MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-123B17
Chromosome	5 (Build37)
Map Location	139,867,675 - 139,868,007
singlet/doublet	singlet
Overlap gene	3110082I17Rik, Gpr146
Upstream gene	2610020C11Rik, LOC433955, EG666533, 1700123K08Rik, Zfp68, LOC665882, A430033K04Rik, BC004044, EG384244, Pdgfa, Prkar1b, Heatr2, Unc84a, 1110007L15Rik, Centa1, Cox19, Cyp2w1, D830046C22Rik
Downstream gene	C130050O18Rik, Gpr30, Zfand2a, Uncx4.1, LOC100041200, LOC100041209, LOC100041217, Micall2, Ints1, Mafk, BC019731, 1810042K04Rik, A930017N06Rik, LOC100041270, Mad1l1, Ftsj2, Nudt1, Snx8
Link	Open Mouse BAC browser

Click to get alignment info.

name	2610020C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72154 MGI:1919404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433955 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 953 ESTs, 8 Proteins pseudo : _no_value

name	EG666533 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666533 MGI:3644505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	1700123K08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76658 MGI:1923908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24135 MGI:1344427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins pseudo : _no_value

name	A430033K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243308 MGI:3583896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC004044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80752 MGI:2136853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384244 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384244 MGI:3646467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Pdgfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18590 MGI:97527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkar1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19085 MGI:97759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Heatr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433956 MGI:3616079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc84a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77053 MGI:1924303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110007L15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67604 MGI:1914854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231821 MGI:2442201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68033 MGI:1915283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2w1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545817 MGI:3616076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 106 Proteins

name	3110082I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73212 MGI:1920462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830046C22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320197 MGI:2443565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr146 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80290 MGI:1933113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C130050O18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319772 MGI:2442694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76854 MGI:1924104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfand2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100494 MGI:2140729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uncx4.1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22255 MGI:108013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041200 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041209 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041209
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Micall2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231830 MGI:2444818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68510 MGI:1915760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mafk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17135 MGI:99951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC019731 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231832 MGI:2385897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810042K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66506 MGI:1913756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930017N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243312 MGI:2442479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 10 Proteins pseudo : _no_value

name	Mad1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17120 MGI:1341857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ftsj2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68017 MGI:1915267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17766 MGI:109280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231834 MGI:2443816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610020C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254176 GeneID:72154 MGI:1919404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610020C11 gene transcript_id : NM_028130.2

name	1700123K08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802060 GeneID:76658 MGI:1923908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700123K08 gene transcript_id : NM_029693.2

name	Zfp68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680983 GeneID:24135 MGI:1344427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 68 transcript_id : NM_001044747.1

name	Zfp68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113681056 GeneID:24135 MGI:1344427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 68 transcript_id : NM_013844.2

name	A430033K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942099 GeneID:243308 MGI:3583896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430033K04 gene transcript_id : NM_183025.1

name	BC004044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842825 GeneID:80752 MGI:2136853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004044 transcript_id : NM_030565.5

name	EG384244 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254649 GeneID:384244 MGI:3646467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG384244 transcript_id : XM_357518.6

name	Pdgfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130644 GeneID:18590 MGI:97527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet derived growth factor, alpha transcript_id : NM_008808.3

name	Prkar1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543508 GeneID:19085 MGI:97759
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, cAMP dependent regulatory, type I beta transcript_id : NM_008923.2

name	Heatr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486914 GeneID:433956 MGI:3616079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HEAT repeat containing 2 transcript_id : NM_001081265.1

name	Unc84a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789242 GeneID:77053 MGI:1924303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-84 homolog A (C. elegans) transcript_id : NM_024451.1

name	1110007L15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312885 GeneID:67604 MGI:1914854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110007L15 gene transcript_id : NM_026269.1

name	Centa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352026 GeneID:231821 MGI:2442201
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, alpha 1 transcript_id : NM_172723.2

name	Cox19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574049 GeneID:68033 MGI:1915283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) transcript_id : NM_197980.1

name	Cyp2w1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254651 GeneID:545817 MGI:3616076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 106 Proteins product : cytochrome P450, family 2, subfamily w, polypeptide 1 transcript_id : XM_620268.4

