MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-271O09
Chromosome	5 (Build37)
Map Location	110,323,096 - 110,345,399
singlet/doublet	doublet
Overlap gene	none
Upstream gene	EG667087, LOC100041615, V2r16, LOC545792, EG384219, Vmn2r12, LOC231589, EG231591, LOC667128, EG211223, EG384220, EG636052, EG384221, LOC667159, LOC667171, Tpte2, EG667185, LOC671695, LOC636173, LOC624831, LOC100041734, LOC100042749, LOC667198, 4930522L14Rik
Downstream gene	LOC667243, Plcxd1, Gtpbp6, LOC675812, Chfr, Golga3, D5Ertd585e, Pgam5, Pxmp2, Pole, P2rx2, Gm1679, 2410025L10Rik, Galnt9, Noc4l, Ddx51, Ep400, Pus1, Ulk1, Hscb, Chek2, Ttc28
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG667087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667087 MGI:3647958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041615 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	V2r16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22307 MGI:1316730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545792 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 4 Proteins pseudo : _no_value

name	EG384219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384219 MGI:3643806
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	Vmn2r12 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	LOC231589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:231589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	EG231591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231591 MGI:3649151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins

name	LOC667128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG211223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211223 MGI:3649165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins

name	EG384220 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384220 MGI:3647194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	EG636052 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636052 MGI:3649028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG384221 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384221 MGI:3647193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC667159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC667171 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Tpte2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57914 MGI:1889506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667185 MGI:3646443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC671695 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC636173 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC624831 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 58 ESTs

name	LOC100041734 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC667198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 185 ESTs, 6 Proteins pseudo : _no_value

name	4930522L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78020 MGI:1925270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Plcxd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403178 MGI:2685422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtpbp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107999 MGI:1306825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins

name	Chfr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231600 MGI:2444898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golga3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269682 MGI:96958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D5Ertd585e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71782 MGI:1261856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgam5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72542 MGI:1919792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pxmp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19301 MGI:107487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pole (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18973 MGI:1196391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231602 MGI:2665170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1679 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381667 MGI:2686525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410025L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381668 MGI:1920907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galnt9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231605 MGI:2677965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Noc4l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100608 MGI:2140843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69663 MGI:1916913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ep400 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75560 MGI:1276124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pus1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56361 MGI:1929237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ulk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22241 MGI:1270126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hscb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100900 MGI:2141135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chek2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50883 MGI:1355321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209683 MGI:2140873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 192 ESTs, 1 Protein

name	LOC100041615 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254119 GeneID:100041615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100041615 transcript_id : XM_001476691.1

name	V2r16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529455 GeneID:22307 MGI:1316730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 16 transcript_id : NM_009491.2

name	EG384219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375092 GeneID:384219 MGI:3643806
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG384219 transcript_id : XM_621684.3

name	EG231591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82899096 GeneID:231591 MGI:3649151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins product : predicted gene, EG231591, transcript variant 1 transcript_id : XM_621686.2

name	EG211223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82899211 GeneID:211223 MGI:3649165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins product : predicted gene, EG211223 transcript_id : XM_142477.3

name	EG384220 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51711189 GeneID:384220 MGI:3647194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : predicted gene, EG384220 transcript_id : XM_357498.2

name	EG636052 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254162 GeneID:636052 MGI:3649028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG636052 transcript_id : XM_001479107.1

name	Tpte2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802359 GeneID:57914 MGI:1889506
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 transcript_id : NM_016715.3

name	LOC624831 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254164 GeneID:624831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 58 ESTs product : similar to LOC635138 protein transcript_id : XM_898489.3

name	LOC100041734 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254123 GeneID:100041734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001476915.1

name	LOC100042749 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254166 GeneID:100042749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042749 transcript_id : XM_001479149.1

name	Plcxd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402312 GeneID:403178 MGI:2685422
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-specific phospholipase C, X domain containing 1 transcript_id : NM_207279.1

name	Gtpbp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365016 GeneID:107999 MGI:1306825
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 6 (putative) transcript_id : NM_145147.3

name	LOC675812 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254168 GeneID:675812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins product : similar to zinc finger protein 605 transcript_id : XM_001479199.1

name	Chfr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377331 GeneID:231600 MGI:2444898
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : checkpoint with forkhead and ring finger domains transcript_id : NM_172717.2

name	Golga3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982329 GeneID:269682 MGI:96958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi autoantigen, golgin subfamily a, 3 transcript_id : NM_008146.3

