MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-063H24
Chromosome	5 (Build37)
Map Location	87,195,611 - 87,196,187
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Cenpc1, LOC100039521, AI586015, Ube1l2, Gnrhr, Tmprss11c, Tmprss11d, Tmprss11a, 9930032O22Rik, Tmprss11f, Tmprss11b, Tmprss11e
Downstream gene	A730098D12Rik, LOC622056, Ugt2b34, Ugt2b1, LOC665424, LOC545767, Ugt2b35, Ugt2b36, LOC665440, Ugt2b5, LOC435848, Ugt2b37, LOC665468, Ugt2a3, LOC665476, LOC665483, LOC665494, LOC100039818, Ugt2b38, Ugt2a2, Ugt2a1, Sult1b1, Sult1d1, Sult1e1, Csn1s1, Csn2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cenpc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12617 MGI:99700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039521 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs pseudo : _no_value

name	AI586015 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56792 MGI:1926193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231380 MGI:1913894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnrhr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14715 MGI:95790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss11c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435845 MGI:3521861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss11d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231382 MGI:2385221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194597 MGI:2684853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930032O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320454 MGI:2444058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss11f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243083 MGI:2442348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss11b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319875 MGI:2442893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss11e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243084 MGI:3513175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730098D12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231386 MGI:2443713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622056 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ugt2b34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100727 MGI:2140962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71773 MGI:1919023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC545767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 112 ESTs, 32 Proteins pseudo : _no_value

name	Ugt2b35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243085 MGI:3576100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt2b36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231396 MGI:3576103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ugt2b5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22238 MGI:98900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Ugt2b37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112417 MGI:2148239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	Ugt2a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72094 MGI:1919344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC665483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins pseudo : _no_value

name	LOC665494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins pseudo : _no_value

name	LOC100039818 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ugt2b38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100559 MGI:2140794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:552899 MGI:3576095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94215 MGI:2149905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56362 MGI:2136282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53315 MGI:1926341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20860 MGI:98431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csn1s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12990 MGI:88540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12991 MGI:88541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802028 GeneID:12617 MGI:99700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein C1 transcript_id : NM_007683.2

name	AI586015 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385057 GeneID:56792 MGI:1926193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI586015 transcript_id : NM_019992.3

name	Ube1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254245 GeneID:231380 MGI:1913894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-activating enzyme E1-like 2 transcript_id : NM_172712.2

name	Gnrhr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754031 GeneID:14715 MGI:95790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gonadotropin releasing hormone receptor transcript_id : NM_010323.1

name	Tmprss11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100815530 GeneID:435845 MGI:3521861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 11c transcript_id : NM_001030297.2

name	Tmprss11d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130165 GeneID:231382 MGI:2385221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 11d transcript_id : NM_145561.2

name	Tmprss11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366997 GeneID:194597 MGI:2684853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 11a transcript_id : NM_001033233.2

name	9930032O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803131 GeneID:320454 MGI:2444058
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930032O22 gene transcript_id : NM_177162.3

name	Tmprss11f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053910 GeneID:243083 MGI:2442348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 11f transcript_id : NM_178730.3

name	Tmprss11b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803132 GeneID:319875 MGI:2442893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 11b transcript_id : NM_177024.3

name	Tmprss11e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802965 GeneID:243084 MGI:3513175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 11e transcript_id : NM_172880.2

name	A730098D12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430548 GeneID:231386 MGI:2443713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730098D12 gene transcript_id : NM_177680.3

name	Ugt2b34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130096 GeneID:100727 MGI:2140962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide B34 transcript_id : NM_153598.2

name	Ugt2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22779900 GeneID:71773 MGI:1919023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide B1 transcript_id : NM_152811.1

name	Ugt2b35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347504 GeneID:243085 MGI:3576100
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide B35 transcript_id : NM_172881.2

name	Ugt2b36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274183 GeneID:231396 MGI:3576103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide B36 transcript_id : NM_001029867.1

name	Ugt2b5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678500 GeneID:22238 MGI:98900
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide B5 transcript_id : NM_009467.1

name	Ugt2b37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131147 GeneID:112417 MGI:2148239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide B37 transcript_id : NM_053215.3

name	Ugt2a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803411 GeneID:72094 MGI:1919344
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide A3 transcript_id : NM_028094.2

name	Ugt2b38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527109 GeneID:100559 MGI:2140794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide B38 transcript_id : NM_133894.1

name	Ugt2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66571302 GeneID:552899 MGI:3576095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide A2 transcript_id : NM_001024148.1

