MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-111A08
Chromosome	4 (Build37)
Map Location	89,191,783 - 89,192,184
singlet/doublet	singlet
Overlap gene	none
Upstream gene	OTTMUSG00000007655, Ifna14, Ifna9, Mrpl48-ps, Ifna12, C87499, Ifna13, LOC546834, OTTMUSG00000011275, Ifna2, Ifnab, LOC546835, Klhl9, LOC100040477, Ifnz, LOC100041062, EG545645, LOC668147, OTTMUSG00000011291, OTTMUSG00000011290, OTTMUSG00000011265, Ifnz, OTTMUSG00000011269, OTTMUSG00000011270, OTTMUSG00000011272, OTTMUSG00000011268, OTTMUSG00000011273, OTTMUSG00000011282, OTTMUSG00000011285, OTTMUSG00000011289, Ifna7, Ifna11, Ifna6, Ifna5, Ifna4, Ifna1, Ifne1, LOC100040617, Mtap, LOC625574, Cdkn2a, Cdkn2b, LOC664785
Downstream gene	Dmrta1, Zfp352, LOC619842, LOC435792
Link	Open Mouse BAC browser

Click to get alignment info.

name	OTTMUSG00000007655 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242517 MGI:3649418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404549 MGI:3641425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15972 MGI:107659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl48-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269553 MGI:3050089
definition	note : mitochondrial ribosomal protein L48 pseudogene pseudo : _no_value

name	Ifna12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242519 MGI:2676324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381590 MGI:2140706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230396 MGI:2667155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546834
definition	note : interferon-alpha 3 pseudogene pseudo : _no_value

name	OTTMUSG00000011275 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230398 MGI:3649260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15965 MGI:107666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifnab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15974 MGI:1097683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546835
definition	note : interferon-alpha 2 pseudogene pseudo : _no_value

name	Klhl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242521 MGI:2180122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040477 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ifnz (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100041062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG545645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545645 MGI:3704097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	LOC668147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins

name	OTTMUSG00000011291 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545646 MGI:3701990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	OTTMUSG00000011290 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545647 MGI:3701987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	OTTMUSG00000011265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545648 MGI:3701968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	Ifnz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319146 MGI:2448469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000011269 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545649 MGI:3701972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins

name	OTTMUSG00000011270 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545650 MGI:3701974
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins

name	OTTMUSG00000011272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545651 MGI:3701976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	OTTMUSG00000011268 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545652 MGI:3701970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	OTTMUSG00000011273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545653 MGI:3701978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	OTTMUSG00000011282 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545654 MGI:3701981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins

name	OTTMUSG00000011285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545655 MGI:3701983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	OTTMUSG00000011289 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668208 MGI:3701985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	Ifna7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15970 MGI:107661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15964 MGI:109210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15969 MGI:107662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15968 MGI:107663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15967 MGI:107664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15962 MGI:107668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifne1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230405 MGI:2667156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040617 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Mtap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66902 MGI:1914152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625574 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 8 Proteins

name	Cdkn2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12578 MGI:104738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cdkn2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12579 MGI:104737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664785 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dmrta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242523 MGI:2653627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236537 MGI:2387418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins pseudo : _no_value

name	LOC435792 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	OTTMUSG00000007655 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047407 GeneID:242517 MGI:3649418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000007655 transcript_id : NM_206870.1

name	Ifna14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195447 GeneID:404549 MGI:3641425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon, alpha 14 transcript_id : NM_206975.1

name	Ifna9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754297 GeneID:15972 MGI:107659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 9 transcript_id : NM_010507.1

name	Ifna12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340762 GeneID:242519 MGI:2676324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 12 transcript_id : NM_177361.2

name	C87499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350864 GeneID:381590 MGI:2140706
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C87499 transcript_id : NM_198663.2

name	Ifna13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340904 GeneID:230396 MGI:2667155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 13 transcript_id : NM_177347.2

name	OTTMUSG00000011275 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047410 GeneID:230398 MGI:3649260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000011275 transcript_id : NM_206867.1

