] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0031202 - RNA splicing factor activity, transesterification mechanism [Evidence IDA]; GO:0051082 - unfolded protein binding [Evidence NAS] GO_process : GO:0016482 - cytoplasmic transport [Evidence IDA]; GO:0006406 - mRNA export from nucleus [Evidence NAS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0048025 - negative regulation of nuclear mRNA splicing, via spliceosome [Evidence IDA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence NAS] [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Fus-associated protein with serine-arginine repeats; neural-salient serine/arginine-rich product : FUS interacting protein (serine-arginine rich) 1 isoform 2 protein_id : NP_001073856.1

name	Pnrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385876 CCDS:CCDS18792.1 GeneID:52830 MGI:106512
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : proline-rich nuclear receptor coactivator 2 protein_id : NP_080659.1

name	Cnr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981837 CCDS:CCDS18793.1 GeneID:12802 MGI:104650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cannabinoid receptor 2 (spleen) product : cannabinoid receptor 2 (macrophage) protein_id : NP_034054.2

name	Fuca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541781 CCDS:CCDS18794.1 GeneID:71665 MGI:95593
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004560 - alpha-L-fucosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alpha-L-fucosidase product : fucosidase, alpha-L-1, tissue protein_id : NP_077205.2

name	Hmgcl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680233 CCDS:CCDS18795.1 GeneID:15356 MGI:96158
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004419 - hydroxymethylglutaryl-CoA lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : 3-hydroxy-3-methylglutaryl-Coenzyme A lyase protein_id : NP_032280.1

name	Gale (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409988 CCDS:CCDS18796.1 GeneID:74246 MGI:1921496
definition	GO_function : GO:0050662 - coenzyme binding [Evidence IEA]; GO:0016857 - racemase and epimerase activity, acting on carbohydrates and derivatives [Evidence IEA]; GO:0003978 - UDP-glucose 4-epimerase activity [Evidence IDA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0044237 - cellular metabolism [Evidence IEA] codon_start : 1 product : galactose-4-epimerase, UDP protein_id : NP_848476.1

name	Lypla2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242156 CCDS:CCDS18797.1 GeneID:26394 MGI:1347000
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : lysophospholipase II product : lysophospholipase 2 protein_id : NP_036072.1

name	1110049F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076883 GeneID:66193 MGI:1913443
definition	codon_start : 1 exception : unclassified translation discrepancy note : novel protein containing a DUF1000 domain product : thioredoxin family Trp26 protein_id : NP_079687.2

name	Tceb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543847 CCDS:CCDS18798.1 GeneID:27224 MGI:1351315
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : transcription elongation factor B (SIII), polypeptide 3 (110kD); Elongin A product : transcription elongation factor B (SIII), polypeptide 3 protein_id : NP_038764.2

name	Rpl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385408 CCDS:CCDS18799.1 GeneID:67025 MGI:1914275
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L11 protein_id : NP_080195.1

name	Id3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680341 CCDS:CCDS18800.1 GeneID:15903 MGI:96398
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030855 - epithelial cell differentiation [Evidence IDA]; GO:0007507 - heart development [Evidence IGI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : inhibitor of DNA binding 3 protein_id : NP_032347.1

name	E2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244208 CCDS:CCDS18801.1 GeneID:242705 MGI:1096341
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E2F transcription factor 2 protein_id : NP_808401.1

name	Ddefl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56711264 CCDS:CCDS18802.1 GeneID:230837 MGI:2684986
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 product : development and differentiation enhancing factor-like 1 protein_id : NP_001008233.1

name	LOC676072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676072
definition	number : 3 pseudo : _no_value

name	LOC676072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676072
definition	number : 2 pseudo : _no_value

name	LOC676072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676072
definition	number : 1 pseudo : _no_value

name	LOC665287 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665287
definition	number : 2 pseudo : _no_value

name	LOC665287 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665287
definition	number : 1 pseudo : _no_value

name	1700029M20Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:73937
definition	number : 1