name	Ugt2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716476 GeneID:94215 MGI:2149905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide A1 transcript_id : NM_053184.1

name	Sult1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359864 GeneID:56362 MGI:2136282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1B, member 1 transcript_id : NM_019878.3

name	Sult1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734448 GeneID:53315 MGI:1926341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1D, member 1 transcript_id : NM_016771.2

name	Sult1e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963514 GeneID:20860 MGI:98431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1E, member 1 transcript_id : NM_023135.1

name	Csn1s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982443 GeneID:12990 MGI:88540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein alpha s1 transcript_id : NM_007784.2

name	Csn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753537 GeneID:12991 MGI:88541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein beta transcript_id : NM_009972.1

name	Cenpc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671740 GeneID:12617 MGI:99700
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : centromeric protein product : centromere autoantigen C1 protein_id : NP_031709.1

name	AI586015 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910568 CCDS:CCDS19377.1 GeneID:56792 MGI:1926193
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence IDA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030099 - myeloid cell differentiation [Evidence TAS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IDA] codon_start : 1 note : stem cell adaptor protein STAP-1 product : BCR downstream signaling 1 protein_id : NP_064376.1

name	Ube1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370032 CCDS:CCDS19378.1 GeneID:231380 MGI:1913894
definition	codon_start : 1 product : ubiquitin-activating enzyme E1-like 2 protein_id : NP_766300.1

name	Gnrhr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754032 CCDS:CCDS19379.1 GeneID:14715 MGI:95790
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : gonadotropin releasing hormone receptor protein_id : NP_034453.1

name	Tmprss11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71892422 CCDS:CCDS19380.1 GeneID:435845 MGI:3521861
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : neurobin product : transmembrane protease, serine 11c protein_id : NP_001025468.1

name	Tmprss11d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704106 GeneID:231382 MGI:2385221
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : airway spesific trypsin-like protease; airway trypsin-like protease product : transmembrane protease, serine 11d precursor protein_id : NP_663536.1

name	Tmprss11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794609 GeneID:194597 MGI:2684853
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : airway trypsin-like protease 1 product : transmembrane protease, serine 11a protein_id : NP_001028405.1

name	9930032O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893147 GeneID:320454 MGI:2444058
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serine protease Desc4 protein_id : NP_796136.1

name	Tmprss11f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189423 GeneID:243083 MGI:2442348
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : transmembrane protease, serine 11f protein_id : NP_848845.1

name	Tmprss11b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892897 GeneID:319875 MGI:2442893
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transmembrane protease, serine 11b protein_id : NP_795998.1

name	Tmprss11e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370340 GeneID:243084 MGI:3513175
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IDA] codon_start : 1 product : type II transmembrane serine protease protein_id : NP_766468.1

name	A730098D12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430549 GeneID:231386 MGI:2443713
definition	codon_start : 1 product : hypothetical protein LOC231386 protein_id : NP_808348.2

name	Ugt2b34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956406 CCDS:CCDS19381.1 GeneID:100727 MGI:2140962
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide B34 protein_id : NP_705826.1

name	Ugt2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779901 CCDS:CCDS19382.1 GeneID:71773 MGI:1919023
definition	codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide B1 protein_id : NP_690024.1

name	Ugt2b35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370342 GeneID:243085 MGI:3576100
definition	GO_function : GO:0015020 - glucuronosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide B35 protein_id : NP_766469.1

name	Ugt2b36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274184 CCDS:CCDS19384.1 GeneID:231396 MGI:3576103
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide B36 protein_id : NP_001025038.1

name	Ugt2b5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678501 CCDS:CCDS19385.1 GeneID:22238 MGI:98900
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0015020 - glucuronosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : UDP-glucuronosyltransferase 2 family, member 5 product : UDP glucuronosyltransferase 2 family, polypeptide B5 protein_id : NP_033493.1

name	Ugt2b37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753955 CCDS:CCDS19386.1 GeneID:112417 MGI:2148239
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide B37 protein_id : NP_444445.2

name	Ugt2a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386284 CCDS:CCDS19387.1 GeneID:72094 MGI:1919344
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UDP glucuronosyltransferase 2 family, polypeptide A3 protein_id : NP_082370.1

name	Ugt2b38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527110 CCDS:CCDS19388.1 GeneID:100559 MGI:2140794
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide B38 protein_id : NP_598655.1