name	D5Ertd585e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789238 GeneID:71782 MGI:1261856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 585, expressed transcript_id : NM_027922.1

name	Pgam5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349845 GeneID:72542 MGI:1919792
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoglycerate mutase family member 5 transcript_id : NM_028273.2

name	Pxmp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421057 GeneID:19301 MGI:107487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal membrane protein 2 transcript_id : NM_008993.2

name	Pole (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755123 GeneID:18973 MGI:1196391
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), epsilon transcript_id : NM_011132.1

name	P2rx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354790 GeneID:231602 MGI:2665170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 2 transcript_id : NM_153400.3

name	Gm1679 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371683 GeneID:381667 MGI:2686525
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1679, (NCBI) transcript_id : NM_001033459.2

name	2410025L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347475 GeneID:381668 MGI:1920907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410025L10 gene transcript_id : NM_028596.2

name	Galnt9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38142485 GeneID:231605 MGI:2677965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 transcript_id : NM_198306.1

name	Noc4l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981993 GeneID:100608 MGI:2140843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar complex associated 4 homolog (S. cerevisiae) transcript_id : NM_153570.2

name	Ddx51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538824 GeneID:69663 MGI:1916913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 transcript_id : NM_027156.2

name	Ep400 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414492 GeneID:75560 MGI:1276124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E1A binding protein p400 transcript_id : NM_029337.1

name	Pus1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982769 GeneID:56361 MGI:1929237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pseudouridine synthase 1 transcript_id : NM_001025562.2

name	Pus1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982773 GeneID:56361 MGI:1929237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pseudouridine synthase 1 transcript_id : NM_019700.4

name	Pus1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982763 GeneID:56361 MGI:1929237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pseudouridine synthase 1 transcript_id : NM_001025561.2

name	Ulk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254401 GeneID:22241 MGI:1270126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Unc-51 like kinase 1 (C. elegans) transcript_id : NM_009469.3

name	Hscb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956361 GeneID:100900 MGI:2141135
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HscB iron-sulfur cluster co-chaperone homolog (E. coli) transcript_id : NM_153571.1

name	Chek2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377787 GeneID:50883 MGI:1355321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CHK2 checkpoint homolog (S. pombe) transcript_id : NM_016681.3

name	Ttc28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254130 GeneID:209683 MGI:2140873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 192 ESTs, 1 Protein product : tetratricopeptide repeat domain 28 transcript_id : XM_001481308.1

name	LOC100041615 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254120 GeneID:100041615
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476741.1

name	V2r16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529456 GeneID:22307 MGI:1316730
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 16 product : vomeronasal 2, receptor, 16 protein_id : NP_033517.2

name	EG384219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375093 GeneID:384219 MGI:3643806
definition	codon_start : 1 product : similar to predicted gene, EG623734 protein_id : XP_621684.3

name	EG231591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899097 GeneID:231591 MGI:3649151
definition	codon_start : 1 product : similar to predicted gene, EG623734 isoform 1 protein_id : XP_621686.2

name	EG211223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899212 GeneID:211223 MGI:3649165
definition	codon_start : 1 product : similar to predicted gene, EG623734 protein_id : XP_142477.3

name	EG384220 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51711190 GeneID:384220 MGI:3647194
definition	codon_start : 1 product : similar to predicted gene, EG623734 protein_id : XP_357498.2

name	EG636052 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254163 GeneID:636052 MGI:3649028
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001479157.1

name	Tpte2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980663 CCDS:CCDS19521.1 GeneID:57914 MGI:1889506
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : lymphocyte antigen 114; delta 1 product : thymic stromal-derived lymphopoietin, receptor protein_id : NP_057924.2

name	LOC624831 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375045 GeneID:624831
definition	codon_start : 1 product : similar to LOC635138 protein protein_id : XP_903582.2

name	LOC100041734 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254124 GeneID:100041734
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476965.1

name	LOC100042749 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254167 GeneID:100042749
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479199.1

name	Plcxd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402313 GeneID:403178 MGI:2685422
definition	GO_function : GO:0004629 - phospholipase C activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : phosphatidylinositol-specific phospholipase C, X domain containing 1 protein_id : NP_997162.1

name	Gtpbp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956274 GeneID:107999 MGI:1306825
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : pseudoautosomal GTP binding protein-like, like product : GTP binding protein 6 (putative) protein_id : NP_660129.1