name	1700029M20Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:73937
definition	number : 2

name	1700029M20Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:73937
definition	number : 3

name	LOC669445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669445
definition	number : 1 pseudo : _no_value

name	LOC665334 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253173 GeneID:665334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : similar to RNA polymerase II elongation factor pseudo : _no_value transcript_id : XR_001716.2

clone name	MSMg01-327N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498P16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-496L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-251B21.b	B6Ng01-251B21.g
ACC	GA058473	GA058474
length	941	804
definition	B6Ng01-251B21.b	B6Ng01-251B21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(134,798,429 - 134,799,355)	(134,624,606 - 134,625,409)
sequence	gaattcagtggtaagtaggtaggtgattgttgtcttcaggtcccagcttc ttactgtcttccctggtcattatcatcactatcacccgtcacccttagtc ctgggaaacagagataaagttattaaagccctcatttaattatttttaaa tcggactagtctaaagactgattaatctaggttttctaagtgagcagttc cttaaccttgacttagtaaaacattaaaatattcatggtgtctgccactg accctattctgcaacgtgggagctaatccagcggtttctcattaaatgcc agcatcgagcaattgcagaattacaacaggctcggaggaggaggaggggc tagtgagtgagagccacttcaggtggcttggtagacagaaaatacccttc agaatgaaactgagtgctaagacctgccctacctctgaatatggctatta ttttcccttggccaatcctgaactggtgatcttcctgccacagtctactg agtgttaggaaaacaggcatatcctatcaaaaacccgctgatacattccg ttttggggggttttgttgtttgttgttgttttgagacaggatcttagtat acatagtcttgggacttattgtgtagaccaggctgaccttgaaactcaca gagatcctcttgcctctgtctcctgagtgctgggattaaaggtgtgcacc actacgactggctttctttctgttttcagtttgaagcctgcgtttttctc ctttgttcagatcggatgggttttactcttttagtttatgggtttttccc tctctgctttccagttgacttttgaggctgtattggtcagctttcttgtt tactataataaaatacctcaggttagctaaacttctgaaaaagtttcggg tttggatttatggcggtggaggcgccatagcttttgggtat	gaattctctcccacactgggaggcccagggccaggtagcaaactccaagc ctacaagatgtgagttcgggtccagttccactaagaagtgcttcttagtg taccactgagaacattccagagtgtctctgtgcatgttgtttttgctggg tcctgtgaccatcctggatgctaagacctgtcccctggccatagagaaag gcccagaggggccgggaaggggctcggttggaggcttatatatgcatgag gacctgagtttaccccatataaagctgggtgtggttgtacacacttgtaa tcccagctctggggccaggtgtgtgcatatggtgggatcgccaaggagaa agagcctgcagaccctcgagctcactgaccagacagcctcagcctggccc atctgtcaagcccaagggcaaggagattctgactgaaaacaaaaacaaaa gcaaaatcagaggctcctgaggcagaacacctgaggccggcctctggcct tcacacaggcacgtgccctcgtctgcacatgctcacacgtgtgtgtaaat acaggcacagatacacaagaagaaaaggacagtgggggctggagagatgg ctaagtgatgaagagccttgactgctcttccagaggtcctgagttcaaat cccaacaaccacatggccgctcacaactgtcttataactccaagatgtga caccctcatatagacatgcatgcaagcaaaacaccaaagcacataaaata tgaataaataagttattaggaaggaaggaaggaaggaaggaaggaaggaa ggga
