MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-144B19
Chromosome	5 (Build37)
Map Location	95,103,297 - 95,104,485
singlet/doublet	singlet
Overlap gene	LOC621203
Upstream gene	LOC666075, LOC666077, LOC666081, EG665802, LOC100040408, LOC100040981, EG622719, LOC100041003, BC061212, EG622744, LOC100041032, LOC100041042, LOC624421, AA792892, LOC665521, LOC665551, LOC100041102, LOC665560, LOC100041115, LOC624507
Downstream gene	LOC100041153, LOC665499, LOC624698, LOC100041179, LOC624655, LOC100041166, LOC665469, LOC622894, EG666121, LOC666125, EG666133, LOC100041296, LOC100041253, LOC100041264, EG624049, EG666159, LOC666164, EG666169, D5Ertd577e, LOC100041354, LOC100040503, LOC666187, EG622731, LOC100041380
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 36 Proteins pseudo : _no_value

name	LOC666077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 115 ESTs, 15 Proteins pseudo : _no_value

name	LOC666081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG665802 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665802 MGI:3704104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 168 ESTs, 48 Proteins

name	LOC100040408 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins

name	EG622719 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622719 MGI:3644199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins

name	LOC100041003 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins pseudo : _no_value

name	BC061212 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381724 MGI:2681870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622744 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622744 MGI:3647817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 47 Proteins

name	LOC100041032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 164 ESTs, 50 Proteins

name	LOC100041042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 6 Proteins

name	LOC624421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins

name	AA792892 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100554 MGI:2140789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665521 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 44 Proteins pseudo : _no_value

name	LOC665551 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins

name	LOC100041102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 168 ESTs, 49 Proteins

name	LOC665560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 45 Proteins

name	LOC624507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins

name	LOC621203 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 148 ESTs, 39 Proteins pseudo : _no_value

name	LOC100041153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins pseudo : _no_value

name	LOC665499 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC624698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 41 Proteins

name	LOC100041179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 169 ESTs, 49 Proteins

name	LOC624655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 14 Proteins pseudo : _no_value

name	LOC665469 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins pseudo : _no_value

name	LOC622894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 148 ESTs, 39 Proteins pseudo : _no_value

name	EG666121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666121 MGI:3643725
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins pseudo : _no_value

name	LOC666125 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG666133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666133 MGI:3646599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 42 Proteins

name	LOC100041296 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 166 ESTs, 48 Proteins

name	LOC100041253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 168 ESTs, 49 Proteins

name	LOC100041264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 46 Proteins

name	EG624049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624049 MGI:3646666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins

name	EG666159 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666159 MGI:3645939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC666164 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666169 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666169 MGI:3643214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins

name	D5Ertd577e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320549 MGI:1261918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 62 ESTs, 56 Proteins

name	LOC100040503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC666187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins

name	EG622731 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622731 MGI:3643967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins

name	LOC100041380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins pseudo : _no_value

name	EG665802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374914 GeneID:665802 MGI:3704104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 131 ESTs, 45 Proteins product : predicted gene, EG665802, transcript variant 5 transcript_id : XM_981847.1

name	EG665802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374916 GeneID:665802 MGI:3704104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 143 ESTs, 45 Proteins product : predicted gene, EG665802, transcript variant 6 transcript_id : XM_981891.1

name	LOC100040981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254043 GeneID:100040981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins product : similar to CDNA sequence BC061212 transcript_id : XM_001476028.1

name	EG622719 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82897868 GeneID:622719 MGI:3644199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins product : predicted gene, EG622719 transcript_id : XM_889891.1

name	BC061212 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348567 GeneID:381724 MGI:2681870
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC061212 transcript_id : NM_198667.1

name	EG622744 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374956 GeneID:622744 MGI:3647817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 47 Proteins product : predicted gene, EG622744 transcript_id : XM_889906.2

name	LOC100041032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254046 GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 127 ESTs, 47 Proteins product : similar to C87414 protein, transcript variant 1 transcript_id : XM_001476116.1

name	LOC100041032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254048 GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 138 ESTs, 47 Proteins product : similar to C87414 protein, transcript variant 2 transcript_id : XM_001476136.1