name	LOC675812 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254169 GeneID:675812
definition	codon_start : 1 product : similar to zinc finger protein 605 protein_id : XP_001479249.1

name	Chfr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370050 CCDS:CCDS19522.1 GeneID:231600 MGI:2444898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000278 - mitotic cell cycle [Evidence IMP]; GO:0000209 - protein polyubiquitination [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : checkpoint with forkhead and ring finger domains protein_id : NP_766305.1

name	Golga3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982330 GeneID:269682 MGI:96958
definition	GO_component : GO:0005793 - ER-Golgi intermediate compartment [Evidence IDA]; GO:0000139 - Golgi membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : Mea2/Golga3 product : Golgi autoantigen, golgin subfamily a, 3 protein_id : NP_032172.3

name	D5Ertd585e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789239 GeneID:71782 MGI:1261856
definition	codon_start : 1 product : hypothetical protein LOC71782 protein_id : NP_082198.1

name	Pgam5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037293 CCDS:CCDS19523.1 GeneID:72542 MGI:1919792
definition	codon_start : 1 exception : mismatches in translation product : phosphoglycerate mutase family member 5 protein_id : NP_082549.1

name	Pxmp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421058 CCDS:CCDS19524.1 GeneID:19301 MGI:107487
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 note : peroxisomal membrane protein 2, 22 kDa product : peroxisomal membrane protein 2 protein_id : NP_033019.2

name	Pole (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755124 CCDS:CCDS19525.1 GeneID:18973 MGI:1196391
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : DNA polymerase epsilon; pol-epsilon product : DNA polymerase epsilon catalytic subunit protein_id : NP_035262.1

name	P2rx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544935 GeneID:231602 MGI:2665170
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004931 - ATP-gated cation channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : purinergic receptor P2X, ligand-gated ion channel, 2 protein_id : NP_700449.2

name	Gm1679 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701975 GeneID:381667 MGI:2686525
definition	codon_start : 1 product : hypothetical protein LOC381667 protein_id : NP_001028631.1

name	2410025L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347476 GeneID:381668 MGI:1920907
definition	codon_start : 1 product : hypothetical protein LOC381668 protein_id : NP_082872.2

name	Galnt9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38142486 GeneID:231605 MGI:2677965
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 protein_id : NP_938048.1

name	Noc4l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981994 CCDS:CCDS19527.1 GeneID:100608 MGI:2140843
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005732 - small nucleolar ribonucleoprotein complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0030515 - snoRNA binding [Evidence ISS] GO_process : GO:0006365 - 35S primary transcript processing [Evidence ISS] codon_start : 1 product : nucleolar complex associated 4 homolog protein_id : NP_705798.2

name	Ddx51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538825 CCDS:CCDS19528.1 GeneID:69663 MGI:1916913
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 protein_id : NP_081432.2

name	Ep400 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414493 CCDS:CCDS19529.1 GeneID:75560 MGI:1276124
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Domino protein_id : NP_083613.1

name	Pus1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70906470 CCDS:CCDS19531.1 GeneID:56361 MGI:1929237
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004730 - pseudouridylate synthase activity [Evidence IEA]; GO:0016439 - tRNA-pseudouridine synthase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0008033 - tRNA processing [Evidence IEA]; GO:0031119 - tRNA pseudouridine synthesis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : pseudouridine synthase 1 isoform 2 protein_id : NP_062674.2

name	Pus1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70906468 CCDS:CCDS19530.1 GeneID:56361 MGI:1929237
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004730 - pseudouridylate synthase activity [Evidence IEA]; GO:0016439 - tRNA-pseudouridine synthase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0008033 - tRNA processing [Evidence IEA]; GO:0031119 - tRNA pseudouridine synthesis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : pseudouridine synthase 1 isoform 1 protein_id : NP_001020732.1

name	Pus1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70906472 GeneID:56361 MGI:1929237
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004730 - pseudouridylate synthase activity [Evidence IEA]; GO:0016439 - tRNA-pseudouridine synthase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0008033 - tRNA processing [Evidence IEA]; GO:0031119 - tRNA pseudouridine synthesis [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : pseudouridine synthase 1 isoform 3 protein_id : NP_001020733.1

name	Ulk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254402 CCDS:CCDS19532.1 GeneID:22241 MGI:1270126
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007265 - Ras protein signal transduction [Evidence IDA] codon_start : 1 product : Unc-51 like kinase 1 protein_id : NP_033495.2