quality values	Open. Hide. 58 33 21 34 58 28 22 54 58 58 49 58 58 58 58 58 54 58 49 62 62 62 54 62 62 38 37 62 62 62 46 39 36 32 41 50 37 28 21 37 30 30 49 47 47 62 62 49 49 49 49 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 49 62 59 59 62 59 59 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 54 59 62 62 59 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 56 62 62 62 62 51 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 52 62 53 53 43 62 42 62 52 62 62 43 52 42 62 43 62 62 43 62 42 47 41 58 58 58 58 58 58 45 41 58 58 54 54 58 58 46 58 54 54 46 58 37 42 54 34 42 52 58 54 58 39 54 54 52 31 17 47 19 54 54 50 45 45 58 46 42 26 37 52 42 45 54 54 58 40 54 52 54 52 47 51 58 51 41 52 52 46 38 51 51 40 46 51 47 50 50 47 47 45 27 50 48 24 30 26 39 26 43 37 42 40 42 38 43 33 50 51 40 53 50 54 24 50 51 58 35 58 58 35 26 51 25 50 50 36 39 40 50 50 50 50 34 27 37 52 36 33 44 50 26 35 41 40 51 46 50 39 52 51 51 39 39 20 30 50 50 49 32 41 41 39 37 27 13 50 35 37 50 30 47 18 34 38 38 28 47 49 10 24 35 42 31 34 40 28 44 25 19 44 35 16 28 40 40 35 38 29 40 41 40 42 44 44 45 52 39 42 40 40 52 28 18 34 26 17 29 24 9 9 16 33 46 19 15 38 33 33 28 28 40 41 27 22 29 22 24 32 29 40 25 30 11 6 15 30 5 33 19 14 9 6 21 6 9 10 9 6 11 13 21 25 11 19 25 26 30 21 8 9 23 8 7 12 19 11 9 6 9 31 26 15 29 9 45 9 28 19 45 31 30 15 25 37 37 37 17 12 25 33 9 12 16 19 23 31 31 30 18 33 9 34 32 19 26 27 24 10 4 20 10 19 16 6 9 7 30 24 16 16 13 18 7 27 11 15 12 18 15 9 9 10 7 9 6 9	Open. Hide. 62 47 51 42 62 62 62 62 62 62 62 44 42 59 41 59 37 28 38 38 44 59 62 62 62 62 59 62 62 49 46 59 59 62 62 59 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 59 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 49 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 49 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 28 43 47 47 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 45 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 49 58 58 43 58 54 58 58 58 58 58 52 54 54 58 58 45 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 54 58 54 58 58 52 54 54 52 58 41 58 58 58 58 54 58 58 58 58 49 58 42 39 54 58 58 58 58 58 41 41 47 50 58 58 51 36 58 39 45 38 58 58 50 54 53 58 46 54 58 51 41 58 58 58 46 58 46 43 54 58 49 49 39 48 51 58 54 51 53 58 58 53 39 40 40 46 22 58 52 52 58 54 58 51 32 58 53 46 48 58 48 52 51 58 31 28 51 51 39 50 54 41 42 51 50 51 54 54 51 54 50 51 53 52 40 40 28 54 50 53 51 51 51 58 35 49 49 42 53 52 54 49 51 28 51 49 44 31 53 54 41 38 37 40 41 42 50 53 42 45 52 52 52 40 41 51 49 30 53 45 53 45 52 51 53 29 53 39 53 37 54 54 54 49 40 44 51 34 49 46 40 52 41 46 37 51 38 54 54 51 47 40 45 53 52 46 37 23 49 28 47 42 47 29 33 34 32 34 29 27 38 40 47 40 31 51 53 45 31 53 41 34 41 51 33 36 27 46 37 33 30 45 43 51 21 34 27 33 27 40 33 27 13 40 9 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_134798429_134799355
seq2: B6Ng01-251B21.b_48_988 (reverse)

