MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-268D19
Chromosome	5 (Build37)
Map Location	114,057,255 - 114,232,781
singlet/doublet	doublet
Overlap gene	Cmklr1, LOC381707, D5Ertd40e, Sart3, LOC100041786, Iscu
Upstream gene	Myo18b, Adrbk2, Crybb2, LOC100042920, Crybb3, 2900026A02Rik, Gm854, Rutbc2, Aym1, C530024P05Rik
Downstream gene	Tmem119, Selplg, Coro1c, Ssh1, Dao1, Svop, Usp30, Alkbh2, Ung, Acacb, Foxn4, Myo1h, Kctd10, Ube3b, Mmab, Mvk, BC057022, Trpv4, Gltp, Tchp, Git2, 4930515G01Rik, Ankrd13a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Myo18b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74376 MGI:1921626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins

name	Adrbk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320129 MGI:87941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Crybb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12961 MGI:88519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042920 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Crybb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12962 MGI:102717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900026A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243219 MGI:1920194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm854 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333048 MGI:2685700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rutbc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52850 MGI:107320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aym1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503692 MGI:1891321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530024P05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320916 MGI:2445030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmklr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14747 MGI:109603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC381707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D5Ertd40e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231630 MGI:1098550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sart3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53890 MGI:1858230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041786 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 496 ESTs, 1 Protein

name	Iscu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66383 MGI:1913633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231633 MGI:2385228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Selplg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20345 MGI:106689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23790 MGI:1345964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231637 MGI:2686240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dao1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13142 MGI:94859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svop (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68666 MGI:1915916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100756 MGI:2140991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alkbh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231642 MGI:2141032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ung (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22256 MGI:109352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Acacb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100705 MGI:2140940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116810 MGI:2151057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231646 MGI:1914674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 9 Proteins

name	Kctd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330171 MGI:2141207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117146 MGI:1891295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77697 MGI:1924947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mvk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17855 MGI:107624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC057022 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433940 MGI:3605543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63873 MGI:1926945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gltp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56356 MGI:1929253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tchp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77832 MGI:1925082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Git2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	4930515G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67642 MGI:1914892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68420 MGI:1915670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo18b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254132 GeneID:74376 MGI:1921626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : myosin XVIIIb transcript_id : XM_990203.2

name	Adrbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78711829 GeneID:320129 MGI:87941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor kinase, beta 2 transcript_id : NM_177078.3

name	Adrbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78711827 GeneID:320129 MGI:87941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor kinase, beta 2 transcript_id : NM_001035531.1

name	Crybb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372366 GeneID:12961 MGI:88519
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta B2 transcript_id : NM_007773.2

name	LOC100042920 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254170 GeneID:100042920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042920 transcript_id : XM_001479469.1

name	Crybb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476046 GeneID:12962 MGI:102717
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta B3 transcript_id : NM_021352.2

name	2900026A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373023 GeneID:243219 MGI:1920194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900026A02 gene transcript_id : NM_172884.2

name	Gm854 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803583 GeneID:333048 MGI:2685700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 854, (NCBI) transcript_id : NM_001033428.2

name	Rutbc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352699 GeneID:52850 MGI:107320
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and TBC1 domain containing 2 transcript_id : NM_172718.2

name	Aym1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60678283 GeneID:503692 MGI:1891321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activator of yeast meiotic promoters 1 transcript_id : NM_001012726.1

name	C530024P05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343262 GeneID:320916 MGI:2445030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530024P05 gene transcript_id : NM_177292.2

name	Cmklr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896663 GeneID:14747 MGI:109603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine-like receptor 1 transcript_id : NM_008153.2

name	LOC381707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254532 GeneID:381707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC381707 transcript_id : XM_001471974.1

name	D5Ertd40e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803114 GeneID:231630 MGI:1098550
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 40, expressed transcript_id : NM_001010825.2