name	Ifna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722648 GeneID:15965 MGI:107666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 2 transcript_id : NM_010503.2

name	Ifnab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865992 GeneID:15974 MGI:1097683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha B transcript_id : NM_008336.2

name	Klhl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244067 GeneID:242521 MGI:2180122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 9 (Drosophila) transcript_id : NM_172871.2

name	LOC100040477 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252602 GeneID:100040477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040477 transcript_id : XM_001474761.1

name	Ifnz (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51709340 GeneID:435791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : interferon zeta transcript_id : XM_487805.1

name	EG545645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371950 GeneID:545645 MGI:3704097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, EG545645 transcript_id : XM_620066.3

name	LOC668147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371951 GeneID:668147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins product : similar to novel member of the interferon zeta family Ifnz transcript_id : XM_994561.1

name	OTTMUSG00000011291 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371953 GeneID:545646 MGI:3701990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011291 transcript_id : XM_620067.3

name	OTTMUSG00000011290 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371954 GeneID:545647 MGI:3701987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011290 transcript_id : XM_620068.3

name	OTTMUSG00000011265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371955 GeneID:545648 MGI:3701968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011265 transcript_id : XM_620069.3

name	Ifnz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802456 GeneID:319146 MGI:2448469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon zeta transcript_id : NM_197889.2

name	OTTMUSG00000011269 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371956 GeneID:545649 MGI:3701972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011269 transcript_id : XM_620070.3

name	OTTMUSG00000011270 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371957 GeneID:545650 MGI:3701974
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011270 transcript_id : XM_620071.3

name	OTTMUSG00000011272 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371958 GeneID:545651 MGI:3701976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011272 transcript_id : XM_620072.3

name	OTTMUSG00000011268 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371959 GeneID:545652 MGI:3701970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011268 transcript_id : XM_620073.3

name	OTTMUSG00000011273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371960 GeneID:545653 MGI:3701978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011273 transcript_id : XM_620074.3

name	OTTMUSG00000011282 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371961 GeneID:545654 MGI:3701981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011282 transcript_id : XM_620075.3

name	OTTMUSG00000011285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371962 GeneID:545655 MGI:3701983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011285 transcript_id : XM_620076.3

name	OTTMUSG00000011289 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371963 GeneID:668208 MGI:3701985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011289 transcript_id : XM_001000025.1

name	Ifna7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45598383 GeneID:15970 MGI:107661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 7 transcript_id : NM_008334.2

name	Ifna11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680364 GeneID:15964 MGI:109210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 11 transcript_id : NM_008333.1

name	Ifna6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047422 GeneID:15969 MGI:107662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 6 transcript_id : NM_206871.1

name	Ifna5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754295 GeneID:15968 MGI:107663
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 5 transcript_id : NM_010505.1

name	Ifna4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754293 GeneID:15967 MGI:107664
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 4 transcript_id : NM_010504.1

name	Ifna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168292 GeneID:15962 MGI:107668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 1 transcript_id : NM_010502.2

name	Ifne1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340824 GeneID:230405 MGI:2667156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon epsilon 1 transcript_id : NM_177348.2

name	LOC100040617 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252606 GeneID:100040617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040617 transcript_id : XM_001474986.1

name	Mtap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45544617 GeneID:66902 MGI:1914152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methylthioadenosine phosphorylase transcript_id : NM_024433.1

name	LOC625574 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371965 GeneID:625574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 8 Proteins product : similar to TGFB-induced factor 2 transcript_id : XM_890156.2

name	Cdkn2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:98986443 GeneID:12578 MGI:104738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 2A transcript_id : NM_009877.2

name	Cdkn2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:98986446 GeneID:12578 MGI:104738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 2A transcript_id : NM_001040654.1

name	Cdkn2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131209 GeneID:12579 MGI:104737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) transcript_id : NM_007670.3

name	Dmrta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130309 GeneID:242523 MGI:2653627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : doublesex and mab-3 related transcription factor like family A1 transcript_id : NM_175647.3

name	Zfp352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363529 GeneID:236537 MGI:2387418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 352 transcript_id : NM_153102.2