name	Hscb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956362 GeneID:100900 MGI:2141135
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0051087 - chaperone binding [Evidence IEA]; GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : J-type co-chaperone HSC20 protein_id : NP_705799.1

name	Chek2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710088 CCDS:CCDS19533.1 GeneID:50883 MGI:1355321
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : protein kinase Chk2; Cds1 homolog; Rad53 homolog product : CHK2 checkpoint homolog protein_id : NP_057890.1

name	Ttc28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254131 GeneID:209683 MGI:2140873
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : similar to OTTHUMP00000028696 protein_id : XP_001481358.1 transl_except : (pos:111706166..111706168,aa:OTHER) transl_except : (pos:111706175..111706177,aa:OTHER) transl_except : (pos:111706232..111706234,aa:OTHER) transl_except : (pos:111707515..111707517,aa:OTHER) transl_except : (pos:111709188..111709190,aa:OTHER) transl_except : (pos:111710905..111710907,aa:OTHER) transl_except : (pos:111711823..111711825,aa:OTHER) transl_except : (pos:111711901..111711903,aa:OTHER) transl_except : (pos:111712969..111712971,aa:OTHER) transl_except : (pos:111712978..111712980,aa:OTHER) transl_except : (pos:111713014..111713016,aa:OTHER) transl_except : (pos:111713023..111713025,aa:OTHER) transl_except : (pos:111714019..111714021,aa:OTHER) transl_except : (pos:111714265..111714267,aa:OTHER) transl_except : (pos:111714268..111714270,aa:OTHER) transl_except : (pos:111714493..111714495,aa:OTHER) transl_except : (pos:111714598..111714600,aa:OTHER) transl_except : (pos:111714775..111714777,aa:OTHER) transl_except : (pos:111715003..111715005,aa:OTHER) transl_except : (pos:111715171..111715173,aa:OTHER) transl_except : (pos:111715183..111715185,aa:OTHER) transl_except : (pos:111715393..111715395,aa:OTHER)

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 1 pseudo : _no_value

name	Vmn2r12 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627569
definition	number : 6 pseudo : _no_value

name	Vmn2r12 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627569
definition	number : 5 pseudo : _no_value

name	Vmn2r12 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627569
definition	number : 4 pseudo : _no_value

name	Vmn2r12 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627569
definition	number : 3 pseudo : _no_value

name	Vmn2r12 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627569
definition	number : 2 pseudo : _no_value

name	Vmn2r12 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627569
definition	number : 1 pseudo : _no_value

name	LOC231589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:231589
definition	number : 6 pseudo : _no_value

name	LOC231589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:231589
definition	number : 5 pseudo : _no_value

name	LOC231589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:231589
definition	number : 4 pseudo : _no_value

name	LOC231589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:231589
definition	number : 3 pseudo : _no_value

name	LOC231589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:231589
definition	number : 2 pseudo : _no_value

name	LOC231589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:231589
definition	number : 1 pseudo : _no_value

name	LOC667128 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667128
definition	number : 1 pseudo : _no_value

name	EG384221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384221
definition	number : 1 pseudo : _no_value

name	EG384221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384221
definition	number : 2 pseudo : _no_value

name	EG384221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384221
definition	number : 3 pseudo : _no_value

name	EG384221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384221
definition	number : 4 pseudo : _no_value

name	EG384221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384221
definition	number : 5 pseudo : _no_value

name	EG384221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384221
definition	number : 6 pseudo : _no_value

name	EG384221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384221
definition	number : 7 pseudo : _no_value

name	LOC667159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667159
definition	number : 2 pseudo : _no_value

name	LOC667159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667159
definition	number : 1 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 8 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 7 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 6 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 5 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 4 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 3 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 2 pseudo : _no_value

name	LOC667171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667171
definition	number : 1 pseudo : _no_value

name	EG667185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667185
definition	number : 2 pseudo : _no_value

name	EG667185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667185
definition	number : 1 pseudo : _no_value

name	LOC671695 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671695
definition	number : 2 pseudo : _no_value

name	LOC671695 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671695
definition	number : 1 pseudo : _no_value

name	LOC636173 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636173
definition	number : 2 pseudo : _no_value

name	LOC636173 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636173
definition	number : 1 pseudo : _no_value

name	LOC667243 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667243
definition	number : 1 pseudo : _no_value

name	LOC545792 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254161 GeneID:545792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 4 Proteins product : similar to survival motor neuron domain containing 1 pseudo : _no_value transcript_id : XR_034056.1