name	Sart3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394238 GeneID:53890 MGI:1858230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : squamous cell carcinoma antigen recognized by T-cells 3 transcript_id : NM_016926.1

name	LOC100041786 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254565 GeneID:100041786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 496 ESTs, 1 Protein product : similar to 40S ribosomal protein S28 transcript_id : XM_001478306.1

name	Iscu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803041 GeneID:66383 MGI:1913633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IscU iron-sulfur cluster scaffold homolog (E. coli) transcript_id : NM_025526.2

name	Tmem119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343950 GeneID:231633 MGI:2385228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 119 transcript_id : NM_146162.2

name	Selplg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982018 GeneID:20345 MGI:106689
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selectin, platelet (p-selectin) ligand transcript_id : NM_009151.2

name	Coro1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365603 GeneID:23790 MGI:1345964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 1C transcript_id : NM_011779.3

name	Ssh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350170 GeneID:231637 MGI:2686240
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slingshot homolog 1 (Drosophila) transcript_id : NM_198109.3

name	Dao1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815856 GeneID:13142 MGI:94859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D-amino acid oxidase 1 transcript_id : NM_010018.2

name	Svop (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72534842 GeneID:68666 MGI:1915916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SV2 related protein transcript_id : NM_026805.1

name	Usp30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348786 GeneID:100756 MGI:2140991
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 30 transcript_id : NM_001033202.2

name	Alkbh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098161 GeneID:231642 MGI:2141032
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkB, alkylation repair homolog 2 (E. coli) transcript_id : NM_175016.2

name	Ung (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:101943607 GeneID:22256 MGI:109352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uracil DNA glycosylase transcript_id : NM_001040691.1

name	Ung (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:101943420 GeneID:22256 MGI:109352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uracil DNA glycosylase transcript_id : NM_011677.2

name	Acacb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976024 GeneID:100705 MGI:2140940
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetyl-Coenzyme A carboxylase beta transcript_id : NM_133904.1

name	Foxn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598890 GeneID:116810 MGI:2151057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box N4 transcript_id : NM_148935.2

name	Myo1h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254534 GeneID:231646 MGI:1914674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 9 Proteins product : myosin 1H transcript_id : XM_972888.2

name	Kctd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387975 GeneID:330171 MGI:2141207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 10 transcript_id : NM_026145.3

name	Ube3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68533241 GeneID:117146 MGI:1891295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin protein ligase E3B transcript_id : NM_054093.2

name	Mmab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373343 GeneID:77697 MGI:1924947
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methylmalonic aciduria (cobalamin deficiency) type B homolog (human) transcript_id : NM_029956.3

name	Mvk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980640 GeneID:17855 MGI:107624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mevalonate kinase transcript_id : NM_023556.2

name	BC057022 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921354 GeneID:433940 MGI:3605543
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057022 transcript_id : NM_001004180.1

name	Trpv4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11528501 GeneID:63873 MGI:1926945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 4 transcript_id : NM_022017.1

name	Gltp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560403 GeneID:56356 MGI:1929253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycolipid transfer protein transcript_id : NM_019821.2

name	Tchp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794203 GeneID:77832 MGI:1925082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trichoplein, keratin filament binding transcript_id : NM_029992.1

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517289 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_001077359.1

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517296 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_019834.3

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517294 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_001077360.1

name	Ankrd13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61651674 GeneID:68420 MGI:1915670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 13a transcript_id : NM_026718.2

name	Myo18b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254133 GeneID:74376 MGI:1921626
definition	codon_start : 1 product : myosin XVIIIb protein_id : XP_995297.2

name	Adrbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78711830 CCDS:CCDS19545.1 GeneID:320129 MGI:87941
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0047696 - beta-adrenergic receptor kinase activity [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; beta ARK2 product : adrenergic receptor kinase, beta 2 isoform 1 protein_id : NP_796052.2