name	3110082I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801665 GeneID:73212 MGI:1920462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110082I17 gene transcript_id : NM_028469.2

name	D830046C22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802148 GeneID:320197 MGI:2443565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D830046C22 gene transcript_id : NM_177097.3

name	Gpr146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662751 GeneID:80290 MGI:1933113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 146 transcript_id : NM_030258.3

name	Gpr146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662746 GeneID:80290 MGI:1933113
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 146 transcript_id : NM_001038703.1

name	C130050O18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301224 GeneID:319772 MGI:2442694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C130050O18 gene transcript_id : NM_177000.3

name	Gpr30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378497 GeneID:76854 MGI:1924104
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 30 transcript_id : NM_029771.2

name	Zfand2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475963 GeneID:100494 MGI:2140729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, AN1-type domain 2A transcript_id : NM_133349.2

name	Uncx4.1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982739 GeneID:22255 MGI:108013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Unc4.1 homeobox (C. elegans) transcript_id : NM_013702.2

name	Micall2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341298 GeneID:231830 MGI:2444818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MICAL-like 2 transcript_id : NM_174850.2

name	Ints1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930422 GeneID:68510 MGI:1915760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 1 transcript_id : NM_026748.1

name	Mafk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130123 GeneID:17135 MGI:99951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) transcript_id : NM_010757.2

name	BC019731 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560761 GeneID:231832 MGI:2385897
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC019731 transcript_id : NM_144914.2

name	1810042K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345410 GeneID:66506 MGI:1913756
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810042K04 gene transcript_id : NM_025604.2

name	A930017N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342092 GeneID:243312 MGI:2442479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930017N06 gene transcript_id : NM_175522.2

name	Mad1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648090 GeneID:17120 MGI:1341857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitotic arrest deficient 1-like 1 transcript_id : NM_010752.3

name	Ftsj2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386001 GeneID:68017 MGI:1915267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FtsJ homolog 2 (E. coli) transcript_id : NM_026510.1

name	Nudt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678949 GeneID:17766 MGI:109280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 1 transcript_id : NM_008637.1

name	Snx8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375675 GeneID:231834 MGI:2443816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 8 transcript_id : NM_172277.2

name	2610020C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254177 GeneID:72154 MGI:1919404
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72154 protein_id : NP_082406.2

name	1700123K08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386432 GeneID:76658 MGI:1923908
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76658 protein_id : NP_083969.1

name	Zfp68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305647 CCDS:CCDS19801.1 GeneID:24135 MGI:1344427
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : zinc finger protein 68 isoform a protein_id : NP_038872.1

name	Zfp68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680984 GeneID:24135 MGI:1344427
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : zinc finger protein 68 isoform b protein_id : NP_001038212.1

name	A430033K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942100 GeneID:243308 MGI:3583896
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243308 protein_id : NP_898846.1

name	BC004044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385516 GeneID:80752 MGI:2136853
definition	codon_start : 1 note : dentin matrix protein 4 product : cDNA sequence BC004044 protein_id : NP_085042.1

name	EG384244 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254650 GeneID:384244 MGI:3646467
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357518.6

name	Pdgfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6715566 CCDS:CCDS19802.1 GeneID:18590 MGI:97527
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005902 - microvillus [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0048286 - alveolus development [Evidence IMP]; GO:0001525 - angiogenesis [Evidence IDA]; GO:0030031 - cell projection biogenesis [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IGI] [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0050730 - regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : platelet derived growth factor, alpha protein_id : NP_032834.1

name	Prkar1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543509 CCDS:CCDS19803.1 GeneID:19085 MGI:97759
definition	GO_component : GO:0005952 - cAMP-dependent protein kinase complex [Evidence IEA]; GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence TAS]; GO:0007611 - learning and/or memory [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protein kinase, cAMP dependent regulatory, type I beta protein_id : NP_032949.2

name	Heatr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486915 GeneID:433956 MGI:3616079
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : HEAT repeat containing 2 protein_id : NP_001074734.1

name	Unc84a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789243 CCDS:CCDS19804.1 GeneID:77053 MGI:1924303
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : unc-84 homolog A protein_id : NP_077771.1