name	LOC100041032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254050 GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 89 ESTs, 3 Proteins product : similar to C87414 protein, transcript variant 3 transcript_id : XM_001476149.1

name	LOC100041042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254052 GeneID:100041042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 6 Proteins product : hypothetical protein LOC100041042 transcript_id : XM_001476164.1

name	LOC624421 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375924 GeneID:624421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins product : similar to D5Ertd577e protein transcript_id : XM_888973.2

name	AA792892 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802394 GeneID:100554 MGI:2140789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA792892 transcript_id : NM_178894.3

name	LOC665551 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375932 GeneID:665551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins product : similar to D5Ertd577e protein transcript_id : XM_977722.1

name	LOC100041102 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254056 GeneID:100041102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 131 ESTs, 46 Proteins product : similar to Expressed sequence AA792892, transcript variant 1 transcript_id : XM_001476240.1

name	LOC100041102 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254058 GeneID:100041102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 142 ESTs, 46 Proteins product : similar to Expressed sequence AA792892, transcript variant 2 transcript_id : XM_001476257.1

name	LOC100041102 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254060 GeneID:100041102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 3 Proteins product : similar to Expressed sequence AA792892, transcript variant 3 transcript_id : XM_001476272.1

name	LOC100041115 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254062 GeneID:100041115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 45 Proteins product : similar to CDNA sequence BC061212 transcript_id : XM_001476310.1

name	LOC624507 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375937 GeneID:624507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins product : similar to D5Ertd577e protein transcript_id : XM_889056.2

name	LOC624698 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375897 GeneID:624698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 41 Proteins product : similar to D5Ertd577e protein transcript_id : XM_889253.2

name	LOC100041179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254073 GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 132 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 1 transcript_id : XM_001476397.1

name	LOC100041179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254075 GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 143 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 2 transcript_id : XM_001476414.1

name	LOC100041179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254077 GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 3 Proteins product : similar to C87414 protein, transcript variant 3 transcript_id : XM_001476427.1

name	EG666133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374958 GeneID:666133 MGI:3646599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 42 Proteins product : predicted gene, EG666133 transcript_id : XM_981835.1

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254097 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 3 Proteins product : similar to Expressed sequence C87414, transcript variant 3 transcript_id : XM_001476611.1

name	LOC100041253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254084 GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 131 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 1 transcript_id : XM_001476493.1

name	LOC100041253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254086 GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 142 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 2 transcript_id : XM_001476505.1

name	LOC100041253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254088 GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 3 Proteins product : similar to C87414 protein, transcript variant 3 transcript_id : XM_001476521.1

name	LOC100041264 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254091 GeneID:100041264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 46 Proteins product : similar to CDNA sequence BC061212 transcript_id : XM_001476548.1

name	EG624049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374967 GeneID:624049 MGI:3646666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins product : predicted gene, EG624049 transcript_id : XM_888575.2

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254095 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 158 ESTs, 45 Proteins product : similar to Expressed sequence C87414, transcript variant 2 transcript_id : XM_001476589.1

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254093 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 150 ESTs, 45 Proteins product : similar to Expressed sequence C87414, transcript variant 1 transcript_id : XM_001476574.1

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254099 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 135 ESTs, 3 Proteins product : similar to Expressed sequence C87414, transcript variant 4 transcript_id : XM_001476631.1

name	EG666169 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374970 GeneID:666169 MGI:3643214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins product : predicted gene, EG666169 transcript_id : XM_982113.1

name	D5Ertd577e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343011 GeneID:320549 MGI:1261918
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 577, expressed transcript_id : NM_177187.2

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254103 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 41 ESTs, 53 Proteins product : similar to D5Ertd577e protein, transcript variant 1 transcript_id : XM_001476772.1

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254105 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 44 ESTs, 53 Proteins product : similar to D5Ertd577e protein, transcript variant 2 transcript_id : XM_001476793.1

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254107 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 58 ESTs, 53 Proteins product : similar to D5Ertd577e protein, transcript variant 3 transcript_id : XM_001476810.1

