MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-343E10
Chromosome	5 (Build37)
Map Location	93,761,384 - 93,761,600
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Cxcl10, Cxcl11, LOC100040228, Art3, Nup54, Scarb2, Gm1381, D5Ertd593e, 4932413O14Rik, Shroom3, LOC623798, Ankrd56, Sept11, Ccni, LOC100040826, 2010109A12Rik, Ccng2
Downstream gene	LOC632115, EG330129, LOC100040885, LOC666064, LOC100040909, C87414, LOC666075, LOC666077, LOC666081, EG665802, LOC100040408, LOC100040981, EG622719, LOC100041003, BC061212, EG622744, LOC100041032, LOC100041042, LOC624421
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cxcl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15945 MGI:1352450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxcl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56066 MGI:1860203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Art3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109979 MGI:1202729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269113 MGI:1920460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scarb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12492 MGI:1196458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384198 MGI:2686227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D5Ertd593e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52331 MGI:1261768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932413O14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320696 MGI:2444555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shroom3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27428 MGI:1351655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC623798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 756 ESTs, 9 Proteins pseudo : _no_value

name	Ankrd56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78088 MGI:1925338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52398 MGI:1277214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccni (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12453 MGI:1341077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040826 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 4 Proteins pseudo : _no_value

name	2010109A12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75610 MGI:1922860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ccng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12452 MGI:1095734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins pseudo : _no_value

name	EG330129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330129 MGI:3648817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 12 Proteins

name	LOC100040885 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040885
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 166 ESTs, 50 Proteins

name	LOC666064 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040909 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins pseudo : _no_value

name	C87414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381654 MGI:2141341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 159 ESTs, 46 Proteins

name	LOC666075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 36 Proteins pseudo : _no_value

name	LOC666077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 115 ESTs, 15 Proteins pseudo : _no_value

name	LOC666081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG665802 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665802 MGI:3704104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 168 ESTs, 48 Proteins

name	LOC100040408 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins

name	EG622719 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622719 MGI:3644199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins

name	LOC100041003 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins pseudo : _no_value

name	BC061212 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381724 MGI:2681870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622744 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622744 MGI:3647817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 47 Proteins

name	LOC100041032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 164 ESTs, 50 Proteins

name	LOC100041042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 6 Proteins

name	LOC624421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins

name	Cxcl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946575 GeneID:15945 MGI:1352450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 10 transcript_id : NM_021274.1

name	Cxcl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9507070 GeneID:56066 MGI:1860203
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 11 transcript_id : NM_019494.1

name	Art3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32171189 GeneID:109979 MGI:1202729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 3 transcript_id : NM_181728.1

name	Nup54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326535 GeneID:269113 MGI:1920460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 54 transcript_id : NM_183392.2

name	Scarb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377768 GeneID:12492 MGI:1196458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scavenger receptor class B, member 2 transcript_id : NM_007644.3

name	Gm1381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702012 GeneID:384198 MGI:2686227
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1381, (NCBI) transcript_id : NM_001033478.1

name	D5Ertd593e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386655 GeneID:52331 MGI:1261768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 593, expressed transcript_id : NM_175096.3

name	4932413O14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130351 GeneID:320696 MGI:2444555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932413O14 gene transcript_id : NM_177230.3

name	Shroom3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606394 GeneID:27428 MGI:1351655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 3 transcript_id : NM_015756.2

name	Shroom3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606378 GeneID:27428 MGI:1351655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 3 transcript_id : NM_001077595.1

name	Shroom3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606380 GeneID:27428 MGI:1351655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 3 transcript_id : NM_001077596.1

name	Ankrd56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366393 GeneID:78088 MGI:1925338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 56 transcript_id : NM_175270.3

name	Sept11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57634517 GeneID:52398 MGI:1277214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 11 transcript_id : NM_001009818.1

name	Ccni (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560455 GeneID:12453 MGI:1341077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin I transcript_id : NM_017367.2

name	2010109A12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254027 GeneID:75610 MGI:1922860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 2010109A12 gene transcript_id : XM_001475713.1