name	1110007L15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229052 CCDS:CCDS19805.1 GeneID:67604 MGI:1914854
definition	codon_start : 1 product : hypothetical protein LOC67604 protein_id : NP_080545.2

name	Centa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370052 CCDS:CCDS19806.1 GeneID:231821 MGI:2442201
definition	GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 product : centaurin, alpha 1 protein_id : NP_766311.1

name	Cox19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574050 GeneID:68033 MGI:1915283
definition	codon_start : 1 product : COX19 cytochrome c oxidase assembly homolog protein_id : NP_932097.1

name	Cyp2w1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254652 GeneID:545817 MGI:3616076
definition	codon_start : 1 product : similar to cytochrome P450, family 2, subfamily W, polypeptide 1 protein_id : XP_620268.4

name	3110082I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312132 GeneID:73212 MGI:1920462
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC73212 protein_id : NP_082745.1

name	D830046C22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893027 GeneID:320197 MGI:2443565
definition	codon_start : 1 product : hypothetical protein LOC320197 protein_id : NP_796071.1

name	Gpr146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662747 CCDS:CCDS19809.1 GeneID:80290 MGI:1933113
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 146 protein_id : NP_001033792.1

name	Gpr146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981402 CCDS:CCDS19809.1 GeneID:80290 MGI:1933113
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 146 protein_id : NP_084534.2

name	C130050O18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301225 GeneID:319772 MGI:2442694
definition	codon_start : 1 product : hypothetical protein LOC319772 protein_id : NP_795974.2

name	Gpr30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037469 CCDS:CCDS19811.1 GeneID:76854 MGI:1924104
definition	GO_function : GO:0045028 - purinergic nucleotide receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : constitutively expressed peptide-like receptor like product : G protein-coupled receptor 30 protein_id : NP_084047.1

name	Zfand2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111158 CCDS:CCDS19812.1 GeneID:100494 MGI:2140729
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, AN1-type domain 2A protein_id : NP_579927.1

name	Uncx4.1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305613 CCDS:CCDS19813.1 GeneID:22255 MGI:108013
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Unc4.1 homeobox protein_id : NP_038730.1

name	Micall2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424677 GeneID:231830 MGI:2444818
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MICAL-like 2 protein_id : NP_777275.1

name	Ints1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930423 GeneID:68510 MGI:1915760
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 product : integrator complex subunit 1 protein_id : NP_081024.1

name	Mafk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754612 CCDS:CCDS19814.1 GeneID:17135 MGI:99951
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear factor, erythroid derived 2, ubiquitous; p18 NF-E2 product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K protein_id : NP_034887.1

name	BC019731 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560762 GeneID:231832 MGI:2385897
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC231832 protein_id : NP_659163.2

name	1810042K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313432 CCDS:CCDS19815.1 GeneID:66506 MGI:1913756
definition	codon_start : 1 product : hypothetical protein LOC66506 protein_id : NP_079880.1

name	A930017N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425288 CCDS:CCDS19816.1 GeneID:243312 MGI:2442479
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243312 protein_id : NP_780731.1

name	Mad1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014564 CCDS:CCDS19817.1 GeneID:17120 MGI:1341857
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : mitotic arrest deficient 1-like 1 protein_id : NP_034882.2

name	Ftsj2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386002 GeneID:68017 MGI:1915267
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : FtsJ homolog 2 protein_id : NP_080786.1

name	Nudt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678950 CCDS:CCDS19818.1 GeneID:17766 MGI:109280
definition	GO_function : GO:0008413 - 8-oxo-7,8-dihydroguanine triphosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006203 - dGTP catabolism [Evidence IDA]; GO:0006281 - DNA repair [Evidence IEA] codon_start : 1 note : mutT (E. coli) human homolog (8-oxo-dGTPase); 8-oxo-7,8-dihydro-2'-dGTPase product : nudix-type motif 1 protein_id : NP_032663.1

name	Snx8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986581 GeneID:231834 MGI:2443816
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 8 protein_id : NP_758481.1