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254109 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 3 Proteins product : similar to D5Ertd577e protein, transcript variant 4 transcript_id : XM_001476832.1

name	LOC666187 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94374973 GeneID:666187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins product : predicted gene, EG666089 transcript_id : XM_982184.1

name	EG622731 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82897870 GeneID:622731 MGI:3643967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins product : predicted gene, EG622731 transcript_id : XM_889897.1

name	EG665802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374915 GeneID:665802 MGI:3704104
definition	codon_start : 1 product : similar to C87414 protein isoform 5 protein_id : XP_986941.1

name	EG665802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374917 GeneID:665802 MGI:3704104
definition	codon_start : 1 product : similar to C87414 protein isoform 6 protein_id : XP_986985.1

name	LOC100040981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254044 GeneID:100040981
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_001476078.1

name	EG622719 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897869 GeneID:622719 MGI:3644199
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894984.1

name	BC061212 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348568 GeneID:381724 MGI:2681870
definition	codon_start : 1 product : hypothetical protein LOC381724 protein_id : NP_941069.1

name	EG622744 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897873 GeneID:622744 MGI:3647817
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894999.1

name	LOC100041032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254047 GeneID:100041032
definition	codon_start : 1 product : similar to C87414 protein isoform 1 protein_id : XP_001476166.1

name	LOC100041032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254049 GeneID:100041032
definition	codon_start : 1 product : similar to C87414 protein isoform 2 protein_id : XP_001476186.1

name	LOC100041032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254051 GeneID:100041032
definition	codon_start : 1 product : similar to C87414 protein isoform 3 protein_id : XP_001476199.1

name	LOC100041042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254053 GeneID:100041042
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476214.1

name	LOC624421 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375925 GeneID:624421
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894066.2

name	AA792892 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725742 GeneID:100554 MGI:2140789
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC100554 protein_id : NP_849225.1

name	LOC665551 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375933 GeneID:665551
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982816.1

name	LOC100041102 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254057 GeneID:100041102
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476290.1

name	LOC100041102 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254059 GeneID:100041102
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476307.1

name	LOC100041102 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254061 GeneID:100041102
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001476322.1

name	LOC100041115 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254063 GeneID:100041115
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_001476360.1

name	LOC624507 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375938 GeneID:624507
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894149.2

name	LOC624698 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82900352 GeneID:624698
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894346.1

name	LOC100041179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254074 GeneID:100041179
definition	codon_start : 1 product : similar to C87414 protein isoform 1 protein_id : XP_001476447.1

name	LOC100041179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254076 GeneID:100041179
definition	codon_start : 1 product : similar to C87414 protein isoform 2 protein_id : XP_001476464.1

name	LOC100041179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254078 GeneID:100041179
definition	codon_start : 1 product : similar to C87414 protein isoform 3 protein_id : XP_001476477.1

name	EG666133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374959 GeneID:666133 MGI:3646599
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986929.1

name	LOC100041253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254085 GeneID:100041253
definition	codon_start : 1 product : similar to C87414 protein isoform 1 protein_id : XP_001476543.1

name	LOC100041253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254087 GeneID:100041253
definition	codon_start : 1 product : similar to C87414 protein isoform 2 protein_id : XP_001476555.1

name	LOC100041253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254089 GeneID:100041253
definition	codon_start : 1 product : similar to C87414 protein isoform 3 protein_id : XP_001476571.1

name	LOC100041264 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254092 GeneID:100041264
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_001476598.1

name	EG624049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374968 GeneID:624049 MGI:3646666
definition	codon_start : 1 product : hypothetical protein protein_id : XP_893668.2

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254094 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 1 protein_id : XP_001476624.1

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254096 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 2 protein_id : XP_001476639.1

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254098 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 3 protein_id : XP_001476661.1

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254100 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 4 protein_id : XP_001476681.1

name	EG666169 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374971 GeneID:666169 MGI:3643214
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987207.1

name	D5Ertd577e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893195 GeneID:320549 MGI:1261918
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC320549 protein_id : NP_796161.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254104 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476822.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254106 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476843.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254108 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001476860.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254110 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001476882.1

name	LOC666187 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374974 GeneID:666187
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_987278.1

name	EG622731 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897871 GeneID:622731 MGI:3643967
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894990.1