name	Ccng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378472 GeneID:12452 MGI:1095734
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin G2 transcript_id : NM_007635.3

name	EG330129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374943 GeneID:330129 MGI:3648817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 12 Proteins product : predicted gene, EG330129 transcript_id : XM_284106.6

name	LOC100040885 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254029 GeneID:100040885
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 105 ESTs, 47 Proteins product : similar to Expressed sequence AA792892, transcript variant 1 transcript_id : XM_001475748.1

name	LOC100040885 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254031 GeneID:100040885
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 128 ESTs, 47 Proteins product : similar to Expressed sequence AA792892, transcript variant 2 transcript_id : XM_001475767.1

name	LOC100040885 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254033 GeneID:100040885
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 140 ESTs, 47 Proteins product : similar to Expressed sequence AA792892, transcript variant 3 transcript_id : XM_001475785.1

name	LOC100040885 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254035 GeneID:100040885
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 90 ESTs, 3 Proteins product : similar to Expressed sequence AA792892, transcript variant 4 transcript_id : XM_001475804.1

name	C87414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254040 GeneID:381654 MGI:2141341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 152 ESTs, 43 Proteins product : expressed sequence C87414 transcript_id : XM_001475849.1

name	C87414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374909 GeneID:381654 MGI:2141341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 142 ESTs, 3 Proteins product : expressed sequence C87414, transcript variant 3 transcript_id : XM_898543.2

name	C87414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374908 GeneID:381654 MGI:2141341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 157 ESTs, 43 Proteins product : expressed sequence C87414, transcript variant 5 transcript_id : XM_898556.2

name	C87414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374905 GeneID:381654 MGI:2141341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 151 ESTs, 43 Proteins product : expressed sequence C87414, transcript variant 6 transcript_id : XM_981565.1

name	EG665802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374914 GeneID:665802 MGI:3704104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 131 ESTs, 45 Proteins product : predicted gene, EG665802, transcript variant 5 transcript_id : XM_981847.1

name	EG665802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374916 GeneID:665802 MGI:3704104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 143 ESTs, 45 Proteins product : predicted gene, EG665802, transcript variant 6 transcript_id : XM_981891.1

name	LOC100040981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254043 GeneID:100040981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins product : similar to CDNA sequence BC061212 transcript_id : XM_001476028.1

name	EG622719 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82897868 GeneID:622719 MGI:3644199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins product : predicted gene, EG622719 transcript_id : XM_889891.1

name	BC061212 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348567 GeneID:381724 MGI:2681870
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC061212 transcript_id : NM_198667.1

name	EG622744 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374956 GeneID:622744 MGI:3647817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 47 Proteins product : predicted gene, EG622744 transcript_id : XM_889906.2

name	LOC100041032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254046 GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 127 ESTs, 47 Proteins product : similar to C87414 protein, transcript variant 1 transcript_id : XM_001476116.1

name	LOC100041032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254048 GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 138 ESTs, 47 Proteins product : similar to C87414 protein, transcript variant 2 transcript_id : XM_001476136.1

name	LOC100041032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254050 GeneID:100041032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 89 ESTs, 3 Proteins product : similar to C87414 protein, transcript variant 3 transcript_id : XM_001476149.1

name	LOC100041042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254052 GeneID:100041042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 6 Proteins product : hypothetical protein LOC100041042 transcript_id : XM_001476164.1

name	LOC624421 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375924 GeneID:624421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins product : similar to D5Ertd577e protein transcript_id : XM_888973.2

name	Cxcl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946576 GeneID:15945 MGI:1352450
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : interferon activated gene 10; small inducible cytokine B subfamily (Cys-X-Cys), member 10 product : chemokine (C-X-C motif) ligand 10 protein_id : NP_067249.1

name	Cxcl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507071 GeneID:56066 MGI:1860203
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence TAS]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : small inducible cytokine subfamily B (Cys-X-Cys), member 11 product : chemokine (C-X-C motif) ligand 11 protein_id : NP_062367.1

name	Art3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32171190 GeneID:109979 MGI:1202729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 function : unknown note : ART3 mono(ADP-ribosyl)transferase; mono-ADP-ribosyltransferase 3; NAD(P)(+)--arginine ADP-ribosyltransferase product : ADP-ribosyltransferase 3 protein_id : NP_859417.1