name	LOC667198 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254165 GeneID:667198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 185 ESTs, 6 Proteins product : similar to golgi autoantigen, golgin subfamily a, 7 pseudo : _no_value transcript_id : XR_034078.1

name	4930522L14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254125 GeneID:78020 MGI:1925270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : RIKEN cDNA 4930522L14 gene transcript_id : XR_035683.1

clone name	MSMg01-538H19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-133D21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-117N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-188D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-464P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291P11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336L15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-271O09.b	B6Ng01-271O09.g
ACC	GA073860	GA073861
length	951	1,104
definition	B6Ng01-271O09.b	B6Ng01-271O09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(110,344,857 - 110,345,399)	(110,323,096 - 110,324,125)
sequence	gaattctggggatgttggctcctgtacaaaacaactccattgttaggggt ggctaatagtgggactgtccaccagctaattactactcactctaacaagc tgtcagttcttatgactgtcattgtgcctgcactggctatttcttacctc acaacttgctaagtaagcatctttgagcagagacaatgagccagttaaat attggaaatacaccaaacaaggactggtctatttaacctacctcaaccga tttcctgattgttcagaaaccctgaagttttcaaagtgaactctgtgagt ctattctggtgtgatgctgcatacctataataatagcaatcaagaggcag aggcaggaggattgcaagcttgaggtcagcctgagctacatagtgatatg ctgtctcataaaatagaataaaaggaacagttcagaggcccacctgccct tagaactttcccacaccctcagtttgaatcccaggaaaacctaactaaga aggtccccaatatcaaattggtagtaccttagttggggtttctgtttttt gtttgtttgtttgtttgttgtttttcgagacagggtttctctgagtagcc ctggctgtcctggagctcactttgtaaaccaggttggcctcgaactcaga aattcacctgcctctgcctttcaagtgctgggattaaaggcgtgcgcaac cactgcccagcattagttggggtttctaatgtcatgaagagacaccacga acatagcaactcttataaagtaaagtatttagttagggctggcttacagt ttgtaggtttagtccattatcatcatggtggaagcacaatgccatgcagg cagacatggtgctggaaaggaagctgagacttctacatctggattagcag gcatcaaaaagagaaaggaagcaactaggcctggcttgagcatctgaaac t	gaattcacgcagttgaatccttctcaacagtctgttttacgggaacactt cattattatgacccgcagttctggttccggaatgagggatcttccctgcg ccggtgatggtaaccgtcccgggtcttctcgtcccgggtttcagcaccaa ctcttacacgcattcacgaccggccaggaagaacgcaacaaaccggaatc ttctgcggcaaaactttattgcttacatcttcaggagcaagagtgcaaga gagcaagagctctattgcttacatctttaggagccaaagcgcaagagtgc aagagcaaaagcaagagtgcaagcgctttattgcttacatcttcaggagc aagagagtaagagagagaatggcgaaaccccgtcccttttaaggagaatt attctccgcctaggacgtattactccttgattggctgcagcccatcggcc aagttgtcgtcacggggaaggcagagcacatggggtggaaaactaccctt ggcacatgcgcagattatttgtttaccacttagaacacaggatgtcagcg ccatcttgcaacggcgaatgtgagggcggctccccacaaattccgtttta aagaacagtatattttgtttgagagtaaagatgtgctagcccatgtctgc agtgctgtagagtccagatcagaggctccagctttgtccatgtcctgggc ctcatacacaacctcagccccactgcctccttctcagccgaccattaagg atggaagtggaaataaattacactatgaacatggcaaaccagaaattaat aatccttgtaaacaaatgaaaattcttataaaataaacaataattataat aagatgggatgatgataaaagactagttacatttgaataatgttcatact cttgaatccatgtactttttccaggtaagcccacctccgctatgtattga ttttgttctttctcccaagtcctctagacctcagatttcatatgaaagac tgaagaaaatgtcttgataatggtgtctggcattatttcacctgtcagtg tttctcattcttagtaatcagttagttttgaaaaactgacaataggtaga cttc