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 1 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 2 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 3 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 4 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 5 pseudo : _no_value

name	LOC100040408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040408
definition	number : 1 pseudo : _no_value

name	LOC100040408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040408
definition	number : 2 pseudo : _no_value

name	LOC100040408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040408
definition	number : 3 pseudo : _no_value

name	LOC665560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665560
definition	number : 1 pseudo : _no_value

name	LOC665560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665560
definition	number : 2 pseudo : _no_value

name	LOC665560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665560
definition	number : 3 pseudo : _no_value

name	LOC665560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665560
definition	number : 4 pseudo : _no_value

name	LOC665499 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665499
definition	number : 3 pseudo : _no_value

name	LOC665499 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665499
definition	number : 2 pseudo : _no_value

name	LOC665499 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665499
definition	number : 1 pseudo : _no_value

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 1 pseudo : _no_value

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 2 pseudo : _no_value

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 3 pseudo : _no_value

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 4 pseudo : _no_value

name	LOC665469 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665469
definition	number : 1 pseudo : _no_value

name	LOC665469 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665469
definition	number : 2 pseudo : _no_value

name	LOC665469 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665469
definition	number : 3 pseudo : _no_value

name	LOC666125 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666125
definition	number : 3 pseudo : _no_value

name	LOC666125 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666125
definition	number : 2 pseudo : _no_value

name	LOC666125 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666125
definition	number : 1 pseudo : _no_value

name	EG666159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666159
definition	number : 1 pseudo : _no_value

name	EG666159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666159
definition	number : 2 pseudo : _no_value

name	EG666159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666159
definition	number : 3 pseudo : _no_value

name	LOC666164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666164
definition	number : 3 pseudo : _no_value

name	LOC666164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666164
definition	number : 2 pseudo : _no_value

name	LOC666164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666164
definition	number : 1 pseudo : _no_value

name	LOC100040503 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040503
definition	number : 1 pseudo : _no_value

name	LOC100040503 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040503
definition	number : 2 pseudo : _no_value

name	LOC100040503 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040503
definition	number : 3 pseudo : _no_value

name	LOC666075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254042 GeneID:666075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 36 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032496.1

name	LOC666077 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254004 GeneID:666077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 115 ESTs, 15 Proteins product : similar to Expressed sequence C87414 pseudo : _no_value transcript_id : XR_035665.1

name	LOC100041003 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254045 GeneID:100041003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032541.1

name	LOC665521 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94375926 GeneID:665521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 44 Proteins product : similar to CDNA sequence BC061212 pseudo : _no_value transcript_id : XR_001743.1

name	LOC621203 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254064 GeneID:621203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 148 ESTs, 39 Proteins product : similar to Expressed sequence C87414 pseudo : _no_value transcript_id : XR_035672.1

name	LOC100041153 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254067 GeneID:100041153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032699.1

name	LOC100041166 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254070 GeneID:100041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 14 Proteins product : hypothetical protein LOC100041166 pseudo : _no_value transcript_id : XR_032707.1

name	LOC622894 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254082 GeneID:622894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 148 ESTs, 39 Proteins product : similar to Expressed sequence C87414 pseudo : _no_value transcript_id : XR_035674.1

name	EG666121 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254083 GeneID:666121 MGI:3643725
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins product : predicted gene, EG666121 pseudo : _no_value transcript_id : XR_032771.1

name	LOC100041380 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254111 GeneID:100041380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032968.1