name	Nup54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930543 CCDS:CCDS19430.1 GeneID:269113 MGI:1920460
definition	codon_start : 1 note : nucleoporin 54kDa product : nucleoporin 54 protein_id : NP_899248.1

name	Scarb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680878 CCDS:CCDS19431.1 GeneID:12492 MGI:1196458
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 note : CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2; LIMP II product : scavenger receptor class B, member 2 protein_id : NP_031670.1

name	Gm1381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702013 CCDS:CCDS19432.1 GeneID:384198 MGI:2686227
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC384198 protein_id : NP_001028650.1

name	D5Ertd593e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424697 CCDS:CCDS19433.1 GeneID:52331 MGI:1261768
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030246 - carbohydrate binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 product : genethonin 1 protein_id : NP_780305.1

name	4932413O14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893281 CCDS:CCDS19434.1 GeneID:320696 MGI:2444555
definition	codon_start : 1 product : hypothetical protein LOC320696 protein_id : NP_796204.1

name	Shroom3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606395 GeneID:27428 MGI:1351655
definition	GO_component : GO:0005912 - adherens junction [Evidence IDA]; GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA] GO_process : GO:0007389 - pattern specification [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; shroom product : shroom isoform 1 protein_id : NP_056571.2

name	Shroom3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606379 GeneID:27428 MGI:1351655
definition	GO_component : GO:0005912 - adherens junction [Evidence IDA]; GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA] GO_process : GO:0007389 - pattern specification [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; shroom product : shroom isoform 2 protein_id : NP_001071063.1

name	Shroom3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606381 GeneID:27428 MGI:1351655
definition	GO_component : GO:0005912 - adherens junction [Evidence IDA]; GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA] GO_process : GO:0007389 - pattern specification [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; shroom product : shroom isoform 2 protein_id : NP_001071064.1

name	Ankrd56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424924 CCDS:CCDS19435.1 GeneID:78088 MGI:1925338
definition	codon_start : 1 product : ankyrin repeat domain 56 protein_id : NP_780479.1

name	Sept11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57634518 GeneID:52398 MGI:1277214
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : septin 11 protein_id : NP_001009818.1

name	Ccni (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393063 CCDS:CCDS19436.1 GeneID:12453 MGI:1341077
definition	GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence ISS] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence TAS] codon_start : 1 exception : mismatches in translation product : cyclin I protein_id : NP_059063.1

name	2010109A12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254028 GeneID:75610 MGI:1922860
definition	codon_start : 1 product : hypothetical protein LOC75610 protein_id : XP_001475763.1

name	Ccng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982477 CCDS:CCDS19437.1 GeneID:12452 MGI:1095734
definition	GO_component : GO:0016012 - sarcoglycan complex [Evidence IEA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation product : cyclin G2 protein_id : NP_031661.2

name	EG330129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28516430 GeneID:330129 MGI:3648817
definition	codon_start : 1 product : similar to P300/CBP-associated factor protein_id : XP_284106.1

name	LOC100040885 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254036 GeneID:100040885
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001475854.1

name	LOC100040885 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254030 GeneID:100040885
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001475798.1

name	LOC100040885 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254032 GeneID:100040885
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001475817.1

name	LOC100040885 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254034 GeneID:100040885
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001475835.1

name	C87414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897840 GeneID:381654 MGI:2141341
definition	codon_start : 1 product : hypothetical protein LOC381654 isoform 3 protein_id : XP_903636.1

name	C87414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254041 GeneID:381654 MGI:2141341
definition	codon_start : 1 product : hypothetical protein LOC381654 protein_id : XP_001475899.1

name	C87414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897845 GeneID:381654 MGI:2141341
definition	codon_start : 1 product : hypothetical protein LOC381654 isoform 5 protein_id : XP_903649.1

name	C87414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374906 GeneID:381654 MGI:2141341
definition	codon_start : 1 product : hypothetical protein LOC381654 isoform 6 protein_id : XP_986659.1