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 1 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 2 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 3 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 4 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 5 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 6 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 7 pseudo : _no_value

name	LOC100041200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041200
definition	number : 2 pseudo : _no_value

name	LOC100041200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041200
definition	number : 1 pseudo : _no_value

name	LOC100041209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041209
definition	number : 2 pseudo : _no_value

name	LOC100041209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041209
definition	number : 1 pseudo : _no_value

name	LOC100041217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041217
definition	number : 1 pseudo : _no_value

name	LOC433955 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254642 GeneID:433955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 953 ESTs, 8 Proteins product : similar to HSPC008 pseudo : _no_value transcript_id : XR_033167.1

name	LOC665882 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254643 GeneID:665882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins product : similar to Ribosomal protein L17 pseudo : _no_value transcript_id : XR_033203.1

name	LOC100041270 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254653 GeneID:100041270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 10 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_032546.1

clone name	MSMg01-450M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345L20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-448O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-139E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186L14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-123B17.T7 (MSMg01no123_b17.b1)	MSMg01-123B17.TJ (MSMg01no123_b17.g1)
ACC	AG332799	AG332800
length	1,253	1,251
length of high quality (start - end)	281 (128 - 408)	329 (129 - 457)
definition	CHROMAT_FILE: MSMg01no123_b17.b1 PHD_FILE: MSMg01no123_b17.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:32:22 2005	CHROMAT_FILE: MSMg01no123_b17.g1 PHD_FILE: MSMg01no123_b17.