name	Adrbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78711828 GeneID:320129 MGI:87941
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0047696 - beta-adrenergic receptor kinase activity [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; beta ARK2 product : adrenergic receptor kinase, beta 2 isoform 2 protein_id : NP_001030608.1

name	Crybb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681035 CCDS:CCDS19546.1 GeneID:12961 MGI:88519
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0005212 - structural constituent of eye lens [Evidence IDA] GO_process : GO:0007423 - sensory organ development [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 function : structural protein note : betaB2-crystallin; Philly cataract product : crystallin, beta B2 protein_id : NP_031799.1

name	LOC100042920 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254171 GeneID:100042920
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479519.1

name	Crybb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946674 CCDS:CCDS19547.1 GeneID:12962 MGI:102717
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IEA] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 product : crystallin, beta B3 protein_id : NP_067327.1

name	2900026A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370348 GeneID:243219 MGI:1920194
definition	codon_start : 1 product : hypothetical protein LOC243219 protein_id : NP_766472.1

name	Gm854 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701931 CCDS:CCDS19548.1 GeneID:333048 MGI:2685700
definition	codon_start : 1 product : hypothetical protein LOC333048 protein_id : NP_001028600.1

name	Rutbc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370044 GeneID:52850 MGI:107320
definition	codon_start : 1 exception : mismatches in translation product : RUN and TBC1 domain containing 2 protein_id : NP_766306.1

name	Aym1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60678284 GeneID:503692 MGI:1891321
definition	GO_component : GO:0043080 - female germ cell nucleus (sensu Metazoa) [Evidence IDA]; GO:0043081 - male germ cell nucleus (sensu Metazoa) [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : activator of yeast meiotic promoters 1 protein_id : NP_001012744.1

name	C530024P05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893385 CCDS:CCDS19550.1 GeneID:320916 MGI:2445030
definition	codon_start : 1 product : hypothetical protein LOC320916 protein_id : NP_796266.1

name	Cmklr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469077 CCDS:CCDS19551.1 GeneID:14747 MGI:109603
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004944 - C5a anaphylatoxin receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemerin receptor; G-protein coupled receptor 27 product : chemokine-like receptor 1 protein_id : NP_032179.1

name	LOC381707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254533 GeneID:381707
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472024.1

name	D5Ertd40e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58082051 GeneID:231630 MGI:1098550
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : huntingtin interacting protein E product : huntingtin interactor protein E protein_id : NP_001010825.1

name	Sart3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394239 CCDS:CCDS19552.1 GeneID:53890 MGI:1858230
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] codon_start : 1 product : squamous cell carcinoma antigen recognized by T-cells 3 protein_id : NP_058622.1

name	LOC100041786 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254566 GeneID:100041786
definition	codon_start : 1 product : similar to 40S ribosomal protein S28 protein_id : XP_001478356.1

name	Iscu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313484 CCDS:CCDS19553.1 GeneID:66383 MGI:1913633
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : NifU-like N-terminal domain containing product : nitrogen fixation cluster-like protein_id : NP_079802.1

name	Tmem119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122697 CCDS:CCDS19554.1 GeneID:231633 MGI:2385228
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC231633 protein_id : NP_666274.1

name	Selplg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982019 GeneID:20345 MGI:106689
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : selectin, platelet (p-selectin) ligand protein_id : NP_033177.2

name	Coro1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542413 CCDS:CCDS19555.1 GeneID:23790 MGI:1345964
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0000147 - actin cortical patch assembly [Evidence TAS]; GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS]; GO:0006909 - phagocytosis [Evidence TAS] codon_start : 1 note : coronin 1c; coronin 3 product : coronin, actin binding protein 1C protein_id : NP_035909.2

name	Ssh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271413 CCDS:CCDS19556.1 GeneID:231637 MGI:2686240
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : slingshot 1L; slingshot-like 1 product : slingshot homolog 1 protein_id : NP_932777.2