quality values	Open. Hide. 47 22 22 35 58 54 41 58 58 62 62 22 16 54 62 62 62 47 62 62 62 62 62 62 49 51 56 32 62 62 62 54 51 51 56 56 59 35 28 59 59 62 49 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 47 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 52 62 62 42 62 62 62 62 62 62 54 62 62 62 58 54 54 58 58 58 58 58 58 52 58 58 58 54 54 58 58 58 58 58 58 58 58 58 47 58 58 58 54 58 58 54 58 58 58 58 58 58 58 54 58 58 58 52 58 58 58 54 58 58 58 50 58 58 58 50 58 58 50 58 58 58 54 58 52 58 54 41 50 50 49 58 58 58 58 58 58 54 58 58 58 58 50 51 50 43 49 58 58 58 49 58 48 58 58 51 51 58 51 58 49 58 52 58 58 53 53 47 58 58 58 58 40 51 58 49 58 51 43 50 53 53 53 49 51 41 58 50 50 39 49 50 50 54 50 49 50 58 58 50 53 53 50 46 51 58 54 58 50 48 46 53 53 49 44 43 44 58 49 50 33 43 52 53 51 41 51 58 43 58 41 29 34 41 58 47 38 53 32 51 51 54 52 52 54 37 32 41 46 35 54 49 51 54 49 39 39 28 50 47 44 49 42 32 52 53 52 54 54 51 39 54 43 53 45 32 49 45 54 42 52 32 49 53 52 53 32 51 39 35 35 30 52 49 34 47 40 54 42 46 28 53 32 39 53 52 32 49 47 42 53 52 40 40 35 54 54 45 45 45 54 51 36 32 32 30 49 46 32 32 38 21 28 32 53 41 29 34 46 40 32 41 34 29 31 32 29 33 51 32 53 28 31 13 44 25 46 30 31 35 39 31 31 31 31 33 34 31 43 35 37 45 31 31 27 33 29 40 30 51 30 31 31 28 45 33 30 30 40 32 37 26 32 33 31 22 7 20 23 31 31 28 21 22 37 31 31 31 42 31 43 25 26 31 47 33 24 34 35 36 29 31 35 26 46 7 19 20 25 32 30 32 29 30 16 31 31 31 36 33 18 18 25 27 17 31 8 22 16 12 22 31 33 27 46 47 48 44 12 38 28 36 44 30 20 37 25 31 24 37 17 24 26 22 11 24 15 28 23 31 31 38 30 30 25 30 31 16 30 26 32 22 32 27 36 47 27 27 34	Open. Hide. 62 47 56 47 62 47 51 49 62 62 56 54 62 62 62 44 56 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 59 62 62 54 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 49 54 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 46 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 58 45 58 52 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 48 58 58 58 58 47 58 58 54 58 58 54 54 49 58 58 58 58 58 58 49 54 54 58 58 54 58 58 58 58 58 54 52 58 45 43 58 58 58 52 50 58 58 54 58 58 54 54 58 45 42 58 58 58 51 51 58 52 54 45 29 41 58 58 47 47 49 50 58 58 51 58 51 51 58 58 41 58 54 58 51 39 58 51 53 46 51 49 51 50 58 39 58 40 52 36 46 31 58 48 44 41 49 53 58 58 51 37 58 58 48 58 49 50 52 51 52 49 51 50 51 58 58 54 58 50 58 43 49 58 40 54 46 49 49 58 51 52 53 45 53 51 58 44 49 50 40 58 41 38 34 52 51 51 50 51 52 52 41 52 52 58 50 54 51 41 53 36 53 39 50 40 43 33 37 51 42 42 42 42 39 15 54 42 52 40 50 32 45 53 46 54 54 51 49 49 40 29 38 53 52 36 32 41 38 40 51 26 46 50 42 42 45 53 53 42 45 41 51 42 42 54 42 38 37 46 51 49 42 35 37 30 47 25 44 39 33 35 44 52 32 34 35 27 37 52 47 38 53 31 40 31 53 47 31 32 29 51 31 24 47 51 32 33 32 40 51 34 53 52 42 41 21 49 32 32 34 31 34 31 42 34 32 32 33 32 30 32 26 43 42 51 30 30 51 45 30 31 28 21 46 47 24 20 45 31 31 31 26 31 31 33 30 24 23 38 21 23 47 31 37 14 46 29 32 31 41 46 47 31 31 31 31 43 31 31 37 35 47 47 31 27 33 46 29 43 26 27 31 31 31 42 35 31 33 32 32 38 30 26 31 37 20 35 47 21 21 21 31 38 27 41 35 21 29 47 47 32 16 32 23 32 36 30 31 31 32 42 26 38 47 33 32 43 22 31 23 26 32 36 8 34 21 25 34 32 38 32 31 22 11 32 20 30 31 18 22 15 25 42 33 32 31 31 48 47 43 22 7 22 21 24 32 23 27 30 21 32 39 19 20 16 13 12 19 19 6 19 32 15 29 8 13 26 22 25 17 21 29 48 43 27 20 11 20 28 19 47 16 27 12 8 26 15 9 18 28 25 18 14 14 14 10 21 5 22 16 10 13 14 9 11 29 14 38 25 17 10 11 16 27 19 15 47 15 5 20 20 24 16 16 8 9 28 40 40 28 17 27 17 24 12 20 25 17 6 5 8 7 13 7 7 8 9 16 10 8 17 9 8 3 7 15 19 28 22 13 7 6 20 5 14 10 18 8 13 3 2 2 27 7 9 4 9 6 18 8 21 10 20 13 1 3 3 3 2 4 6 13 4 5 23 4 7 29 17 13 8 18 23 29 28 21 13 13 8 6 9 9 22 6 4 3 5 3 5 16 4 4 11 11 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_110344857_110345399
seq2: B6Ng01-271O09.b_48_590 (reverse)