name	OTTMUSG00000007655 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047408 CCDS:CCDS18319.1 GeneID:242517 MGI:3649418
definition	codon_start : 1 note : alpha-interferon; novel interferon alpha (Ifna) family member product : alpha-interferon precursor protein_id : NP_996753.1

name	Ifna14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195448 CCDS:CCDS18320.1 GeneID:404549 MGI:3641425
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha 14 (Ifna14) product : interferon, alpha 14 protein_id : NP_996858.1

name	Ifna9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754298 CCDS:CCDS18321.1 GeneID:15972 MGI:107659
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family gene 9 product : interferon alpha family, gene 9 protein_id : NP_034637.1

name	Ifna12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893507 CCDS:CCDS18322.1 GeneID:242519 MGI:2676324
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family gene 12 product : interferon alpha family, gene 12 protein_id : NP_796335.1

name	C87499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348560 GeneID:381590 MGI:2140706
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381590 protein_id : NP_941065.1

name	Ifna13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893479 CCDS:CCDS18324.1 GeneID:230396 MGI:2667155
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha-13 product : interferon alpha family, gene 13 protein_id : NP_796321.1

name	OTTMUSG00000011275 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047411 CCDS:CCDS18325.1 GeneID:230398 MGI:3649260
definition	codon_start : 1 note : novel member of the interferon alpha family Ifna product : interferon alpha 6T protein_id : NP_996750.1

name	Ifna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722649 CCDS:CCDS18326.1 GeneID:15965 MGI:107666
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : novel member of the interferon alpha family Ifna product : interferon alpha family, gene 2 protein_id : NP_034633.2

name	Ifnab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865993 CCDS:CCDS18327.1 GeneID:15974 MGI:1097683
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : novel member of the interferon alpha family Ifna product : interferon alpha family, gene B protein_id : NP_032362.2

name	Klhl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244068 GeneID:242521 MGI:2180122
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 9 protein_id : NP_766459.2

name	LOC100040477 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252603 GeneID:100040477
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474811.1

name	Ifnz (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51709341 GeneID:435791
definition	codon_start : 1 product : similar to interferon zeta protein_id : XP_487805.1

name	EG545645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514576 GeneID:545645 MGI:3704097
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620066.1

name	LOC668147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371952 GeneID:668147
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_999655.1

name	OTTMUSG00000011291 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252612 GeneID:545646 MGI:3701990
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620067.2

name	OTTMUSG00000011290 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252613 GeneID:545647 MGI:3701987
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620068.2

name	OTTMUSG00000011265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514587 GeneID:545648 MGI:3701968
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620069.1

name	Ifnz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37497122 CCDS:CCDS18333.1 GeneID:319146 MGI:2448469
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA]; GO:0005132 - interferon-alpha/beta receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0030183 - B cell differentiation [Evidence IDA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : limitin; novel member of the interferon zeta family Ifnz product : interferon zeta protein_id : NP_922871.1

name	OTTMUSG00000011269 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514591 GeneID:545649 MGI:3701972
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620070.1

name	OTTMUSG00000011270 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514595 GeneID:545650 MGI:3701974
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620071.1

name	OTTMUSG00000011272 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514599 GeneID:545651 MGI:3701976
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620072.1

name	OTTMUSG00000011268 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514603 GeneID:545652 MGI:3701970
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620073.1

name	OTTMUSG00000011273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514606 GeneID:545653 MGI:3701978
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620074.1

name	OTTMUSG00000011282 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514610 GeneID:545654 MGI:3701981
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620075.1

name	OTTMUSG00000011285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252614 GeneID:545655 MGI:3701983
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620076.2

name	OTTMUSG00000011289 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252615 GeneID:668208 MGI:3701985
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000025.2

name	Ifna7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45598384 CCDS:CCDS18342.1 GeneID:15970 MGI:107661
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family, gene 7 product : interferon alpha 7 protein_id : NP_032360.2