name	Dao1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815857 CCDS:CCDS19557.1 GeneID:13142 MGI:94859
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003884 - D-amino-acid oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : D-amino acid oxidase 1 protein_id : NP_034148.2

name	Svop (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72534843 GeneID:68666 MGI:1915916
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015075 - ion transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 product : SV2 related protein protein_id : NP_081081.1

name	Usp30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986575 CCDS:CCDS19558.1 GeneID:100756 MGI:2140991
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 30 protein_id : NP_001028374.1

name	Alkbh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098162 CCDS:CCDS19559.1 GeneID:231642 MGI:2141032
definition	GO_function : GO:0051747 - DNA demethylase activity [Evidence IDA]; GO:0004519 - endonuclease activity [Evidence IDA]; GO:0004527 - exonuclease activity [Evidence IDA] codon_start : 1 product : alkB, alkylation repair homolog 2 protein_id : NP_778181.2

name	Ung (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:101943608 GeneID:22256 MGI:109352
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004844 - uracil DNA N-glycosylase activity [Evidence IDA] [Evidence IMP]; GO:0045437 - uridine nucleosidase activity [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006281 - DNA repair [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0016446 - somatic hypermutation of immunoglobulin genes [Evidence IGI]; GO:0016447 - somatic recombination of immunoglobulin gene segments [Evidence IMP] [Evidence IGI] codon_start : 1 note : isoform a is encoded by transcript variant 1; uracil-DNA glycosylase product : uracil DNA glycosylase isoform a protein_id : NP_001035781.1

name	Ung (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:101943421 CCDS:CCDS19560.1 GeneID:22256 MGI:109352
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004844 - uracil DNA N-glycosylase activity [Evidence IDA] [Evidence IMP]; GO:0045437 - uridine nucleosidase activity [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006281 - DNA repair [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0016446 - somatic hypermutation of immunoglobulin genes [Evidence IGI]; GO:0016447 - somatic recombination of immunoglobulin gene segments [Evidence IMP] [Evidence IGI] codon_start : 1 note : isoform b is encoded by transcript variant 2; uracil-DNA glycosylase product : uracil DNA glycosylase isoform b protein_id : NP_035807.2

name	Acacb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48976025 CCDS:CCDS19561.1 GeneID:100705 MGI:2140940
definition	GO_function : GO:0003989 - acetyl-CoA carboxylase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0009374 - biotin binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acetyl-Coenzyme A carboxylase beta protein_id : NP_598665.1

name	Foxn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91598891 CCDS:CCDS19562.1 GeneID:116810 MGI:2151057
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead box N4 protein_id : NP_683737.2

name	Myo1h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254535 GeneID:231646 MGI:1914674
definition	codon_start : 1 product : myosin 1H protein_id : XP_977982.2

name	Kctd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29725637 CCDS:CCDS19563.1 GeneID:330171 MGI:2141207
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel tetramerization domain-containing 10 protein_id : NP_080421.2

name	Ube3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68533242 CCDS:CCDS19564.1 GeneID:117146 MGI:1891295
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] codon_start : 1 product : ubiquitin protein ligase E3B protein_id : NP_473434.2

name	Mmab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313396 CCDS:CCDS19565.1 GeneID:77697 MGI:1924947
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0008817 - cob(I)yrinic acid a,c-diamide adenosyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ATP:Cob(I)alamin Adenosyltransferase product : methylmalonic aciduria (cobalamin deficiency) type B homolog protein_id : NP_084232.1

name	Mvk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963731 CCDS:CCDS19566.1 GeneID:17855 MGI:107624
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004496 - mevalonate kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008299 - isoprenoid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 product : mevalonate kinase protein_id : NP_076045.1

name	BC057022 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921355 CCDS:CCDS19567.1 GeneID:433940 MGI:3605543
definition	codon_start : 1 product : hypothetical protein LOC433940 protein_id : NP_001004180.1