name	Ugt2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716477 GeneID:94215 MGI:2149905
definition	GO_function : GO:0015020 - glucuronosyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : olfactory UDP glucuronosyltransferase; UDP glycosyltransferase 2 family, polypeptide A1 product : UDP glucuronosyltransferase 2 family, polypeptide A1 protein_id : NP_444414.1

name	Ugt2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66571303 CCDS:CCDS19390.1 GeneID:552899 MGI:3576095
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide A2 protein_id : NP_001019319.1

name	Sult1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845263 CCDS:CCDS19391.1 GeneID:56362 MGI:2136282
definition	GO_component : GO:0005829 - cytosol [Evidence TAS] GO_function : GO:0004062 - aryl sulfotransferase activity [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 product : dopa/tyrosine sulfotransferase protein_id : NP_063931.1

name	Sult1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734449 GeneID:53315 MGI:1926341
definition	GO_function : GO:0004062 - aryl sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0017067 - tyrosine-ester sulfotransferase activity [Evidence IEA] GO_process : GO:0000103 - sulfate assimilation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : amine N-sulfotransferase; tyrosine-ester sulfotransferase product : sulfotransferase family 1D, member 1 protein_id : NP_058051.2

name	Sult1e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963515 CCDS:CCDS19392.1 GeneID:20860 MGI:98431
definition	GO_function : GO:0004304 - estrone sulfotransferase activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008210 - estrogen metabolism [Evidence IMP]; GO:0007565 - pregnancy [Evidence IMP] codon_start : 1 exception : mismatches in translation note : sulfotransferase, estrogen preferring product : sulfotransferase family 1E, member 1 protein_id : NP_075624.1

name	Csn1s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681055 GeneID:12990 MGI:88540
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : casein alpha protein_id : NP_031810.1

name	Csn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753538 GeneID:12991 MGI:88541
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : casein beta protein_id : NP_034102.1

name	LOC622056 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622056
definition	number : 3 pseudo : _no_value

name	LOC622056 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622056
definition	number : 2 pseudo : _no_value

name	LOC622056 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622056
definition	number : 1 pseudo : _no_value

name	LOC665424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665424
definition	number : 1 pseudo : _no_value

name	LOC665424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665424
definition	number : 2 pseudo : _no_value

name	LOC665424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665424
definition	number : 3 pseudo : _no_value

name	LOC665424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665424
definition	number : 4 pseudo : _no_value

name	LOC665424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665424
definition	number : 5 pseudo : _no_value

name	LOC665424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665424
definition	number : 6 pseudo : _no_value

name	LOC665424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665424
definition	number : 7 pseudo : _no_value

name	LOC665440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665440
definition	number : 3 pseudo : _no_value

name	LOC665440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665440
definition	number : 2 pseudo : _no_value

name	LOC665440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665440
definition	number : 1 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 8 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 7 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 6 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 5 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 4 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 3 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 2 pseudo : _no_value

name	LOC435848 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435848
definition	number : 1 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 8 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 7 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 6 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 5 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 4 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 3 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 2 pseudo : _no_value

name	LOC665468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665468
definition	number : 1 pseudo : _no_value

name	LOC665476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665476
definition	number : 5 pseudo : _no_value

name	LOC665476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665476
definition	number : 4 pseudo : _no_value

name	LOC665476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665476
definition	number : 3 pseudo : _no_value

name	LOC665476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665476
definition	number : 2 pseudo : _no_value

name	LOC665476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665476
definition	number : 1 pseudo : _no_value

name	LOC100039818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039818
definition	number : 3 pseudo : _no_value

name	LOC100039818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039818
definition	number : 2 pseudo : _no_value

name	LOC100039818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039818
definition	number : 1 pseudo : _no_value

name	LOC100039521 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253987 GeneID:100039521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to RNA polymerase I associated factor (Paf53) pseudo : _no_value transcript_id : XR_031063.1

name	LOC545767 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253988 GeneID:545767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 112 ESTs, 32 Proteins product : similar to elongation factor 1 alpha pseudo : _no_value transcript_id : XR_031253.1

name	LOC665483 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253989 GeneID:665483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins product : similar to Isopentenyl-diphosphate delta isomerase pseudo : _no_value transcript_id : XR_031277.1

name	LOC665494 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253990 GeneID:665494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins product : similar to UDP glucuronosyltransferase 2 family, polypeptide B36 pseudo : _no_value transcript_id : XR_031289.1