name	EG665802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374915 GeneID:665802 MGI:3704104
definition	codon_start : 1 product : similar to C87414 protein isoform 5 protein_id : XP_986941.1

name	EG665802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374917 GeneID:665802 MGI:3704104
definition	codon_start : 1 product : similar to C87414 protein isoform 6 protein_id : XP_986985.1

name	LOC100040981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254044 GeneID:100040981
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_001476078.1

name	EG622719 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897869 GeneID:622719 MGI:3644199
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894984.1

name	BC061212 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348568 GeneID:381724 MGI:2681870
definition	codon_start : 1 product : hypothetical protein LOC381724 protein_id : NP_941069.1

name	EG622744 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897873 GeneID:622744 MGI:3647817
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894999.1

name	LOC100041032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254047 GeneID:100041032
definition	codon_start : 1 product : similar to C87414 protein isoform 1 protein_id : XP_001476166.1

name	LOC100041032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254049 GeneID:100041032
definition	codon_start : 1 product : similar to C87414 protein isoform 2 protein_id : XP_001476186.1

name	LOC100041032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254051 GeneID:100041032
definition	codon_start : 1 product : similar to C87414 protein isoform 3 protein_id : XP_001476199.1

name	LOC100041042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254053 GeneID:100041042
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476214.1

name	LOC624421 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375925 GeneID:624421
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894066.2

name	LOC632115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632115
definition	number : 7 pseudo : _no_value

name	LOC632115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632115
definition	number : 6 pseudo : _no_value

name	LOC632115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632115
definition	number : 5 pseudo : _no_value

name	LOC632115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632115
definition	number : 4 pseudo : _no_value

name	LOC632115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632115
definition	number : 3 pseudo : _no_value

name	LOC632115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632115
definition	number : 2 pseudo : _no_value

name	LOC632115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632115
definition	number : 1 pseudo : _no_value

name	LOC666064 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666064
definition	number : 5 pseudo : _no_value

name	LOC666064 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666064
definition	number : 4 pseudo : _no_value

name	LOC666064 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666064
definition	number : 3 pseudo : _no_value

name	LOC666064 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666064
definition	number : 2 pseudo : _no_value

name	LOC666064 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666064
definition	number : 1 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 1 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 2 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 3 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 4 pseudo : _no_value

name	LOC666081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666081
definition	number : 5 pseudo : _no_value

name	LOC100040408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040408
definition	number : 1 pseudo : _no_value

name	LOC100040408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040408
definition	number : 2 pseudo : _no_value

name	LOC100040408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040408
definition	number : 3 pseudo : _no_value

name	LOC100040228 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254001 GeneID:100040228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to CWF19-like 1, cell cycle control pseudo : _no_value transcript_id : XR_031703.1

name	LOC623798 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254023 GeneID:623798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 756 ESTs, 9 Proteins product : similar to 60S ribosomal protein L9 pseudo : _no_value transcript_id : XR_032331.1

name	LOC100040826 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254024 GeneID:100040826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 4 Proteins product : similar to RNA polymerase II transcriptional coactivator pseudo : _no_value transcript_id : XR_032383.1

name	LOC100040909 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254039 GeneID:100040909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032446.1

name	LOC666075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254042 GeneID:666075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 36 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032496.1

name	LOC666077 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254004 GeneID:666077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 115 ESTs, 15 Proteins product : similar to Expressed sequence C87414 pseudo : _no_value transcript_id : XR_035665.1

name	LOC100041003 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254045 GeneID:100041003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032541.1