name	Ifna11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680365 GeneID:15964 MGI:109210
definition	GO_process : GO:0009615 - response to virus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : IFNa11 (B6); type I interferon; has confirmed antiviral activity product : interferon alpha family, gene 11 protein_id : NP_032359.1

name	Ifna6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047423 GeneID:15969 MGI:107662
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family, gene 8; interferon alpha 8/6 product : interferon alpha family, gene 6 protein_id : NP_996754.1

name	Ifna5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754296 CCDS:CCDS18345.1 GeneID:15968 MGI:107663
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : interferon alpha family, gene 5 protein_id : NP_034635.1

name	Ifna4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754294 CCDS:CCDS18346.1 GeneID:15967 MGI:107664
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : MuIFN-alpha 4; interferon alpha family, gene 4 product : interferon, alpha 4 protein_id : NP_034634.1

name	Ifna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168293 CCDS:CCDS18347.1 GeneID:15962 MGI:107668
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family gene 1 product : interferon alpha 1 precursor protein_id : NP_034632.2

name	Ifne1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893489 CCDS:CCDS18348.1 GeneID:230405 MGI:2667156
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon tau-1 product : interferon epsilon 1 protein_id : NP_796322.1

name	LOC100040617 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252607 GeneID:100040617
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475036.1

name	Mtap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45544618 CCDS:CCDS18349.1 GeneID:66902 MGI:1914152
definition	GO_function : GO:0016763 - transferase activity, transferring pentosyl groups [Evidence IEA] codon_start : 1 product : methylthioadenosine phosphorylase protein_id : NP_077753.1

name	LOC625574 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82893728 GeneID:625574
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895249.1

name	Cdkn2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:98986447 GeneID:12578 MGI:104738
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007568 - aging [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007569 - cell aging [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0008544 - epidermis development [Evidence IMP]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000079 - regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; cyclin-dependent kinase inhibitor 2A (p16, inhibits CDK4); cyclin-dependent kinase inhibitor protein product : cyclin-dependent kinase inhibitor 2A isoform 2 protein_id : NP_001035744.1

name	Cdkn2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753390 CCDS:CCDS18350.1 GeneID:12578 MGI:104738
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007568 - aging [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007569 - cell aging [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0008544 - epidermis development [Evidence IMP]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000079 - regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cyclin-dependent kinase inhibitor 2A (p16, inhibits CDK4); cyclin-dependent kinase inhibitor protein product : cyclin-dependent kinase inhibitor 2A isoform 1 protein_id : NP_034007.1

name	Cdkn2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671728 CCDS:CCDS18351.1 GeneID:12579 MGI:104737
definition	GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : cyclin-dependent kinase inhibitor p15INK4b; cyclin-dependent kinase inhibitor protein product : cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) protein_id : NP_031696.1

name	Dmrta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316744 CCDS:CCDS18352.1 GeneID:242523 MGI:2653627
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007548 - sex differentiation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : doublesex and mab-3 related transcription factor 4 product : doublesex and mab-3 related transcription factor like family A1 protein_id : NP_783578.1

name	Zfp352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821036 CCDS:CCDS18353.1 GeneID:236537 MGI:2387418
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 352 protein_id : NP_694742.1

name	LOC100041062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041062
definition	number : 1 pseudo : _no_value

name	LOC664785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664785
definition	number : 5 pseudo : _no_value

name	LOC664785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664785
definition	number : 4 pseudo : _no_value

name	LOC664785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664785
definition	number : 3 pseudo : _no_value

name	LOC664785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664785
definition	number : 2 pseudo : _no_value

name	LOC664785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664785
definition	number : 1 pseudo : _no_value

name	LOC435792 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435792
definition	number : 1 pseudo : _no_value

name	LOC619842 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252789 GeneID:619842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : similar to zinc finger protein 352 pseudo : _no_value transcript_id : XR_033808.1