clone name	MSMg01-329P19
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-123M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-144B19.b	B6Ng01-144B19.g
ACC	DH941872	DH941873
length	1,214	1,168
definition	DH941872\|Mus musculus domesticus DNA, BAC clone: B6Ng01-144B19, 5' end.	DH941873\|Mus musculus domesticus DNA, BAC clone: B6Ng01-144B19, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaataggtccatatctatcaccctacagaacactccagtccaag cggaccaaaaacctcaacctaaacctagatacattaaatataattaaaaa gtgggtaatagctttgaatccattagtacaggagacatcttcctgaaaga tccaacatctcagtcactaagatcaaaaagtaataaatggaacctcatga aactaaaacatctcctgtatggaaaaggagatttttgtcaaggacagtgg tcaaaaggataaaacagtagcctagagattgggaaaagatctccaccaac cttccatctgaaagagggctgatatccaaagtacctaaagaactaaaaaa agtagacactaacaaaccaaatagcctaaattttaaaaaggggtacatag ctaaatagaattttcaacagaggaatatttaatgaccaagaagcacttac agaaatgctcaacatccttagtcatcagggaaatccaaatcaaaatgact ctgggatttcattttacaccctttagaagggcaacagttcatgctagcta gggtgtggagcatgggaaaactctcttcctttgctgataggagtgcaaac ttgtacaaccagtctgaaaataaattcagtgctttctcaaataattggaa ataattatctctgaaatgcttataccactcctggtcatatactcaaaaga tgctgcgtcataccacaagaatagtgttttaactatgtgcagttttattg gaaatagccagaaacttgaaacaacccaaatgtccctcaactgaagaatg gaaaatgaatatatggtacatttacacaacagaatactactcagctgtta aaaacaatgacatcatgaaacttgcaggctaaacccagactcataaagac aaatgtggcgtgtacacaggagtgaattgtaaccataaagtacaggatac ctttttatcagaggcttaaagaaactagaagaaaggtccagcagagatat ttgatctaatagacataattaagtacacttcagagtagatgatgagggac tttatgtaaggaatctgacagtataagtcgtcacatatggttgagatgac gagaagaaattgaatctgtgactgcgaaatctgaaatgacagataccttg catgaactctgatctcagagtgaggaccttgctgacttctttgcatacga acctatgcggacgt	gaattctgtctcacccaaccaaatacgaacaatgggaattgatgttaaat aggcagctcagtcacttgtcctgggctttcatgaatgaaaatagcttcag taaaaatttcaaattcctcgggtgaagagaaagagattttctacaaagag gtttatagaggtcttttgggaaatgtaaggacaaatcaatactgaaaaga aaaaaatttccggataaaatgggatcaagacaaaggagactttgagctgg gtcaggctcatgagcaggaaattagcctagggcctagcattgacctcgac aatttaacaggcaccacagttattaatggaagggccacaagtacctctgg cgagattaagacaatgactcacttttttccatgcatgaaaaatttcaagc ctcaaaaggcatggaggcttttgtcaaaatacccactggtaagaaaatga cttccttcaggtccaggctttgggctcaatgggaagggatccatccctga tcctgttatattgctgaaagctgtttcccagagcttttctgtgattgacc tgtgtccctctgagaagcttgtccagggtgtccttggggaattccatgcc aaggatagaacacagtaggaatggtttcagcataatgctaggagtgctgc ccaggtgactttcatcttctgtttcatgctcttcagagtagaaggatgga gagcctggcaggtgttgtaattgtttgtttctttgtttgtgatttctgtc tagttgagtgtttctctggtgttggctgaggctgagatcctgctgccaag ccctgttctctttctggccatgaaacttctagcccctttgctggtctgtt tctaagagcttttattctggtggcttgcttccctctaccacctatgcagg tgtagcagctgcttcacagttgtgcccttagtatttagcatttacatctt cctagcccacacattctttgcatgctaaccctggagcttcacagtaggac tgggaatgacactgtgagcctagagcaatctgctttctgccccaatcaga acagcatttttttctttgcttggcagtttactcaaaaggccaggcagaac tgagagaactggatcaagactgggtagactgggcctgttatttatgctct gaaactttactcaattga
quality values	Open. Hide. 61 43 35 39 61 38 19 61 61 61 47 61 47 61 61 47 35 61 61 61 61 61 61 61 49 49 61 52 59 36 27 28 18 26 41 59 61 61 61 61 61 59 59 59 59 61 59 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 59 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 59 44 55 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 55 44 55 61 61 59 59 61 59 55 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 50 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 47 47 47 47 61 53 61 61 61 61 61 61 27 47 47 52 57 47 53 53 53 57 57 57 53 57 57 57 53 53 53 57 53 53 57 57 53 53 57 53 57 57 57 53 53 43 53 57 57 57 57 57 47 47 53 57 53 57 53 52 47 53 53 50 53 57 57 53 57 57 53 47 53 47 57 57 52 52 57 47 52 53 57 57 57 57 57 53 53 53 29 52 43 33 34 45 47 53 53 57 57 47 57 27 52 30 57 46 53 57 52 38 52 52 57 53 57 57 57 50 57 50 45 53 53 53 45 42 47 57 57 52 46 57 47 43 45 53 39 52 53 46 46 53 53 53 46 46 57 53 37 53 52 57 47 50 52 39 38 34 50 53 53 39 47 50 53 57 37 42 