seq1  ATACC--AAAGCTCT-GCGCCT-CAACACCATAAA-CCAAA-CCGAAAC-  43
      |||||  |||||| | |||||| || | ||||||| ||||| ||||||| 
seq2  ATACCCAAAAGCTATGGCGCCTCCACCGCCATAAATCCAAACCCGAAACT  50

seq1  TTTTCAGAAG-TTAGCT-ACCTTGGGTATTTTATTATAGTAA--CAGGAA  89
      |||||||||| |||||| ||||  ||||||||||||||||||   || ||
seq2  TTTTCAGAAGTTTAGCTAACCTGAGGTATTTTATTATAGTAAACAAGAAA  100

seq1  GCTGACCAATACAGCCTCAAAAGTCAACTGGAAAGCAGAGAGGGAAAAAC  139
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGACCAATACAGCCTCAAAAGTCAACTGGAAAGCAGAGAGGGAAAAAC  150

seq1  CCATAAACTAAAAGAGTAAAA-CCATCCGATCTGAACAAAGGAG-AAAAC  187
      ||||||||||||||||||||| |||||||||||||||||||||| |||||
seq2  CCATAAACTAAAAGAGTAAAACCCATCCGATCTGAACAAAGGAGAAAAAC  200

seq1  GCAGGCTTCAAACTGAAAACAGAAAGAAAGCCAGTCGTAGTGGTGCACAC  237
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGCTTCAAACTGAAAACAGAAAGAAAGCCAGTCGTAGTGGTGCACAC  250

seq1  CTTTAATCCCAGCACTCAGGAGACAGAGGCAAGAGGATCTCTGTGAG-TT  286
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  CTTTAATCCCAGCACTCAGGAGACAGAGGCAAGAGGATCTCTGTGAGTTT  300

seq1  CAAGGTCAGCCTGGTCTACACAATAAGTCCCAAGACTATGTATACTAAGA  336
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGTCAGCCTGGTCTACACAATAAGTCCCAAGACTATGTATACTAAGA  350

seq1  TCCTGTCTCAAAACAACAACAAACAACAAAACCCCCCAAAACGGAATGTA  386
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGTCTCAAAACAACAACAAACAACAAAACCCCCCAAAACGGAATGTA  400

seq1  TCAGCGGGTTTTTGATAGGATATGCCTGTTTTCCTAACACTCAGTAGACT  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCGGGTTTTTGATAGGATATGCCTGTTTTCCTAACACTCAGTAGACT  450

seq1  GTGGCAGGAAGATCACCAGTTCAGGATTGGCCAAGGGAAAATAATAGCCA  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCAGGAAGATCACCAGTTCAGGATTGGCCAAGGGAAAATAATAGCCA  500

seq1  TATTCAGAGGTAGGGCAGGTCTTAGCACTCAGTTTCATTCTGAAGGGTAT  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCAGAGGTAGGGCAGGTCTTAGCACTCAGTTTCATTCTGAAGGGTAT  550

seq1  TTTCTGTCTACCAAGCCACCTGAAGTGGCTCTCACTCACTAGCCCCTCCT  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGTCTACCAAGCCACCTGAAGTGGCTCTCACTCACTAGCCCCTCCT  600

seq1  CCTCCTCCGAGCCTGTTGTAATTCTGCAATTGCTCGATGCTGGCATTTAA  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCCGAGCCTGTTGTAATTCTGCAATTGCTCGATGCTGGCATTTAA  650

seq1  TGAGAAACCGCTGGATTAGCTCCCACGTTGCAGAATAGGGTCAGTGGCAG  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAAACCGCTGGATTAGCTCCCACGTTGCAGAATAGGGTCAGTGGCAG  700

seq1  ACACCATGAATATTTTAATGTTTTACTAAGTCAAGGTTAAGGAACTGCTC  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCATGAATATTTTAATGTTTTACTAAGTCAAGGTTAAGGAACTGCTC  750

seq1  ACTTAGAAAACCTAGATTAATCAGTCTTTAGACTAGTCCGATTTAAAAAT  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAGAAAACCTAGATTAATCAGTCTTTAGACTAGTCCGATTTAAAAAT  800

seq1  AATTAAATGAGGGCTTTAATAACTTTATCTCTGTTTCCCAGGACTAAGGG  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTAAATGAGGGCTTTAATAACTTTATCTCTGTTTCCCAGGACTAAGGG  850

seq1  TGACGGGTGATAGTGATGATAATGACCAGGGAAGACAGTAAGAAGCTGGG  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACGGGTGATAGTGATGATAATGACCAGGGAAGACAGTAAGAAGCTGGG  900