clone name	MSMg01-419E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-454J02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-068E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-411B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524G09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-425O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-274I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-071B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-146N13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434C24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-419F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135N19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-144B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-131N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-479P22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-237I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528G07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-487D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-395F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061M01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-439O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-149A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D21
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-191L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-063H24.b	B6Ng01-063H24.g
ACC	DH883576	DH883577
length	884	1,172
definition	DH883576\|Mus musculus domesticus DNA, BAC clone: B6Ng01-063H24, 5' end.	DH883577\|Mus musculus domesticus DNA, BAC clone: B6Ng01-063H24, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcataaaattcttaggcaactggatagaactagaaaatattatcct aagtgacataacccaataacaaaagaacacacatggtatgcattcactga taagtggatattaggttagaagctcacaatacccaagatacaattcacag accacatgaagctcaagaagaaggaagaccaaagtgtgagtgcttcagtc cttcttggaaggagtaacaaaatactcatgggagaaaatatggagacaaa gtatggagcagagactgaaggaaaggccatgcagagaatgccccacctga ggatccagcccatatacaccattactaaatgcagacactattgtagatgc caagaagtgcaagctgtcaggagcctgatatagctgtcttatgagaggct ctgccagagcctgacagatacagaggcagatgctcacagccaaccattga actgattatggggtccccaatgaggagttaaagaaaggactggaggagct gaaggggtttgcagcctgatcggaagaacaacaataccaaacaaccagag ctcccagggactaaaccaccaaccaaggagtacacatggagggacccatg gctccagctgaagaaaatggccttatcagacattagtggaagcagaggcc catcatgccatgaaggcatgatgccccagagtagggagtgggggaggggg acagaccctcctagaacaggaagaggggtttatcagatagagggtttcgg aaagggaatcaggaaaggggataacatttgaaatggtaataaataaatat caagggaaaagatgttctttcctcggatttaacattatatggatgataat ttaaaaacgtctcgtgatttttatcaaaagtttt	gaattcagaggacatgttctggaatctgttctcttttcatggttttacat atattctaaagatgggactggttgccactgttgcctaaccagtgttttaa cttgttgggccctctggatgaccctaaaatgattcttttaaactcatcta ccatcttatttagtgacagactgcagattgaggactaacacagattggta cacagatatctatgtagtatggagacagtatcgctttagctggttgcttt attcaaaatttgaagtactttctgactttacataatgaggttctttatac ttgtgacatgcaccacctctatcccagacacagaaagattgtgaatgaag gatgatagagagtgcatcaccagtcactgggtgtttaattctcttctgtt ttgaacctcagagagagccaggaaatagctagccagatgaaggcacatgc tgtcaagaacctgaagaccttaaatttattcatactacctaaggtgaaag gacaaaatgccttctttaaaatgtcctctggcattctgtggattgtatcc tgggaattctgcactttctttggctaatctacacttattagtgagtacat accacacatatcttttgggggctgaattacctcactcaggatgatatttt ctagttccacctatttgcatgcaaaactcatcatgttctcgttcttaata gctgagcaatattccattgtgtaaatgaatcacattttctgaatccattc ttctgtcgtgggacatctgggttgtttccaacttctggctatcacagata aggtcactataaacatagtggaacatgtgcccctgttgcaaggtgagaca acttttagtatattccaagagtgtgtagctgggtcttcaggtagatctag ttcaattttctgagacctccagattgatttcagaatggttgtaccagttt tgcatggaggactgtctatttctcacatcctcaacaatgtggctgtcacc tagtttgattagctatctgatgtgaaggtgggttcgcaggtcaattgatt ggcatttcctggatgactagaaattggaaattcctagtgctcttccagcc ctcgttgtgatcctgtagtctaccaatttgaatggagttggtttcagggg tagctctctgaggagcatctta