41 52 47 52 44 39 53 43 37 57 57 57 39 38 29 52 52 53 52 39 41 34 36 40 52 40 38 38 30 39 39 45 41 52 36 44 48 48 48 51 27 57 57 40 36 30 40 37 40 45 45 33 39 39 24 30 33 46 57 46 36 37 47 40 19 37 57 21 30 30 30 25 24 27 34 47 45 45 30 32 30 32 32 48 37 32 27 30 23 37 25 29 45 29 29 47 30 25 36 27 34 37 33 31 29 38 35 48 29 31 32 25 28 29 21 29 46 46 43 29 30 30 29 29 29 32 29 36 29 46 22 29 29 28 43 51 29 28 41 15 36 25 21 23 29 29 39 26 26 29 29 29 35 29 35 33 23 25 27 29 29 26 29 24 51 46 41 26 26 16 20 29 30 28 27 24 38 34 29 30 29 29 51 20 23 30 33 33 28 26 27 22 17 29 23 41 26 16 25 30 23 25 34 21 31 25 19 36 31 51 35 23 29 19 11 36 26 25 27 23 25 32 17 23 22 41 23 23 29 18 30 10 11 14 34 19 28 30 20 22 16 23 32 25 21 16 23 28 19 22 27 51 22 29 29 28 22 15 17 27 13 5 18 8 17 29 51 51 51 24 8 5 16 8 17 33 17 14 18 22 22 8 42 21 9 19 39 22 15 12 33 11 33 31 18 32 44 15 24 23 18 22 31 23 22 22 13 13 39 10 19 8 9 11 29 29 15 29 9 21 6 22 13 11 4 4 3 7 9 14 5 16 4 5 14 25 16 9 12 15 12 15 12 19 13 4 5 3 3 10 6 7 29 11 27 9 11 23 5 8 36 14 17 6 10 9 7 6 5 8 16 9 12 14 15 6 11 7 4 7 27 7 10 5 16 15 8 5 3 3 3 5 11 9 13 23 9 13 7 5 4 7 11 6 8 5 5 16 4 15 8 5 14 2 3 9 6 16 6 6 15 20 13 2 4 7 4 12 5 7 4 8 16 5 7 8 5 6 6 11 2 1 7 4 3 5 7 16 11 15 9 16 5 3 3 3 5 6 18 4 7 13 4 4 1 3 1 3 3 4 1 3 13 5 3 5 1 2 4 3 4 4 11 7 7 6 5 4 10 3 12 7 7 3 2 5 8 10 20 7 19 7 7 5 8 3 4 6 17 3 3 1 4 5 5 9 14 4 12 19 3 1 4 1 3 6 4 2	Open. Hide. 61 61 55 49 61 43 43 40 28 41 49 59 36 59 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 59 59 59 59 59 59 59 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 50 61 61 61 61 53 61 37 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 53 50 50 47 61 52 61 61 50 53 61 52 53 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 52 61 61 61 47 46 47 45 53 47 42 34 47 53 53 53 47 47 47 53 57 57 53 53 53 53 53 57 53 53 53 57 53 53 53 53 53 53 57 53 53 46 47 47 47 45 57 45 53 53 53 57 57 50 57 57 53 57 47 47 57 53 47 39 47 53 53 52 57 50 47 34 47 52 50 57 57 53 30 57 53 45 53 53 47 53 50 43 41 47 47 47 47 43 47 45 45 43 38 38 47 57 57 53 57 45 43 53 50 50 38 52 53 46 38 32 45 52 57 34 39 53 50 57 52 50 50 53 50 53 53 47 17 57 46 43 30 57 47 30 57 53 42 33 43 46 43 52 45 53 50 57 45 52 36 47 43 46 33 52 53 50 53 52 31 38 41 36 35 47 37 57 34 26 46 57 50 40 40 42 40 36 37 38 52 52 38 57 50 30 34 52 53 39 53 37 39 53 40 40 33 52 28 42 42 33 43 52 17 53 34 29 53 46 53 35 47 27 40 46 36 44 42 42 36 15 57 24 52 33 27 52 21 45 47 34 53 53 37 57 34 30 28 57 53 40 33 57 45 53 31 57 33 30 32 40 32 24 57 37 48 32 57 27 35 27 33 25 31 33 29 48 31 34 37 20 46 31 30 30 29 25 29 51 27 38 29 28 30 31 28 40 29 33 9 30 17 30 30 36 14 28 29 27 29 29 30 29 29 29 25 20 18 29 29 27 27 22 23 21 14 27 31 19 15 12 44 43 22 22 27 36 21 27 14 29 28 39 46 29 24 26 30 28 26 29 29 33 36 25 30 29 43 13 29 28 28 26 33 35 28 29 23 8 46 29 26 25 29 27 28 46 18 19 18 36 29 26 23 28 28 28 20 32 29 14 36 29 25 27 28 43 33 29 26 23 43 26 25 27 21 21 29 29 22 29 33 26 29 22 25 33 31 46 25 10 24 23 33 24 29 29 23 31 28 29 29 31 23 26 18 29 25 41 13 15 30 23 22 17 32 19 19 16 27 19 20 18 6 51 33 14 20 24 27 18 51 39 22 29 21 29 33 27 29 17 28 18 27 18 28 33 14 12 15 12 4 8 5 4 9 7 44 26 29 23 8 13 6 12 18 20 20 13 16 17 6 4 6 21 11 28 7 11 35 9 17 26 17 13 25 22 6 35 10 10 19 42 23 22 26 23 9 20 5 8 6 11 4 7 9 14 7 15 7 7 4 3 14 12 9 14 11 5 14 12 17 12 17 36 16 14 10 10 13 9 14 8 8 8 21 8 5 7 21 27 11 10 6 17 9 23 30 35 25 36 35 9 12 9 15 20 13 12 15 24 13 15 8 9 9 4 4 4 6 11 21 6 12 14 25 8 7 10 5 4 3 12 7 15 4 4 18 7 4 5 8 7 6 9 3 6 7 5 17 6 4 17 9 5 1 13 21 19 12 5 4 4 4 8 4 5 4 20 9 5 11 16 6 7 4 5 1 1 3 1 7 6 8 8 6 4 11 4 4 7 6 16 7 4 5 8 10 7 13 7 19 1 12 4 4 7 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_95103297_95104485
seq2: B6Ng01-144B19.g_67_1234