seq1  AGAAACCCCAACTAAGGTACTACCAATTTGATATTGGGGACCTTCTTAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAACCCCAACTAAGGTACTACCAATTTGATATTGGGGACCTTCTTAGT  50

seq1  TAGGTTTTCCTGGGATTCAAACTGAGGGTGTGGGAAAGTTCTAAGGGCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTTTTCCTGGGATTCAAACTGAGGGTGTGGGAAAGTTCTAAGGGCAG  100

seq1  GTGGGCCTCTGAACTGTTCCTTTTACTCTATTTTATGAGACAGCATATCA  150
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  GTGGGCCTCTGAACTGTTCCTTTTATTCTATTTTATGAGACAGCATATCA  150

seq1  CTATGTAGCTCAGGCTGACCTCAAGCTTGCAATCCTCCTGCCTCCGCCTC  200
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  CTATGTAGCTCAGGCTGACCTCAAGCTTGCAATCCTCCTGCCTCTGCCTC  200

seq1  TTGATTGCTATTATTATAGGTATGCAGCATCACACCAGAATAGACTCACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATTGCTATTATTATAGGTATGCAGCATCACACCAGAATAGACTCACA  250

seq1  GAGTTCACTTTGAAAACTTCAGGGTTTCTGAACAATCAGGAAATCGGTTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTCACTTTGAAAACTTCAGGGTTTCTGAACAATCAGGAAATCGGTTG  300

seq1  AGGTAGGTTAAATAGACCAGTCCTTTTTTGGTGTATTTCCAATATTTAAC  350
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AGGTAGGTTAAATAGACCAGTCCTTGTTTGGTGTATTTCCAATATTTAAC  350

seq1  TGGCTCATTGTCTCTGCTCAAAGATGCTTACTTAGCAAGTTGTGAGGTAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCATTGTCTCTGCTCAAAGATGCTTACTTAGCAAGTTGTGAGGTAA  400

seq1  GAAATAGCCAGTGCAGGCACATTGACAGTCATAAGAACTGACAGCTTGTT  450
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GAAATAGCCAGTGCAGGCACAATGACAGTCATAAGAACTGACAGCTTGTT  450

seq1  AGAGTGAGTAGTAATTAGCTGGTGGACAGTCCCACTATTAGCCACCCCTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTGAGTAGTAATTAGCTGGTGGACAGTCCCACTATTAGCCACCCCTA  500

seq1  ACAATGGAGTTGTTTTGTACAGGAGCCAACATCCCCAGAATTC  543
      |||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATGGAGTTGTTTTGTACAGGAGCCAACATCCCCAGAATTC  543

seq1: chr5_110323096_110324125
seq2: B6Ng01-271O09.g_157_1171

seq1  TCTTCCCTGCGCCGGTGATGGTAACCGTCCCGGGTCTTCTCGTCCCGGGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCCTGCGCCGGTGATGGTAACCGTCCCGGGTCTTCTCGTCCCGGGT  50

seq1  TTCAGCACCAACTCTTACACGCATTCACGACCGGCCAGGAAGAACGCAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGCACCAACTCTTACACGCATTCACGACCGGCCAGGAAGAACGCAAC  100

seq1  AAACCGGAATCTTCTGCGGCAAAACTTTATTGCTTACATCTTCAGGAGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCGGAATCTTCTGCGGCAAAACTTTATTGCTTACATCTTCAGGAGCA  150