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:32:22 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	ATTTCTTNNGGACATGCGGTGCTATAGACTCCTAAGGGAGAGGATCCGCG GAATTCTGGGTGTTTGCTCCTGTTCTTTCTTTCGTTCCTTTTTTTGTGGG GGGAGGGGCAGGCCCCTTAAGAGTTCTAGACAGCTTGGCCCTTACTAAGT AGCCCAGGCTCGTCTCCAACTAATAGCAATCCTCCTGTCTCAGTATTTTA AGCGCTGGAATTTCAAGCATGAGTCACCATGTCCAGCCCAGCTTTCTCTA TCTTCCTCCCTCCCTCCCTCCTTCCCTCCCTCCCTCCTCCCTTCCTCCTA CCTCTCTTCACCACCCCCCATGTTCATGTCTGTTGGAACATGCATATGGA GGTCAGAGGACAACCTCTGGGGTCATTTCTCAGGCTCTGTCTACCTTGCA CTGTTGATTTTTTATCTCTTGCTATTCTCAAGCCCATTGGTTGGCTAGGT TAACAGGCCTTTTTTTTTCCCCGCCCCCGTTTCATGCCCACTGTCTTGTA AAAAAAGAGGGGGAGCTTACTCATTACTTTTACTACATCTAGAACTAATT GATCTCCTAGTTAAGCCAGGTGTGCTCGTCTCCTACCTCCACTCTTACCA TCTCTACTATTTTTATTGCGTTCGTACTTTCGTGTATCTTAAATTCTCCT TGTTCCTTCACTTGAATTTGCCCCTTTCTCTCTTTTATTTTACATGCTAC CCTCTTTTCTTAATTTTACTCTTCCCTTTTTCACCTTTGTTTCTCCTTGT GTTTTCCCTCTTACCTTTCCTTCTTTATCTCCTCTCCCTTTTTTCCTTCT TCCTCTTTGTCTCCTTCTTTTTACTCTCTTTTCTTCTATTTCTCCGTTCT TTTCTTTTTCTCCCTCTTTTTTTCCCATCCTTTCTTCTCCTCATTTTTTT TTCTCCTTTCTTTATTTCTTCTTTTTCCCTTACTTTCCTTTATCTCCTTC TCTCTCTTTCTTTCTTCCTCTCTCCCCCTCCCTCTCTTTCATTTTTTTTT CTCTCTCCTTCTTTCTCTCATCTTCTATTCCTTTTCCTCCTCTTTTTTTA CTTTCACTTCTTACTTTTCTTTCTCCTCCCTCCTCTCCTTTCCCAACTCT TCTACCTTTCCCTCCTCTCCTCTTTTTTCCCTCTCTATTCTATTCACTAC TTTCCTCTCAGATCCATTCTCTTCCTTACTTCTTCTTCTACCTCCATTCC TTCTTCTTCTTACCACACTTCCTACCTTTGCATCTCTTCTATCTCTCTCC TGC	GTCCTCCTTTAAGATGGCAGGCTGGGGCGCCXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXCCCTTTTATAGACCCACTTGCCAAACTCG CACTCACTTAACATCCTTAATGACTGCACAGACTGCAACATGGGCTCTGC GCTGCCCCGTGGGTCAGTGACCATGGGGGAGGAAAGGAATGCCCAGGCTC ACCCAGGCCTCCCACGTCTCCCAGCATTGCTGGATCTAGGTGCCCAGCAA CCTAGCAAGCTTCAAGATAACTACAAAGGGCCTGCCCATCTGGGGGAAAT TATGTGGGCACAATGCAGCCAGCATCCATGTTCAGTCCCAGGCCTTGTCA GCCTGGGAGGTGCCTGTGCCTCCTGCCTCCACACACCTCCCGGGCAGCTC TTCAGGCCCCTTTCTCAGGGTACGGTGCAGGGGGCTACAGGTGTGCAACA CCCACGCAGGTGTGTCCCCACATTACCAGATGACAGGCTATACTTAGGTC CTCTACACAAGAAAGAGGGGGCAAGGAGGCAGCCTTGCACTGCCAAGCTG GTTTGAGGTTCTGTGGGTTCTGTCCCCAAAGCGTCCCCTAACCCGCGTCA AAAGGTATCAGCAGCTCTGCTCCTGGTGGAGTAGTGTCACAGGAACGCAC ACAAAAGCCTCTCTGGTGCTTCACCTGGTATTTTGGTTTCCCTCATAAAG AGTCCAGTAGTCTCACCAAGGCGATGCATGGCTCCCGCCGTCTGACCCGG ACACACACTCTGCTGCCAGATGCCGGCCTAAGACAGTGCACAGGACAGTG GTGACTAACCTCTGTCCCTCTCTCCTCACAGTTTGCAATCTGTGGTTGAG CTGCCCTGTGGTGCTGTGGTCCCACTCTACTTTACATCGTGGTCCTGACT CACCCCTGGTCCCCAAACCTTGCCCCTGGGGTTTGTGTGTCCCTCTCCCC TGCTCTTACTCGGGGCGCCGGGTCCNCCTTGTCAACCTTTACTCCAAATC GCTTCTTCTGGCGCTTGGCTCACTCTTCCCCGTCTTTAACCCTCCTGGCC CTTGCCTCCAATTCTCACTTCTTGTCAACCTTGCTCCCTGCCCTTCTCCT TTGTCTTTTACGTTAACTCGCTCTTCTCTTCTTCCTCGGTGTGCNCCCTT CCCTCTCCTCTTTTGTGCGGCTCTTTTGTTCAAACTCTTCATTCCTCGAT TTCCTCTCTCTCTCCTTTTGCCTTCTCTCTCCTTCCTCCTGCTCCTTCTC C