seq1  GAATTCTGTCTCACCCAACCAAATACGAACAATGGGAATTGATGTTAAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTCTCACCCAACCAAATACGAACAATGGGAATTGATGTTAAAT  50

seq1  AGGCAGCTCAGTCACTTGTCCTGGGCTTTCATGAATGAAAATAGCTTCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGCTCAGTCACTTGTCCTGGGCTTTCATGAATGAAAATAGCTTCAG  100

seq1  TAAAAATTTCAAATTCCTCGGGTGAAGAGAAAGAGATTTTCTACAAAGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAATTTCAAATTCCTCGGGTGAAGAGAAAGAGATTTTCTACAAAGAG  150

seq1  GTTTATAGAGGTCTTTTGGGAAATGTAAGGACAAATCAATACTGAAAAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTATAGAGGTCTTTTGGGAAATGTAAGGACAAATCAATACTGAAAAGA  200

seq1  AAAAAATTTCCGGATAAAATGGGATCAAGACAAAGGAGACTTTGAGCTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAATTTCCGGATAAAATGGGATCAAGACAAAGGAGACTTTGAGCTGG  250

seq1  GTCAGGCTCATGAGCAGGAAATTAGCCTAGGGCCTAGCATTGACCTCGAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGGCTCATGAGCAGGAAATTAGCCTAGGGCCTAGCATTGACCTCGAC  300

seq1  AATTTAACAGGCACCACAGTTATTAATGGAAGGGCCACAAGTACCTCTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTAACAGGCACCACAGTTATTAATGGAAGGGCCACAAGTACCTCTGG  350

seq1  CGAGATTAAGACAATGACTCACTTTTTTCCATGCATGAAAAATTTCAAGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGATTAAGACAATGACTCACTTTTTTCCATGCATGAAAAATTTCAAGC  400