name	Trpv4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528502 CCDS:CCDS19568.1 GeneID:63873 MGI:1926945
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] [Evidence ISS]; GO:0005034 - osmosensor activity [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0042538 - hyperosmotic salinity response [Evidence IMP]; GO:0007231 - osmosensory signaling pathway [Evidence IMP] [Evidence ISS] [Evidence IDA]; GO:0006884 - regulation of cell volume [Evidence ISS]; GO:0047484 - regulation of response to osmotic stress [Evidence IMP]; GO:0009612 - response to mechanical stimulus [Evidence ISS]; GO:0006970 - response to osmotic stress [Evidence IPI] [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0030103 - vasopressin secretion [Evidence IMP] codon_start : 1 exception : mismatches in translation note : osmosensitive transient receptor potential channel 4 product : transient receptor potential cation channel, subfamily V, member 4 protein_id : NP_071300.1

name	Gltp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560404 CCDS:CCDS19569.1 GeneID:56356 MGI:1929253
definition	GO_component : GO:0016020 - membrane [Evidence ISS] GO_function : GO:0051861 - glycolipid binding [Evidence ISS]; GO:0017089 - glycolipid transporter activity [Evidence ISS] GO_process : GO:0046836 - glycolipid transport [Evidence ISS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : glycolipid transfer protein protein_id : NP_062795.2

name	Tchp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794204 GeneID:77832 MGI:1925082
definition	GO_component : GO:0045179 - apical cortex [Evidence ISS]; GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence ISS] codon_start : 1 product : trichoplein, keratin filament binding protein_id : NP_084268.1

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517297 CCDS:CCDS19570.1 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 1 protein_id : NP_062808.3

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517295 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 3 protein_id : NP_001070828.1

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517290 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 2 protein_id : NP_001070827.1

name	Ankrd13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61651675 CCDS:CCDS19572.1 GeneID:68420 MGI:1915670
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat domain 13a protein_id : NP_080994.2

name	4930515G01Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254529 GeneID:67642 MGI:1914892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930515G01 gene transcript_id : XR_035133.1