clone name	MSMg01-431N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150I08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-195N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-165J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478C09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-313C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341B08
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-343E10.b	B6Ng01-343E10.g
ACC	GA126096	GA126097
length	1,017	1,175
definition	B6Ng01-343E10.b	B6Ng01-343E10.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctttgtgtttgttgtaaaataaagtcagaaaaatggaggatgata atggatttaaaagcagagaaccggaagggacttgagccccggatcaggcc gggctatctgcttccttaattaatgcagtctcaggtcctgctctattgga ttgtctctagctgcatatgtatcaaaagatggcctagttggccatcactg gaaagagaggcccattggacatgcaaacattatatgccccagtacagggg aacgccagggccaaaaccgggtgtgggggacttttgggatagcattggaa atgtaattgaggaaaatacctaattaaaaaaaaaaaaaaaaaaaaaaaaa aagcagagaacaaagcagttcagccaatgggtcctttaaggccttgattt tctttaccttctttgttgcctttatttgctttgttgttgagatcatggcc tataataataattaacttgagggctggtgagatggctcagtgggtaagag cacctgactgctcttccgaaggtccggagttcaaatcccagcaaccacat ggtggttcacaaccatccataacgagatctgactccctcttctggagtgt ctaaagacagctacagtgtacttacatataataagtaaataaatctttaa aataatattaacttgaatgatttaattttcataatcccattacttgagca ggatcaggaaaggtgtgctttcttagtacctacactgaacaacagtggtc ccataaacagatactattagaaggaaatatctttcaaaatataatttaga atctagaattgagttgaattacttaaaacagttcagattcagccaaatct tccgtagatgatgaagaactattcagagtccctggatttcacttccatgt ggactatttaacattcctgtggaaatacctttcttaaaatcaaattaaag atgttaaataggtgcaaggaagagagctgaacatgtactataagctaaaa tagatgattatttacat	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacatcagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgtggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atgatggacctggagggcatcatcctgagtgaggtaacacattcacaaag gaactcacacaatatgtactcactgataagtggatattagcccaaaacct aggatacccaagatataagatacaatttgctaaacacatgaaactcaaga agaatgaagactgaagtgtggacactatgcccctccttagaagtgggaac aaaacacccttggaaggagttacagagacaaagtttggagctgagatgaa aggatggtccatgtagagacttccatatccagggatccaccccataatca gcatccaaacgttgacaccattgcatacactagcaagattttatcgaaag gacccagatgtagctgtctcttgtgagactatgccggggcctagcaaaca cagaagtggatgctcacagtcagctaatggatggatcacagggctcccaa tggaggagctagagaaagtacccaagagctaaagggatctgcaaccctat aggcgacacatatgactacagtacccgagctctgactctagctgcatatg tatcaaagatgtctagttgcatcgctgtaagagaggtccatgacaagcaa cttatatggccagtacaggacgccaagctacggatggtgcttaggatgat atcggtacttgtctgagagacgcat
quality values	Open. Hide. 62 47 22 32 62 62 62 62 62 62 62 47 62 62 62 47 49 62 47 62 62 62 62 62 62 62 62 44 39 34 43 19 25 31 27 27 39 50 54 62 62 62 62 62 59 49 62 59 59 62 62 59 62 62 54 59 62 59 54 54 62 54 42 62 59 62 62 62 62 62 62 62 59 49 42 43 42 49 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 38 51 38 23 46 24 32 45 43 59 59 62 56 59 59 50 59 59 62 59 45 62 59 45 50 46 62 59 62 59 62 62 62 62 62 56 56 62 62 56 62 56 56 62 44 62 62 56 56 56 56 56 56 56 56 56 62 56 56 56 56 56 62 56 56 56 56 62 62 62 62 56 56 62 56 56 56 56 56 56 56 51 56 56 56 56 38 51 31 28 40 39 47 56 62 56 56 62 56 56 56 56 56 56 56 56 56 62 62 62 62 62 62 62 62 62 62 34 38 62 54 52 52 62 52 52 52 48 43 41 43 52 62 62 62 54 49 34 52 38 46 62 42 46 52 35 54 42 54 48 44 47 54 54 54 54 54 58 52 54 54 54 52 52 52 37 54 52 54 58 54 58 54 52 54 54 42 58 54 54 52 54 58 58 58 58 54 54 50 54 52 54 58 54 34 52 52 54 58 54 52 58 58 48 58 54 46 52 43 52 47 39 33 58 51 54 48 51 50 58 54 52 58 51 49 49 58 53 53 46 48 51 53 58 50 49 49 47 44 49 51 58 54 51 42 50 58 50 58 