clone name	MSMg01-322G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-535G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-329L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-361M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371G15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-263J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366K09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173J22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-111A08.T7 (MSMg01no111_a08.b1)	MSMg01-111A08.TJ (MSMg01no111_a08.g1)
ACC	AG323796	AG323797
length	1,082	1,162
length of high quality (start - end)	245 (384 - 628)	726 (80 - 805)
definition	CHROMAT_FILE: MSMg01no111_a08.b1 PHD_FILE: MSMg01no111_a08.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:14:48 2005	CHROMAT_FILE: MSMg01no111_a08.g1 PHD_FILE: MSMg01no111_a08.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:14:49 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GGCCTTAAGGACCCACNGNGNAAANGNACCTCATTTTCGGATCTTGAAAA CTGCTGGAGGACATCTGGGNTCTTTCCAGCTCCTAGCTATTATAAATAAT GCTGGGTAAGCAAGTCTTAATCTCTATTTGTAATTTCATTGGATTTAACC TTTTTCCTCCTAGTCTTCTTCTTCCATTCCAGTCGATTTGCTTTCTCATA AAGATATTCAGAATTCCTATCCAACACTCAGATTTGTGATGCCACACATC CTGGTTGTTCCTTCACATTGACACTTTGCTCATTGTTCTGAACACAGAGA TCATTAAGCCAATTTTCTAGGGGTGTTTTTTTTTGCAANTCNGGACACAG CACAAAATTCTCTTCATTATCTGCCTTAACTACTTCTCTGACACAATCTC CTCACACTTCTGGTCACCACTACGGTGGTTTGAATGAGATGTCTCTGTAA TCTCAAGCACCTGGAAACTTCTCAGTTGGTTGCATTGTTTAGGCAGTCTT GAGGAAGCTTAGGAGGTGGCCCTCCTAGTGGGACTATGTCACTGGGAAAA GGCTTTGTGAAGACTCTATCTATGCTCCTGTGTATGGGAATGCCAGGGCC AGGAAGCAGGAGTGGGTTGGTGGGTGTGCAGGGGAAGTGGGGAGGATATA GGTATTTTCTTTTTCCTCTTTATATAATAACACAACGACTTTTTTTTTTT TTTTTTTTACGACACACTAGCACCCTTTATTTTTTTTTATCTTTTCTATT CATCTTTTCTCTTCTCACTTCCTTTATTTTTTTATTTATTTCTTTAAACT TAATAACTCATTTATATATTTTTTTTTTTTCTTATTATTTTTATTCTTAT TATCTTTCTTTTTTCTCTTCTTTTTTTATACCTTTTTTTTTTTCTATTTT ATCTTTTTTTCTCTTTTCCTTTTTCTTCTTTTTCTTTCTTTACATTTTTT TTTATTTATTATTTTTTTTTCTATTTTACTTTTTTCTTTATTACATTCTT CTTCTTCTCTTTTCTCTTATATCTTTTTTATTCTTATCTAATTTTATTTT ATTTATTTTTTTATTCTTATTTTTTTTACTAT	TTTTTTTTAGCATTGGAGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXCACTTTTCTCGGCTTAATTCCTTGTAAGGAA CACACTGTGCCACACAAGGAAAGCTGCAGAGTGGCCACAACTGGGTCAAC TAAACTGATAAGCTGAGAGTCATTTTGAGAGAGACTCAGACATAAGAAGA ACTCTATGGTAATAGAAAGAGTCTTTTTTTCCTGCTTTATAATGATTTAC TAGGCTGTACATTGCTCTTATTGTTTTCTGGGACTACAAGGTGTTAGTAA TAAATGTCTCTAAGATAAATGTATAAACAATAGTTGTCCATTGCTGAAAA TTCAGCTAATGGAGAACACAAGTTATCATTTTTGAGAGGTTTTCATATTT TCCATCTTCCAGTAAAAATTGATTTTCAAAAATAGGCTAAGCCCAAGATT TAGCCATAGGCTGTAGTTTTCTAACCTCTGGTTTGAGTTGGTAACTCTTT ATGCTGGCTCTTTCAAATAAGAGAAAATTTAGTGTAATGCAATTCGTGTA AAAATAAATAAAATTTAAGGTTAATTCATTTAATTTAAAATTCACTTTAT GTAATCTAGAATGTAATTTTCTTAAACAATACTTTTATTTATTTATTTTT TAAATCAATTTATTCTTTCATATCCTAACCACAGTATTTTCCTGTGGGGA GCGGGTGTGGCGGCAGTCCCAAAGGCGCCAGAGACTGCAGCTAAGTCATA TGACTTGCACCTGACTTCCTCATATAAGACACAAACATCTTGAGTGCTGC GCAGGTGTACCAGGATACAGGTGAATCCATTTTGGTGGAGATTTGCCCCT GCTGCCCTGATTAGCTGAAGCTGCCTGCCTGGTGAGGTGCCGTGCCCTGC TGTGCGTGAATGGGAACTGAAAGTATAAAAGAGTGAGAGGCCCGGGTTAG AGGGAAGGATTATTATTCGAGAGAGGAATTATTTTTCCAGAAGAGGATTT GTTTTTATTGGGGAGATATTAAACGAGAGGAAAAATTTTAAACGGGGGGA AAATTTAAATCTGGGGGAGAATTTTTTTCTGCAAAAGCAGAAAATTTGGG CCCTGGAATAAAACCGGGGGTGCCAAAGGAATTCCTGGCTTGGTGGGGGT CCTCTTTCTTGC