clone name	MSMg01-327E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-268D19.b	B6Ng01-268D19.g
ACC	GA071147	GA071148
length	1,126	334
definition	B6Ng01-268D19.b	B6Ng01-268D19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(114,057,255 - 114,058,374)	(114,232,442 - 114,232,781)
sequence	ggctgggaagctggtggtccctgtggtgagagtgggaagggaccagagag ctcactccccttgttctccatcactacttcagttcctgcctcccctctag tggtcattcacaagggttgaggagagaggagccattgggtcagacctctc cctagtctgagaatttggggctggaagggagttgctggcgggcaggcatt gcattccagattcagtctgtactccactcccatcccagaatggagtctta tctctccaccaacaagcctttctccccactcagccttgggacctggctca cttaacaggaaacagaatgtgtactgagagaggaaagccatagcttggtt ccccaaagctaggattcccacaccgttgcagccagcacacagtatgggta ggattcccacaccgctgcagccagcacacggtttggtatgactgactcat caaaacaggattgctgccttctgctgagtccccagagcctaacaagcact caacccaaaccaacggacagtgtctgtatggctgccggtgtcttcttcct tatccataaagagaaggcatctaagtggggtgacttaggttgtatgctga tgtgttgctgtttctgaccacgtctcaccatacctggaaacccatcccta gtaaatccccccaggaaggcattggtacctgaccagagccttgtgctgta aacatctgctactgaccaagagccatcggatactatgggccaagcactta ggcctccagtccctgtttcctgcctccctgctccacagcccaacatttgg aatcaaaccagaaactcgctctgctccgttattcagatgcttgctgtaag aagccaagcatctgtgcggtggaaaccaggacacagagaagccttgggtc tgtctctcccagcacatctgggctgcagagcttcagggcgtcagggatcc tcccgcctgtgtgaggaccatccgcggccagcacagacccgatgcccact ttggagcagaggatgagcacagggaagtctgtgttcgagcccgtgcctgg cccagccttttaacagaatcctggtcttgaagagaatgagaaacaattag gccttgggggcggggcctgggggagg	tccggggaaggagagggcaccagtgtgagggggtggagggactgttgggg acataggtcctgatgcaggacagcatgaggaaagtcaggcctagagcacc cggccagggggactgaggccttgggtgggctaccccatgcctgtctctcc tctctgcctggttctgcattcttactccactgctccaggtgtgggcagag cccaggagtagcctcaagtgaacgccggcttgtggcatccactggagagt ctctttctggggaaaatgggtctgtattaatggtggcgatggggatgatg atggtgatggtgatgatgatgggtctggtgatgg
quality values	Open. Hide. 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 43 43 43 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 59 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 47 62 62 62 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 46 58 58 58 58 58 58 58 54 54 58 58 54 54 58 54 54 41 58 54 58 58 54 58 54 58 54 54 58 46 54 58 58 54 53 58 54 58 58 58 58 58 54 58 54 41 58 58 51 42 58 51 58 58 51 58 58 58 51 58 58 45 50 58 53 53 58 58 58 53 58 53 58 58 54 51 54 58 51 49 51 50 58 51 51 53 58 58 50 40 44 46 54 51 58 58 51 58 58 58 58 51 41 58 40 41 58 37 58 58 54 52 41 44 51 58 54 51 50 58 53 52 50 49 50 50 58 49 43 40 58 25 41 58 47 39 46 50 39 33 40 54 41 33 35 51 42 41 58 30 44 51 38 51 49 40 51 49 50 50 49 50 54 51 35 34 51 42 50 51 52 51 49 41 51 54 50 40 39 52 54 31 44 22 44 50 32 53 47 19 39 44 23 32 39 35 41 40 47 49 51 39 41 26 49 52 53 42 41 37 51 32 37 51 33 33 39 52 53 35 39 53 39 54 51 27 51 52 54 42 26 36 40 53 37 54 46 31 54 36 29 53 40 42 45 34 26 45 40 32 51 47 32 29 25 18 32 40 53 53 51 29 47 32 31 32 31 47 33 16 25 29 28 53 52 45 31 45 31 31 30 42 45 30 32 30 43 31 38 22 26 31 31 26 27 31 35 18 30 28 43 33 16 18 30 31 42 45 31 31 32 22 46 22 31 18 29 24 33 31 30 30 43 31 40 36 31 31 31 30 46 25 31 23 21 40 11 12 26 25 31 11 39 28 32 28 22 14 22 17 37 46 22 31 25 26 30 31 46 24 30 32 31 31 34 30 28 31 31 26 37 19 24 27 31 21 31 31 27 22 31 32 47 24 16 30 31 32 24 20 33 8 29 35 19 28 13 11 41 15 7 16 32 35 31 17 43 24 5 14 18 30 30 32 29 31 16 7 14 32 15 13 16 31 27 38 15 30 30 14 21 21 33 18 31 13 11 28 17 22 30 27 32 32 23 31 24 21 32 22 32 33 19 16 21 30 20 33 22 20 19 19 43 29 28 21 29 9 21 20 5 5 4 4 31 32 14 26 7 19 22 20 18 9 34 7 21 15 17 27 22 19 13 6 6 3 8 8 11 14 7 3 30 10 14 11 9 21 21 10 7 5 9 26 7 27 9 13 12 9 28 30 10 18 17 13 22 9 13 21 5 7 9 19 7 19 4 7 8 5 3 3 9 9 6 6 4 6 6 14 22 6 15 10 6 7 9 8 4 5 4 28 14 4 7 16 6 23 27 20 25 6 6 7 7 29 20 6 7 19 21 25 26 13 5 7 4 6	Open. Hide. 62 62 62 62 62 56 51 59 45 23 38 33 38 59 50 62 59 59 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 59 49 62 62 59 50 62 62 62 54 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 59 59 59 62 62 62 54 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 49 40 45 46 43 50 28 23 27 11 17 27 37 18 34 30 18 27 23