quality values	Open. Hide. 8 8 8 8 8 8 3 0 0 3 7 7 9 9 9 9 9 9 11 10 8 8 15 13 8 8 8 11 14 9 8 8 8 8 8 15 15 24 28 28 28 30 31 33 37 37 36 30 28 22 22 18 30 34 37 37 37 28 26 24 29 29 35 28 31 37 37 37 37 22 19 9 9 9 9 18 23 19 19 16 15 16 17 13 14 15 23 29 35 57 57 48 48 23 22 10 14 13 19 23 35 30 30 33 37 28 34 28 25 25 25 23 12 11 11 12 12 19 16 11 15 15 15 13 15 19 19 15 21 27 28 37 28 25 25 36 31 34 32 23 31 31 42 42 42 36 36 21 25 15 14 14 20 34 32 31 27 20 20 13 19 8 10 10 19 19 20 32 32 42 42 47 47 42 42 37 37 31 41 31 43 42 47 42 32 24 24 16 11 11 11 11 11 20 23 32 30 27 24 9 8 8 8 8 19 19 37 37 37 59 43 43 50 37 35 35 42 43 52 57 57 52 43 43 43 43 52 52 47 47 47 41 50 50 57 54 54 54 57 57 52 52 52 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 52 57 52 52 52 57 57 57 57 57 57 57 57 57 57 52 52 52 57 57 57 59 57 57 44 44 38 38 35 50 50 44 44 37 35 35 50 50 50 50 39 37 37 50 50 57 57 52 38 28 14 14 18 38 38 44 44 43 43 43 43 50 36 50 42 37 42 37 37 44 42 46 32 32 15 15 13 13 15 15 20 24 24 32 28 28 32 40 44 48 46 44 40 43 37 32 30 30 30 24 19 12 12 12 21 25 44 36 30 22 14 28 14 15 15 29 32 28 20 20 23 23 27 27 19 19 19 28 28 20 24 24 24 32 36 36 36 31 28 25 34 28 37 37 28 21 15 11 8 8 8 13 13 13 14 15 18 18 20 13 13 13 12 14 19 21 28 37 37 37 30 28 28 20 20 20 23 23 22 13 11 11 10 11 10 10 10 13 19 11 11 11 23 24 28 24 19 15 11 11 14 16 30 37 33 33 25 25 12 10 10 10 10 10 11 12 12 15 13 10 10 10 9 10 10 10 15 15 15 18 12 12 16 19 16 13 10 10 10 10 9 10 10 13 21 19 10 10 10 10 10 10 11 12 11 11 11 23 23 18 18 11 11 11 11 18 18 37 23 24 11 11 11 18 18 12 11 11 11 11 11 22 10 10 10 10 8 8 8 8 8 10 9 14 14 11 13 7 7 8 8 11 12 12 11 10 10 10 10 10 10 12 16 18 11 13 11 10 10 10 10 8 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 8 10 10 9 12 12 12 15 10 9 8 8 8 8 8 6 6 8 6 6 8 8 8 8 8 12 13 19 9 11 9 8 8 8 8 6 6 8 8 8 8 8 8 6 6 8 8 8 8 8 8 9 8 10 10 13 10 8 8 8 8 10 11 11 11 8 8 6 6 8 8 10 10 10 10 8 8 8 8 12 10 12 10 11 10 8 8 8 10 9 9 9 8 8 8 8 10 11 10 8 8 6 7 11 12 14 15 11 8 8 8 8 8 9 10 9 10 10 11 9 9 9 9 9 9 11 11 11 11 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 10 11 11 11 11 10 13 13 9 8 8 6 6 8 8 18 11 10 10 9 10 10 8 10 8 10 10 10 13 8 8 8 8 13 8 8 8 9 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 6 6 10 6 10 10 9 8 8 6 7 8 8 9 9 9 9 10 8 10 7 6 8 8 8 6 6 8 8 8 8 8 8 8 8 9 9 8 10 10 10 13 10 10 11 11 11 11 13 10 11 10 8 8 8 8 8 8 12 12 8 8 6 6 6 8 8 8 8 8 12 8 8 8 8 8 8 8 8 10 10 10 10 13 8 8 8 8 6 6 8 6 8 10 10 13 13 9 9 9 8 8 12 8 8 8 8 8 8 8 9 10 10 11 8 8 6 6 8 8 13 13 14 17 19 10 10 8 10 8 8 8 11 10 10 8 8 8 8 10 10 11 9 9 9 9 9 11 8 8 8 10 9 9 12 12 10 10 9 9 9 8 8 10 10 8 8 11 11 12 9 9 9 10 7 7 9 7 7 8 11 11 10 11 8 8 6 6 8 8 11 11 12 8 11 13 13 8 8 8 8 10 10 8 6 8 8 8 9 9 9 9 9 10 13 11 11 11 13 6 6 6 6 8 8 10 16 23 22 16 11 9 9 10 13 9 10 9 9 15 10 10 10 11 10 9 10 11 11 10 9 9 10 10 10 8 8 10 10 8 8 9 10 11 10 13 