seq1  AGAGTGCAAGAGAGCAAGAGCTCTATTGCTTACATCTTTAGGAGCCAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTGCAAGAGAGCAAGAGCTCTATTGCTTACATCTTTAGGAGCCAAAG  200

seq1  CGCAAGAGTGCAAGAGCAAAAGCAAGAGTGCAAGCGCTTTATTGCTTACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCAAGAGTGCAAGAGCAAAAGCAAGAGTGCAAGCGCTTTATTGCTTACA  250

seq1  TCTTCAGGAGCAAGAGAGTAAGAGAGAGAATGGCGAAACCCCGTCCCTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCAGGAGCAAGAGAGTAAGAGAGAGAATGGCGAAACCCCGTCCCTTT  300

seq1  TAAGGAGAATTATTCTCCGCCTAGGACGTATTACTCCTTGATTGGCTGCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGAGAATTATTCTCCGCCTAGGACGTATTACTCCTTGATTGGCTGCA  350

seq1  GCCCATCGGCCAAGTTGTCGTCACGGGGAAGGCAGAGCACATGGGGTGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCATCGGCCAAGTTGTCGTCACGGGGAAGGCAGAGCACATGGGGTGGA  400

seq1  AAACTACCCTTGGCACATGCGCAGATTATTTGTTTACCACTTAGAACACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTACCCTTGGCACATGCGCAGATTATTTGTTTACCACTTAGAACACA  450

seq1  GGATGTCAGCGCCATCTTGCAACGGCGAATGTGAGGGCGGCTCCCCACAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGTCAGCGCCATCTTGCAACGGCGAATGTGAGGGCGGCTCCCCACAA  500

seq1  ATTCCGTTTTAAAGAACAGTATATTTTGTTTGAGAGTAAAGATGTGCTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCGTTTTAAAGAACAGTATATTTTGTTTGAGAGTAAAGATGTGCTAG  550

seq1  CCCATGTCTGCAGTGCTGTAGAGTCCAGATCAGAGGCTCCAGCTTTGTCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATGTCTGCAGTGCTGTAGAGTCCAGATCAGAGGCTCCAGCTTTGTCC  600

seq1  ATGTCCTGGGCCTCATACACAACCTCAGCCCCACTGCCTCCTTCTCAGCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCCTGGGCCTCATACACAACCTCAGCCCCACTGCCTCCTTCTCAGCC  650

seq1  GACCATTAAGGATGGAAGTGGAAATAAATTACACTATGAACATGGCAAAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCATTAAGGATGGAAGTGGAAATAAATTACACTATGAACATGGCAAAC  700

seq1  CAGAAATTAATAATCCTTGTAAACAAATGAAAATTCTTATAAAATAAACA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAATTAATAATCCTTGTAAACAAATGAAAATTCTTATAAAATAAACA  750

seq1  ATAATTATAATAAGATGGGATGATGATAAAAGACTAGTTACATTTGAAAT  800
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  ATAATTATAATAAGATGGGATGATGATAAAAGACTAGTTACATTTG-AAT  799

seq1  AATGTTCATACTCTTGAATCCATGTACTTTTTCCAGGTAAGCCCACCTCC  850
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AATGTTCATACTCTTGAATCCATGTACTTTTTCCAGGTAAGCCCACCT-C  848

seq1  CGCTATTGTATTGATTTTGTTCTTTCTCCCAAGTCCTCTAAGACCTCAGA  900
      ||||| ||||||||||||||||||||||||||||||||| ||||||||||
seq2  CGCTA-TGTATTGATTTTGTTCTTTCTCCCAAGTCCTCT-AGACCTCAGA  896

seq1  TTTCATATGAAAGACTGAAGAAAATGTCTTGATA--TGTGTCTGGCAATT  948
      ||||||||||||||||||||||||||||||||||   ||||||||| |||
seq2  TTTCATATGAAAGACTGAAGAAAATGTCTTGATAATGGTGTCTGGC-ATT  945

seq1  ATTTCACCCTGTCAGGTGTTTCCTCATTCTTAGTTAATATTCAGGTAAGT  998
      |||||| ||||||| |||||| |||||||||||    || |||| ||   
seq2  ATTTCA-CCTGTCA-GTGTTT-CTCATTCTTAG----TAATCAGTTA--G  986

seq1  TTTTGAAAAACTGACAATAGGGGTAGGACTTC  1030
      |||||||||||||||||||  |||| ||||||
seq2  TTTTGAAAAACTGACAATA--GGTA-GACTTC  1015

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information