54 58 58 48 44 51 50 48 42 48 51 43 54 46 51 46 58 47 50 49 49 48 42 43 42 48 48 51 58 48 48 50 58 54 48 43 58 58 50 50 49 50 49 51 53 58 51 38 58 58 41 30 54 53 53 41 49 41 49 49 44 43 44 51 39 43 37 51 39 29 58 39 39 40 52 58 58 51 52 34 45 42 37 49 49 54 51 39 54 51 40 38 54 54 51 47 31 53 45 35 54 35 31 42 39 35 54 49 49 38 34 46 25 50 42 49 40 54 54 53 52 41 37 32 32 33 25 47 36 37 43 45 31 42 53 52 54 53 33 32 33 31 24 30 24 54 51 29 28 54 44 27 53 32 54 40 41 30 33 39 31 26 42 32 32 33 31 31 21 32 53 25 42 27 49 31 32 26 34 40 32 46 30 31 32 47 53 26 22 29 24 32 32 32 49 30 32 29 33 32 24 31 30 30 30 34 27 27 27 30 43 29 31 31 43 51 39 29 35 30 36 37 33 31 51 51 26 28 26 31 51 32 38 22 5 32 26 31 37 30 29 46 27 12 47 30 31 34 32 38 34 42 31 32 31 20 31 25 34 32 17 31 33 31 21 28 33 22 31 29 23 32 32 33 22 38 21 32 33 41 31 26 31 32 22 21 46 31 31 23 31 31 21 21 31 19 31 31 23 31 27 13 27 32 34 36 46 24 33 9 26 14 31 31 31 32 9 24 15 27 16 31 43 18 26 19 24 15 31 48 25 10 6 6 23 44 43 24 27 31 29 47 29 21 18 30 48 22 13 22 18 31 13 17 16 44 27 24 14 26 13 11 31 23 18 21 20 12 24 6 11 29 7 17 19 34 32 27 20 16 20 17 32 29 19 10 33 28 9 17 4 17 17 34 32 22 43 40 20 25 17 23 32 22 27 33 26 21 21 14 48 33 15 34 14 31	Open. Hide. 62 47 42 47 62 62 62 47 35 44 36 32 27 24 21 32 35 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 59 62 59 59 56 38 42 54 62 56 62 62 62 62 62 62 62 62 62 62 59 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 46 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 54 58 58 58 42 58 58 58 58 49 46 58 58 54 49 54 58 54 58 58 58 58 58 58 58 58 58 54 39 58 52 58 58 54 54 58 58 58 49 58 48 58 51 58 58 58 58 58 58 49 58 58 52 58 51 58 43 58 58 58 51 58 58 58 58 58 58 52 58 58 58 46 52 49 58 48 58 58 58 58 41 49 53 58 54 51 51 58 49 52 58 58 48 37 58 58 54 41 58 39 39 49 40 58 49 42 58 50 44 50 53 50 50 58 52 58 34 51 49 51 49 54 58 58 58 51 50 40 58 58 51 53 53 53 58 51 58 49 58 50 58 53 50 58 52 58 58 30 58 52 33 51 50 58 32 43 34 51 54 40 51 40 50 54 27 54 50 41 34 39 47 49 42 49 50 39 18 33 49 49 35 42 40 50 39 32 53 53 39 49 38 33 38 42 38 32 39 54 54 49 41 40 35 33 44 52 42 41 46 52 45 29 53 47 25 42 41 33 45 37 45 54 31 39 40 24 51 51 32 49 54 46 49 39 51 23 37 47 33 46 19 32 28 32 40 49 51 31 51 32 24 46 46 30 40 32 30 40 53 34 33 32 52 32 33 29 33 32 14 41 29 52 32 40 17 27 29 36 51 46 22 30 23 40 31 31 41 36 40 31 45 31 30 31 30 24 31 32 24 37 26 42 32 46 31 31 30 36 30 30 32 24 26 27 31 19 46 42 30 31 18 31 24 31 22 31 34 31 20 32 31 32 31 31 25 48 48 42 31 31 32 32 42 48 36 26 28 26 13 23 17 23 24 28 27 32 32 26 24 31 37 32 27 26 30 28 27 32 38 32 35 31 15 20 18 36 30 25 23 27 39 24 46 47 30 19 21 27 32 11 31 28 44 32 26 25 33 31 31 30 33 20 26 18 18 16 18 31 30 32 32 14 29 23 25 19 32 31 31 32 42 18 22 21 31 26 4 12 21 25 10 29 23 20 15 11 19 36 26 15 32 16 36 22 14 20 24 24 26 17 10 11 34 14 32 27 21 21 19 13 29 48 23 16 19 22 32 34 29 7 9 10 4 12 20 28 13 34 18 15 47 10 6 13 24 28 18 26 19 13 15 27 11 23 13 22 10 14 14 6 11 3 5 16 6 12 27 8 14 7 34 8 11 6 3 3 18 27 24 26 21 7 7 5 6 20 24 7 25 14 20 20 20 16 21 16 13 16 23 16 21 5 12 7 16 21 8 10 10 14 16 29 18 9 8 6 17 3 6 21 15 5 17 4 3 3 2 9 6 5 14 11 21 5 25 23 7 10 5 14 7 8 2 14 15 10 12 2 2 2 4 22 7 8 7 15 12 17 15 4 4 6 18 8 4 13 13 6 5 14 4 6 4 22 5 3 1 6 7 20 5 5 10 2 3 3 1 5 1 2 6 11 3 5 2 1 1 4 6 16 17 3 5 3 1 1 2 1 2 2 1 13 8 11 15 7 4 5 5 6 1 1 2 4 5 3 3 3 1 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_93761384_93761600
seq2: B6Ng01-343E10.b_198_699 (reverse)