quality values	Open. Hide. 6 6 6 6 6 6 6 8 8 8 8 8 8 9 11 3 0 3 0 3 0 3 23 3 0 3 0 3 21 21 33 33 33 33 37 24 19 7 7 6 6 6 6 6 6 6 6 7 7 8 8 10 9 11 13 11 16 27 34 41 44 39 37 37 37 59 27 27 3 0 3 27 27 59 37 37 37 37 41 41 48 53 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 68 68 68 68 68 68 68 68 68 48 35 34 21 14 14 14 17 32 32 54 54 68 57 57 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 59 59 57 57 57 57 57 57 59 59 59 59 57 27 19 8 8 8 8 8 18 21 35 48 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 57 57 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 68 57 57 57 57 57 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 27 27 11 11 12 14 23 29 37 37 28 20 12 11 9 20 3 0 3 3 0 3 27 29 59 59 59 59 59 59 59 59 59 39 37 43 43 57 57 59 59 57 47 47 43 43 43 43 43 43 43 29 30 18 15 15 12 15 12 12 12 12 15 28 30 37 28 13 12 8 8 10 14 29 47 59 59 59 54 48 47 59 57 57 48 57 57 57 57 57 57 57 57 57 44 44 44 37 43 43 44 34 44 37 44 57 57 57 68 59 59 68 59 59 47 43 35 35 47 43 52 52 57 59 50 57 57 57 68 68 68 68 59 59 57 54 54 54 59 59 57 59 59 57 57 57 68 68 57 59 59 57 57 57 57 44 43 35 35 43 44 57 59 59 57 57 57 57 57 57 57 57 59 57 52 52 59 59 68 68 68 68 68 44 44 23 23 19 38 38 43 52 59 59 59 54 54 54 57 52 57 52 50 44 43 43 43 35 35 35 43 43 57 57 57 44 42 33 33 35 44 34 57 48 44 44 44 42 43 43 43 43 59 57 57 54 57 44 44 30 30 30 44 39 48 48 59 59 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 54 54 54 54 48 57 48 48 48 57 47 39 35 35 39 36 36 39 39 39 37 31 22 22 22 29 24 21 21 24 23 34 29 31 34 37 24 24 12 19 12 14 15 28 22 18 13 12 12 18 18 13 11 11 11 11 12 14 13 15 10 10 10 8 8 8 8 8 8 10 10 10 10 10 10 8 10 8 8 8 8 11 9 8 8 8 8 8 9 9 9 11 10 10 10 15 9 9 9 8 8 6 6 8 8 15 17 24 22 22 17 20 21 22 9 9 10 13 21 15 10 8 6 6 6 6 8 8 11 12 11 10 10 13 10 9 9 10 11 13 13 10 11 11 13 15 13 13 13 8 10 8 8 8 8 8 8 10 12 14 9 10 10 10 8 8 8 8 8 10 11 11 9 9 10 12 13 18 12 10 10 8 8 8 9 9 9 8 8 8 8 8 8 11 8 9 9 9 7 11 8 8 8 13 10 14 13 13 10 10 8 8 8 8 8 8 9 8 8 8 8 8 6 6 8 8 10 8 8 8 8 11 10 10 8 10 10 9 10 9 9 13 10 10 10 13 18 11 11 11 14 11 12 8 8 8 10 10 11 10 10 6 6 8 6 6 8 15 8 8 6 6 8 8 8 8 8 6 6 6 6 10 6 6 6 10 10 13 14 12 9 11 11 11 11 11 15 16 16 11 11 15 11 12 9 10 12 12 7 7 8 8 15 10 12 12 13 13 10 10 14 10 10 9 9 10 11 9 11 8 8 10 10 8 8 8 10 10 10 15 10 9 9 11 8 8 6 6 13 8 8 8 10 13 11 6 6 8 8 11 11 12 18 14 15 13 9 9 8 10 10 10 10 10 10 11 10 9 8 8 8 11 10 15 8 8 6 9 8 8 8 8 8 8 12 10 8 8 8 8 10 10 14 15 15 11 11 12 12 12 11 11 8 11 7 9 10 10 13 11 11 10 12 15 10 10 8 8 8 8 8 8 8 8 10 8 10 11 17 10 7 6 6 6 8 8 