seq1  ACCTGAAGACAACAATCACCTACCTACTTACCACTGAATTC  927
      |||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGAAGACAACAATCACCTACCTACTTACCACTGAATTC  941

seq1: chr4_134624606_134625409
seq2: B6Ng01-251B21.g_69_872

seq1  GAATTCTCTCCCACACTGGGAGGCCCAGGGCCAGGTAGCAAACTCCAAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTCCCACACTGGGAGGCCCAGGGCCAGGTAGCAAACTCCAAGC  50

seq1  CTACAAGATGTGAGTTCGGGTCCAGTTCCACTAAGAAGTGCTTCTTAGTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACAAGATGTGAGTTCGGGTCCAGTTCCACTAAGAAGTGCTTCTTAGTG  100

seq1  TACCACTGAGAACATTCCAGAGTGTCTCTGTGCATGTTGTTTTTGCTGGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCACTGAGAACATTCCAGAGTGTCTCTGTGCATGTTGTTTTTGCTGGG  150

seq1  TCCTGTGACCATCCTGGATGCTAAGACCTGTCCCCTGGCCATAGAGAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGTGACCATCCTGGATGCTAAGACCTGTCCCCTGGCCATAGAGAAAG  200

seq1  GCCCAGAGGGGCCGGGAAGGGGCTCGGTTGGAGGCTTATATATGCATGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGAGGGGCCGGGAAGGGGCTCGGTTGGAGGCTTATATATGCATGAG  250

seq1  GACCTGAGTTTACCCCATATAAAGCTGGGTGTGGTTGTACACACTTGTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTGAGTTTACCCCATATAAAGCTGGGTGTGGTTGTACACACTTGTAA  300

seq1  TCCCAGCTCTGGGGCCAGGTGTGTGCATATGGTGGGATCGCCAAGGAGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGCTCTGGGGCCAGGTGTGTGCATATGGTGGGATCGCCAAGGAGAA  350

seq1  AGAGCCTGCAGACCCTCGAGCTCACTGACCAGACAGCCTCAGCCTGGCCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCTGCAGACCCTCGAGCTCACTGACCAGACAGCCTCAGCCTGGCCC  400

seq1  ATCTGTCAAGCCCAAGGGCAAGGAGATTCTGACTGAAAACAAAAACAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGTCAAGCCCAAGGGCAAGGAGATTCTGACTGAAAACAAAAACAAAA  450

seq1  GCAAAATCAGAGGCTCCTGAGGCAGAACACCTGAGGCCGGCCTCTGGCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAATCAGAGGCTCCTGAGGCAGAACACCTGAGGCCGGCCTCTGGCCT  500

seq1  TCACACAGGCACGTGCCCTCGTCTGCACATGCTCACACGTGTGTGTAAAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACACAGGCACGTGCCCTCGTCTGCACATGCTCACACGTGTGTGTAAAT  550

seq1  ACAGGCACAGATACACAAGAAGAAAAGGACAGTGGGGGCTGGAGAGATGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGCACAGATACACAAGAAGAAAAGGACAGTGGGGGCTGGAGAGATGG  600

seq1  CTAAGTGATGAAGAGCCTTGACTGCTCTTCCAGAGGTCCTGAGTTCAAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGTGATGAAGAGCCTTGACTGCTCTTCCAGAGGTCCTGAGTTCAAAT  650

seq1  CCCAACAACCACATGGCCGCTCACAACTGTCTTATAACTCCAAGATGTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAACAACCACATGGCCGCTCACAACTGTCTTATAACTCCAAGATGTGA  700

seq1  CACCCTCATATAGACATGCATGCAAGCAAAACACCAAAGCACATAAAATA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCTCATATAGACATGCATGCAAGCAAAACACCAAAGCACATAAAATA  750

seq1  TGAATAAATAAGTTATTAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATAAATAAGTTATTAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAA  800

seq1  GGGA  804
      ||||
seq2  GGGA  804

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information