seq1  TTTTTAAGATTTATTTA-TTATTATATGTAAGTACACTGTAGCTGTCTTC  49
      |||| |||||||||||| ||||||||||||||||||||||||||||||| 
seq2  TTTTAAAGATTTATTTACTTATTATATGTAAGTACACTGTAGCTGTCTTT  50

seq1  AGACACACCAGAAGAGGGAGTCAGATTTTCTTACGGATGGTTGTGAGCCA  99
      |||||| ||||||||||||||||||| |  ||| |||||||||||| |||
seq2  AGACACTCCAGAAGAGGGAGTCAGATCTCGTTATGGATGGTTGTGAACCA  100

seq1  CCATGTGGTTGCTGGGATTTGAACTCTGGACCTTCAGAAGAGCAGTCGGG  149
      |||||||||||||||||||||||||| |||||||| ||||||||||| ||
seq2  CCATGTGGTTGCTGGGATTTGAACTCCGGACCTTCGGAAGAGCAGTCAGG  150

seq1  TGCTCTTACCCACTGAGCCATCTCACCAGCCC------------------  181
      ||||||||||||||||||||||||||||||||                  
seq2  TGCTCTTACCCACTGAGCCATCTCACCAGCCCTCAAGTTAATTATTATTA  200

seq1  TAGGCCATCTTTTGATACA--TACGCAGCTAAAGACAA------------  217
      ||||||||  | | | |||   | |||  ||||| |||            
seq2  TAGGCCATGATCTCA-ACAACAAAGCAAATAAAGGCAACAAAGAAGGTAA  249

seq1  --------------------------------------------------  217
                                                        
seq2  AGAAAATCAAGGCCTTAAAGGACCCATTGGCTGAACTGCTTTGTTCTCTG  299

seq1  --------------------------------------------------  217
                                                        
seq2  CTTTTTTTTTTTTTTTTTTTTTTTTTTTAATTAGGTATTTTCCTCAATTA  349

seq1  --------------------------------------------------  217
                                                        
seq2  CATTTCCAATGCTATCCCAAAAGTCCCCCACACCCGGTTTTGGCCCTGGC  399

seq1  --------------------------------------------------  217
                                                        
seq2  GTTCCCCTGTACTGGGGCATATAATGTTTGCATGTCCAATGGGCCTCTCT  449

seq1  --------------------------------------------------  217
                                                        
seq2  TTCCAGTGATGGCCAACTAGGCCATCTTTTGATACATATGCAGCTAGAGA  499

seq1  ---  217
         
seq2  CAA  502

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information