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_114057255_114058374
seq2: B6Ng01-268D19.b_57_1182

seq1  GGCTGGGAAGCTGGTGGTCCCTGTGGTGAGAGTGGGAAGGGACCAGAGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGGGAAGCTGGTGGTCCCTGTGGTGAGAGTGGGAAGGGACCAGAGAG  50

seq1  CTCACTCCCCTTGTTCTCCATCACTACTTCAGTTCCTGCCTCCCCTCTAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTCCCCTTGTTCTCCATCACTACTTCAGTTCCTGCCTCCCCTCTAG  100

seq1  TGGTCATTCACAAGGGTTGAGGAGAGAGGAGCCATTGGGTCAGACCTCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCATTCACAAGGGTTGAGGAGAGAGGAGCCATTGGGTCAGACCTCTC  150

seq1  CCTAGTCTGAGAATTTGGGGCTGGAAGGGAGTTGCTGGCGGGCAGGCATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGTCTGAGAATTTGGGGCTGGAAGGGAGTTGCTGGCGGGCAGGCATT  200

seq1  GCATTCCAGATTCAGTCTGTACTCCACTCCCATCCCAGAATGGAGTCTTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTCCAGATTCAGTCTGTACTCCACTCCCATCCCAGAATGGAGTCTTA  250

seq1  TCTCTCCACCAACAAGCCTTTCTCCCCACTCAGCCTTGGGACCTGGCTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCCACCAACAAGCCTTTCTCCCCACTCAGCCTTGGGACCTGGCTCA  300

seq1  CTTAACAGGAAACAGAATGTGTACTGAGAGAGGAAAGCCATAGCTTGGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAACAGGAAACAGAATGTGTACTGAGAGAGGAAAGCCATAGCTTGGTT  350

seq1  CCCCAAAGCTAGGATTCCCACACCGTTGCAGCCAGCACACAGTATGGGTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAAAGCTAGGATTCCCACACCGTTGCAGCCAGCACACAGTATGGGTA  400

seq1  GGATTCCCACACCGCTGCAGCCAGCACACGGTTTGGTATGACTGACTCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATTCCCACACCGCTGCAGCCAGCACACGGTTTGGTATGACTGACTCAT  450

seq1  CAAAACAGGATTGCTGCCTTCTGCTGAGTCCCCAGAGCCTAACAAGCACT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACAGGATTGCTGCCTTCTGCTGAGTCCCCAGAGCCTAACAAGCACT  500

seq1  CAACCCAAACCAACGGACAGTGTCTGTATGGCTGCCGGTGTCTTCTTCCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCCAAACCAACGGACAGTGTCTGTATGGCTGCCGGTGTCTTCTTCCT  550

seq1  TATCCATAAAGAGAAGGCATCTAAGTGGGGTGACTTAGGTTGTATGCTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCCATAAAGAGAAGGCATCTAAGTGGGGTGACTTAGGTTGTATGCTGA  600

seq1  TGTGTTGCTGTTTCTGACCACGTCTCACCATACCTGGAAACCCATCCCTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTTGCTGTTTCTGACCACGTCTCACCATACCTGGAAACCCATCCCTA  650

seq1  GTAAATCCCCCCAGGAAGGCATTGGTACCTGACCAGAGCCTTGTGCTGTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAATCCCCCCAGGAAGGCATTGGTACCTGACCAGAGCCTTGTGCTGTA  700

seq1  AACATCTGCTACTGACCAAGAGCCATCGGATACTATGGGCCAAGCACTTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATCTGCTACTGACCAAGAGCCATCGGATACTATGGGCCAAGCACTTA  750