quality values	Open. Hide. 57 42 28 33 61 33 18 61 53 61 61 61 33 61 61 61 61 61 61 47 45 49 61 61 61 61 43 38 38 34 26 28 29 29 52 38 52 55 55 61 55 52 55 49 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 55 61 49 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 55 61 61 61 61 47 38 61 61 61 55 61 61 61 61 61 61 61 61 61 43 61 55 61 61 61 61 61 55 61 61 55 61 39 61 61 61 61 55 61 61 43 61 61 50 61 61 61 61 61 61 61 61 55 36 61 61 61 61 40 61 61 43 61 61 61 61 61 31 61 61 61 50 61 61 61 43 45 53 53 61 61 61 53 61 53 61 61 53 61 50 61 61 53 31 61 61 38 61 61 61 61 50 32 61 61 50 53 61 53 61 39 53 61 45 61 61 53 47 34 47 25 61 61 53 46 61 39 61 47 43 52 38 47 25 38 47 47 47 30 53 47 57 53 30 53 45 53 38 53 45 52 47 21 30 17 57 53 42 42 47 47 45 38 57 53 42 53 45 53 15 45 53 53 45 57 53 24 47 57 57 38 40 57 53 38 47 43 50 43 45 45 40 35 53 42 27 46 39 38 34 50 41 38 45 52 30 45 38 28 52 11 37 17 57 14 16 37 33 38 40 50 24 47 28 39 45 39 29 12 46 27 31 42 45 43 39 32 16 57 46 52 29 19 57 28 36 33 6 57 50 38 57 17 23 57 57 57 41 13 10 57 57 53 30 17 8 6 6 24 14 15 23 20 19 24 29 23 10 23 10 10 11 5 44 34 39 20 53 36 44 52 27 27 19 8 12 32 24 18 5 37 20 13 17 37 24 36 25 29 47 23 18 7 30 22 8 15 8 22 29 21 18 17 19 15 9 35 37 32 21 30 23 5 24 12 8 10 15 41 23 24 40 37 29 24 23 20 13 27 27 23 28 30 30 13 14 13 9 20 17 19 6 11 12 5 25 34 11 39 15 15 16 25 16 11 9 8 21 16 20 16 11 7 18 24 15 20 9 18 21 10 10 24 20 29 16 36 26 15 10 15 17 12 18 20 10 7 10 7 27 6 8 7 7 6 14 24 8 7 10 10 24 14 12 7 14 13 7 8 18 11 14 28 14 27 27 24 13 20 23 24 24 15 19 20 20 24 14	Open. Hide. 61 43 43 32 61 38 27 24 53 43 55 37 43 37 47 61 61 61 61 61 61 61 61 50 41 61 61 49 61 55 61 61 61 61 61 61 61 49 49 61 61 61 61 61 61 61 55 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 36 61 61 61 61 61 61 61 61 61 61 53 61 61 33 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 53 61 50 61 61 47 61 47 61 61 61 61 47 52 53 61 61 61 53 57 57 46 53 52 46 52 47 57 53 39 41 47 53 53 53 57 57 57 57 53 57 52 53 53 42 57 47 53 57 53 57 57 53 52 53 53 57 47 57 57 51 53 53 57 53 53 47 47 53 50 53 53 47 53 47 37 53 47 53 52 45 53 38 57 53 57 53 53 57 37 52 53 57 57 57 57 57 38 52 57 57 53 53 57 47 45 57 53 57 53 57 47 53 53 53 57 53 46 57 45 37 43 57 45 53 52 45 57 46 52 39 57 57 38 41 38 46 46 53 52 47 53 53 42 32 50 53 52 32 39 45 41 52 46 35 52 50 57 45 52 37 41 41 30 41 50 34 39 42 52 37 38 53 52 40 30 34 47 41 53 53 47 42 50 33 50 38 53 37 39 53 39 52 38 52 37 37 39 52 52 33 57 57 39 37 57 57 57 53 36 47 44 37 34 26 53 24 39 29 39 44 40 35 53 37 34 12 46 33 22 37 48 28 31 42 57 46 37 40 36 36 32 37 40 27 33 29 30 53 35 40 37 57 34 16 31 27 37 37 27 37 57 57 43 30 40 33 32 41 35 34 40 47 22 43 33 32 37 29 40 35 33 31 47 24 40 30 29 24 31 44 30 51 15 31 23 30 30 29 29 33 29 29 27 30 46 39 22 41 28 25 42 19 30 32 34 25 29 32 27 29 27 24 51 51 48 29 28 28 30 20 26 8 45 20 29 29 29 31 29 29 28 29 28 34 33 25 32 45 17 30 17 21 28 29 24 23 46 21 28 29 29 30 51 26 24 27 28 29 30 28 29 20 28 38 43 21 29 24 28 28 18 20 24 22 41 23 5 16 9 25 18 26 13 23 34 28 29 21 46 29 22 23 29 28 25 23 26 12 39 20 20 14 28 28 25 29 28 36 26 29 24 19 12 21 11 16 18 29 9 39 10 20 26 14 27 21 20 28 31 23 44 44 29 8 6 7 14 16 14 24 27 29 36 6 16 15 34 15 17 27 12 31 15 27 19 24 27 23 38 26 19 29 31 26 24 12 21 28 14 34 20 9 10 26 33 25 27 23 10 36 8 15 23 51 51 20 19 18 19 15 25 15 7 5 17 14 38 8 7 29 19 21 21 27 26 44 9 20 13 8 10 29 12 17 29 22 6 13 18 18 13 19 15 9 25 44 44 15 9 8 30 6 15 14 22 15 19 27 9 25 16 8 5 4 9 18 44 14 8 14 11 4 11 6 17 15 5 12 9 14 6 6 30 30 5 15 6 6 9 16 25 14 5 16 7 6 14 15 29 9 30 42 19 9 12 21 21 8 12 22 20 9 30 6 6 20 23 10 12 5 5 5 23 4 5 5 14 25 17 5 19 12 8 20 16 18 6 2 7 8 5 23 18 9 23 8 19 5 7 9 10 23 32 5 8 10 5 5 6 14 4 3 4 7 7 18 5 3 6 4 3 6 4 7 21 9 6 12 5 5 2 3 3 3 3 7 7 4 6 6 3 3 5 5 6 5 25 10 3 4 4 6 8 3 4 6 3 3 4 7 3 7 7 3 3 6 6 3 5 8 17 4 5 17 30 18 7 5 5 5 18 4 1 3 3 7 13 14 18 13 4 6 3 3 3 4 1 1 8 10 6 6 8 3 3 7 4 4 7 4 17 6 6 5 6 3 5 2 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_87195611_87196187
seq2: B6Ng01-063H24.b_368_932