10 12 12 10 8 8 8 6 6 6 11 10 10 12 12 9 9 10 10 11 10 10 10 11 12 13 16 10 12 10 8 8 6 6 8 8 6 7 8 8 12 11 11 12 12 11 11 11 11 11	Open. Hide. 9 9 10 15 9 9 9 6 6 6 6 6 6 6 6 9 10 10 8 6 6 6 15 8 8 8 15 15 8 10 8 14 15 19 23 22 23 17 19 20 30 29 35 30 30 35 36 36 36 47 47 43 43 42 42 42 53 53 53 47 44 44 39 37 47 43 23 16 13 6 6 8 8 8 16 12 12 12 19 18 29 26 29 30 35 36 36 38 42 42 38 42 42 42 35 35 42 57 57 53 53 59 44 33 28 28 25 23 21 19 11 11 11 12 12 22 26 33 39 41 48 48 36 36 36 36 34 48 37 33 28 28 28 33 40 57 59 59 57 48 57 57 57 57 68 68 53 53 43 43 47 50 50 47 54 57 54 54 57 68 50 50 50 50 50 50 57 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 57 57 54 44 43 44 44 57 57 57 57 57 57 57 59 59 57 57 54 54 57 57 57 57 57 57 57 57 57 59 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 59 57 68 68 68 57 57 57 57 57 57 57 57 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 57 57 57 59 59 59 59 59 59 57 57 57 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 45 45 62 62 62 62 62 62 62 68 68 68 68 68 62 62 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 45 45 52 62 62 62 62 62 59 43 39 39 43 43 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 68 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 68 68 68 68 59 59 57 57 57 59 59 59 59 57 57 59 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 59 59 59 59 59 59 59 59 59 59 68 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 59 59 57 42 41 41 41 41 41 47 47 57 57 57 43 47 35 42 42 47 43 44 36 36 28 32 30 39 32 41 30 39 39 47 47 43 43 41 41 30 25 25 25 36 25 37 37 40 41 43 28 28 21 22 13 27 27 42 42 48 47 57 57 57 57 50 50 36 36 33 33 33 33 33 33 33 32 32 26 24 23 20 20 16 16 13 13 23 27 43 39 39 39 43 37 37 32 32 35 39 39 37 22 17 8 8 8 13 17 34 39 25 22 18 15 14 17 23 23 23 13 12 12 20 12 13 19 26 26 37 37 33 33 23 23 12 12 10 10 8 10 11 8 10 8 10 10 15 15 9 10 10 14 22 23 21 18 19 21 22 29 28 22 22 22 22 24 25 29 28 28 20 25 15 15 15 12 12 12 12 12 11 18 12 10 9 12 13 13 23 15 11 9 9 10 14 13 10 8 8 8 8 10 8 10 8 8 12 13 19 9 8 8 8 8 8 8 8 8 8 8 13 11 10 8 8 8 8 8 15 11 11 10 11 11 8 8 8 12 10 9 9 9 10 10 13 10 10 10 8 8 8 9 13 11 10 10 10 14 11 11 11 16 10 10 9 9 9 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 12 15 12 8 19 8 8 8 8 8 8 15 8 8 8 6 6 6 6 8 8 10 13 11 8 9 9 9 9 12 10 10 10 12 11 14 11 12 12 11 11 8 9 9 9 9 9 9 8 8 6 6 6 6 6 7 11 11 8 10 6 6 8 8 6 6 8 10 9 8 8 11 17 15 15 12 8 8 10 9 9 9 10 8 8 6 7 8 7 15 16 13 12 11 10 8 8 10 13 13 22 13 13 10 10 10 9 9 9 9 13 8 8 6 6 6 6 7 15 10 10 8 8 8 9 10 13 10 12 10 10 10 8 8 7 9 10 8 10 9 9 9 8 10 11 8 8 8 8 8 8 13 8 8 8 8 10 12 12 9 9 10 8 8 8 10 9 11 9 9 9 14 12 18 18 10 9 9 9 13 13 8 8 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no111_a08.g1 MSMg01no111_a08.g1 CHROMAT_FILE:
MSMg01no111_a08.g1 PHD_FILE: MSMg01no111_a08.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:14:49 2005
         (726 letters)