seq1  GGCCTCCAGTCCCTGTTTCCTGCCTCCCTGCTCCACAGCCCAACATTTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTCCAGTCCCTGTTTCCTGCCTCCCTGCTCCACAGCCCAACATTTGG  800

seq1  AATCAAACCAGAAACTCGCTCTGCTCCGTTATTCAGATGCTTGCTGTAAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAAACCAGAAACTCGCTCTGCTCCGTTATTCAGATGCTTGCTGTAAG  850

seq1  AAGCCAAGCATCTGTGCGGTGGAAACCAGGACACAGAGAAGCCTTGGGTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCAAGCATCTGTGCGGTGGAAACCAGGACACAGAGAAGCCTTGGGTC  900

seq1  TGTCTCTCCCAGCACATCTGGGCTGCAGAGCTTCAGGGCGTCAGGGATCC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTCCCAGCACATCTGGGCTGCAGAGCTTCAGGGCGTCAGGGATCC  950

seq1  TCCCGCCTGTGTGAGGACCATCCGCGGCCAGCACAGACCCGATGCCCACT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCGCCTGTGTGAGGACCATCCGCGGCCAGCACAGACCCGATGCCCACT  1000

seq1  TTGGAGCAGAAGGATGAGCACA-GGAAGTCTGTGGTCGAGGCCGTGCCT-  1048
      ||||||||| |||||||||||| ||||||||||| ||||| |||||||| 
seq2  TTGGAGCAG-AGGATGAGCACAGGGAAGTCTGTGTTCGAGCCCGTGCCTG  1049

seq1  GCCAAGCC-TTTAACAGAATCCTGGTCTGGAAGAG-ATGAGAAACAA-TA  1095
      ||| |||| ||||||||||||||||||| |||||| ||||||||||| ||
seq2  GCCCAGCCTTTTAACAGAATCCTGGTCTTGAAGAGAATGAGAAACAATTA  1099

seq1  GGGCT--GGGGCGGGGCTGGGGAGAGG  1120
      || ||  ||||||||||  ||| ||||
seq2  GGCCTTGGGGGCGGGGCCTGGGGGAGG  1126

seq1: chr5_114232442_114232781
seq2: B6Ng01-268D19.g_67_406 (reverse)

seq1  CCATCACCATACCCATCATCATCACCATCACCATCATCATCCCCATCGCC  50
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  CCATCACCAGACCCATCATCATCACCATCACCATCATCATCCCCATCGCC  50

seq1  ACCATTAATACAGACCCATTTTCCCCAGAAAGAGACTCTCCAGTGGATGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATTAATACAGACCCATTTTCCCCAGAAAGAGACTCTCCAGTGGATGC  100

seq1  CACAAGCCGGCGTTCACTTGAGGCTACTCCTGGGCTCTGCCCACACCTGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAGCCGGCGTTCACTTGAGGCTACTCCTGGGCTCTGCCCACACCTGG  150

seq1  AGCAGTGGAGTAAGAATGCAGAACCAGGCAGAGAGGAGAGACAGGCATGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGTGGAGTAAGAATGCAGAACCAGGCAGAGAGGAGAGACAGGCATGG  200

seq1  GGTAGCCCACCCAAGGCCTCAGTCCCCCTGGCCGGGTGCTCTAGGCCTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGCCCACCCAAGGCCTCAGTCCCCCTGGCCGGGTGCTCTAGGCCTGA  250

seq1  CTTTCCTCATGCTGTCCTGCATCAGGACCTATGTCCCCAACAGTCCCTCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCTCATGCTGTCCTGCATCAGGACCTATGTCCCCAACAGTCCCTCC  300

seq1  ACCCCCTCACACTGGTGCCCTCTCCTTCCCCGGAGAATTC  340
      ||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCCTCACACTGGTGCCCTCTCCTTCCCCGGAGAATTC  340

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information