seq1  CATTACTAAATGCAGACACTATTGTAGATGCCAAGAAGTGCAAGCTGTCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTACTAAATGCAGACACTATTGTAGATGCCAAGAAGTGCAAGCTGTCA  50

seq1  GGAGCCTGATATAGCTGTCTTATGAGAGGCTCTGCCAGAGCCTGACAGAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCCTGATATAGCTGTCTTATGAGAGGCTCTGCCAGAGCCTGACAGAT  100

seq1  ACAGAGGCAGATGCTCACAGCCAACCATTGAACTGATTATGGGGTCCCCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAGGCAGATGCTCACAGCCAACCATTGAACTGATTATGGGGTCCCCA  150

seq1  ATGAGGAGTTAAAGAAAGGACTGGAGGAGCTGAAGGGGTTTGCAGCCTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGAGTTAAAGAAAGGACTGGAGGAGCTGAAGGGGTTTGCAGCCTGA  200

seq1  TCGGAAGAACAACAATACCAAACAACCAGAGCTCCCAGGGACTAAACCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGAAGAACAACAATACCAAACAACCAGAGCTCCCAGGGACTAAACCAC  250

seq1  CAACCAAGGAGTACACATGGAGGGACCCATGGCTCCAGCTGAAGAAAATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCAAGGAGTACACATGGAGGGACCCATGGCTCCAGCTGAAGAAAATG  300

seq1  GCCTTATCAGACATTAGTGGAAGCAGAGGCCCATCATGCCATGAAGGCAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTATCAGACATTAGTGGAAGCAGAGGCCCATCATGCCATGAAGGCAT  350

seq1  GATGCCCCAGAGTAGGGAGGTGGGGGAGGGGGACAGACCCTCCTAGAAGC  400
      |||||||||||||||||| ||||||||||||||||||||||||||||| |
seq2  GATGCCCCAGAGTAGGGA-GTGGGGGAGGGGGACAGACCCTCCTAGAA-C  398

seq1  AGGAAGAGGGG-TTATCAGATAGAGGGTTTCGGAGAGGGAAATCAGGAAA  449
      ||||||||||| |||||||||||||||||||||| |||| ||||||||||
seq2  AGGAAGAGGGGTTTATCAGATAGAGGGTTTCGGAAAGGG-AATCAGGAAA  447

seq1  GGGGATAACATTTGAAATGTAAATAAATAAAATATTAAAGGGAAAAAAGA  499
      |||||||||||||||||||  ||||||| |||||| || ||   ||||||
seq2  GGGGATAACATTTGAAATGGTAATAAAT-AAATATCAAGGG---AAAAGA  493

seq1  TGTTCTTTCCTCGGATTTAACAATTATATTGTATGAGAATTTAAAAAACA  549
      ||||||||||||||||||||| |||||| || |||| ||||||||||   
seq2  TGTTCTTTCCTCGGATTTAAC-ATTATA-TGGATGATAATTTAAAAA--C  539

seq1  GTTTCACTGATTTTTATTCAAAAGTTTT  577
      || ||  ||||||||| |||||||||||
seq2  GTCTC-GTGATTTTTA-TCAAAAGTTTT  565

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information