>mm_chr4_89191592_89192717
          Length = 1126

 Score =  644 bits (333), Expect = 0.0
 Identities = 381/405 (94%), Gaps = 15/405 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   ggcttaattccttgtaaggaacacactgtgccacacaaggaaa---------gctgcaga 51
           |||||||||||||||||||||||||||||||||||||||||||         ||||||||
Sbjct: 192 ggcttaattccttgtaaggaacacactgtgccacacaaggaaagctctaagggctgcaga 251

                                                                       
Query: 52  gtggccacaactgggtcaactaaactgataagctgagagtcattttgagagagactcaga 111
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 gtggccacaactgggtcaactaaactgataagctgagagtcattttgagagagactcaga 311

                                                                       
Query: 112 cataagaagaactctatggtaatagaaagagtctttttt---tcctgctttataatgatt 168
           |||   |||||||||||||||||||||||||||||||||    |||||||||||||||||
Sbjct: 312 cat---aagaactctatggtaatagaaagagtcttttttcccccctgctttataatgatt 368

                                                                       
Query: 169 tactaggctgtacattgctcttattgttttctgggactacaaggtgttagtaataaatgt 228
            |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 369 gactacgctgtacattgctcttattgttttctgggactacaaggtgttagtaataaatgt 428

                                                                       
Query: 229 ctctaagataaatgtataaacaatagttgtccattgctgaaaattcagctaatggagaac 288
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 429 ctctaaaataaatgtataaacaatagttgtccattgctgaaaattcagctaatggagaat 488

                                                                       
Query: 289 acaagttatcatttttgagaggttttcatattttccatcttccagtaaaaattgattttc 348
           ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||
Sbjct: 489 acaagttatcatttttgagaggttttcatattttccaccttccagtaaaaatcgattttc 548

                                                        
Query: 349 aaaaataggctaagcccaagatttagccataggctgtagttttct 393
           ||||||||||| ||||||||||||| |||||||||||||||||||
Sbjct: 549 aaaaataggctgagcccaagatttaaccataggctgtagttttct 593


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 28
Number of extensions: 6
Number of successful extensions: 6
Number of sequences better than 10.0: 1
Number of HSP's gapped: 3
Number of HSP's successfully gapped: 1
Length of query: 726
Length of database: 1126
Length adjustment: 10
Effective length of query: 716
Effective length of database: 1116
Effective search space:   799056
Effective search space used:   799056
X1: 9 (17.8 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 9 (18.3 bits)
S2: 9 (18.1 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information