seq1  CTCAAAAGGCATGGAGGCTTTTGTCAAAATACCCACTGGTAAGAAAATGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAAAGGCATGGAGGCTTTTGTCAAAATACCCACTGGTAAGAAAATGA  450

seq1  CTTCCTTCAGGTCCAGGCTTTGGGCTCAATGGGAAGGGATCCATCCCTGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTTCAGGTCCAGGCTTTGGGCTCAATGGGAAGGGATCCATCCCTGA  500

seq1  TCCTGTTATATTGCTGAAAGCTGTTTCCCAGAGCTTTTCTGTGATTGACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGTTATATTGCTGAAAGCTGTTTCCCAGAGCTTTTCTGTGATTGACC  550

seq1  TGTGTCCCTCTGAGAAGCTTGTCCAGGGTGTCCTTGGGGAATTCCATGCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTCCCTCTGAGAAGCTTGTCCAGGGTGTCCTTGGGGAATTCCATGCC  600

seq1  AAGGATAGAACACAGTAGGAATGGTTTCAGCATAATGCTAGGAGTGCTGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGATAGAACACAGTAGGAATGGTTTCAGCATAATGCTAGGAGTGCTGC  650

seq1  CCAGGTGACTTTCATCTTCTGTTTCATGCTCTTCAGAGTAGAAGGATGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTGACTTTCATCTTCTGTTTCATGCTCTTCAGAGTAGAAGGATGGA  700

seq1  GAGCCTGGCAGGTGTTGTAATTGTTTGTTTCTTTGTTTGTGATTTCTGTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCTGGCAGGTGTTGTAATTGTTTGTTTCTTTGTTTGTGATTTCTGTC  750

seq1  TAGTTGAGTGTTTCTCTGGTGTTGGCTGAGGCTGAGATCCTGCTGCCAAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTGAGTGTTTCTCTGGTGTTGGCTGAGGCTGAGATCCTGCTGCCAAG  800

seq1  CCCTGTTCTCTTTCTGGCCATGAAACTTCTAGCCCCTTTGCTGGTCTGTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGTTCTCTTTCTGGCCATGAAACTTCTAGCCCCTTTGCTGGTCTGTT  850

seq1  TCTAAGAGCTTTTATTCTGGTGGCTTGCTTCCCTCTACCACCTATGCAGG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAGAGCTTTTATTCTGGTGGCTTGCTTCCCTCTACCACCTATGCAGG  900

seq1  TGTAGCAGCTGCTTCACAGTTGTGCCCTTAGTATTTAGCATTTACATCTT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGCAGCTGCTTCACAGTTGTGCCCTTAGTATTTAGCATTTACATCTT  950

seq1  CCTAGCCCACACAATTCCTTTGCATTGCTAACCCTGAGCCTCCACAGTAG  1000
      |||||||||||||  | ||||||| |||||||||||   || ||||||||
seq2  CCTAGCCCACACA--TTCTTTGCA-TGCTAACCCTGGAGCTTCACAGTAG  997

seq1  GAACTGGGAATGAACACTTGTGAGCCTCAGAGCAAAACCTGCTTTCTGCC  1050
      | |||||||||| |||| ||||||||| |||||  || ||||||||||||
seq2  G-ACTGGGAATG-ACAC-TGTGAGCCT-AGAGC--AATCTGCTTTCTGCC  1041

seq1  CCAATCCAAGAACAGCCATTTTTTTCCTTGCTTGGCAGTTGTACTCAAAA  1100
      ||||||  ||||||| |||||||||| ||||||||||||| ||||| |||
seq2  CCAATC--AGAACAG-CATTTTTTTCTTTGCTTGGCAGTT-TACTC-AAA  1086

seq1  AGGCACAGGCCAGAAACTGA-AGACTTGAATCCAAAGGAACTGTTGAGCT  1149
      |||| |||| ||| |||||| |||  || |||  |||  ||||   ||  
seq2  AGGC-CAGG-CAG-AACTGAGAGAACTGGATC--AAG--ACTGGGTAGAC  1129

seq1  TGG--CTGATAAATTTTTATGTTGAG-ATCTTTACTCAATTGA  1189
      |||  ||| ||    |||||| |  | | ||||||||||||||
seq2  TGGGCCTGTTA----TTTATGCTCTGAAACTTTACTCAATTGA  1168

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information