10 10 8 8 8 10 10 10 10 10 11 11 10 10 10 10 9 10 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 13 7 6 10 8 8 8 8 8 8 12 13 10 10 10 8 10 6 6 8 10 8 8 8 8 6 6 8 6 6 6 8 8 8 8 13 13 7 7 10 10 12 8 8 9 9 9 9 11 9 7 8 8 8 8 13 10 12 9 10 9 8 8 8 8 8 10 8 8 6 6 8 8 8 6 7 8 10 8 10 10 13 10 11 25 12 12 8 8 8 8 8 10 10 10 8 8 8 12 12 14 11 10 8 8 8 8 8 8 10 12 8 7 8 6 6 6 6 6 6 8 15 10 10 8 10 8 14 21 12 8 8 8 8 8 8 8 6	Open. Hide. 6 6 8 6 6 8 15 15 19 16 9 9 9 9 6 6 6 6 6 6 6 10 9 6 9 9 11 14 17 12 9 9 9 12 9 17 17 19 9 9 12 17 19 28 17 20 20 21 21 10 9 9 22 21 37 28 32 36 44 39 47 47 37 37 37 40 37 26 21 11 11 9 11 11 11 18 12 12 11 12 12 14 14 12 27 13 17 14 23 26 36 53 53 53 42 42 57 57 57 57 57 57 39 39 47 47 47 44 44 39 37 37 22 23 12 16 12 12 10 10 12 15 18 19 18 13 11 13 11 19 24 39 35 53 50 53 57 57 43 43 29 29 25 29 28 33 19 19 10 10 10 21 23 57 57 59 46 46 43 43 43 48 48 54 54 54 54 54 54 54 50 57 57 42 42 30 30 30 44 44 57 57 59 59 57 57 57 43 42 42 42 43 47 42 42 33 42 32 32 28 35 35 43 32 35 43 44 57 57 59 57 57 54 54 54 57 57 52 52 57 52 43 50 50 57 57 57 44 52 52 52 52 57 57 57 57 57 57 57 52 52 52 57 52 52 52 57 57 57 57 52 44 44 39 29 27 38 34 39 43 43 57 52 52 52 57 57 57 57 57 57 43 57 39 43 43 57 43 43 39 35 35 43 43 43 43 31 31 31 44 38 57 52 52 52 62 52 62 62 62 62 62 62 62 62 62 43 43 20 35 35 43 43 62 43 34 23 23 31 39 43 43 52 62 62 62 52 52 62 62 62 62 62 43 43 39 35 43 43 43 62 62 52 52 62 62 62 39 39 39 43 62 62 62 52 52 52 62 62 62 52 43 62 43 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 52 52 52 43 62 43 52 52 43 43 43 43 43 43 33 35 31 43 43 44 44 36 24 13 12 11 13 13 14 14 20 26 26 33 26 43 43 62 62 62 62 62 62 52 52 57 52 43 43 35 35 27 27 35 35 20 19 19 24 24 39 39 57 43 43 45 52 52 52 43 28 22 13 13 16 24 15 16 18 21 24 21 13 10 10 10 12 16 27 33 43 47 57 52 43 43 33 33 43 44 44 38 24 24 22 28 28 42 43 43 42 38 32 14 14 14 24 32 43 57 50 38 32 15 15 19 19 43 43 43 43 32 27 28 28 28 22 17 17 16 18 18 36 36 25 25 20 27 32 27 20 21 32 26 21 14 24 24 42 39 39 30 20 26 32 20 26 20 24 26 18 30 28 36 23 23 23 28 24 24 11 11 11 13 18 16 19 21 31 31 37 35 32 32 20 18 15 18 11 11 11 12 12 21 24 26 21 14 14 14 15 15 13 13 10 10 11 21 19 14 14 12 20 15 11 10 10 9 9 10 9 9 9 10 10 11 11 14 11 10 11 18 15 19 23 23 23 23 23 23 15 13 11 10 10 10 13 15 22 22 10 9 10 10 10 12 16 22 28 28 21 21 13 12 10 10 12 13 13 14 17 16 10 8 8 8 8 8 8 9 10 10 10 15 10 9 10 11 14 16 15 22 13 13 12 18 18 12 14 12 12 22 12 13 11 13 11 13 13 10 10 10 11 10 10 10 9 8 8 8 8 8 11 12 12 12 16 12 10 10 8 8 8 8 8 10 10 8 11 22 15 8 8 8 8 8 10 8 8 8 13 13 12 8 8 8 8 10 10 15 13 10 10 10 10 13 10 8 6 6 6 6 10 8 9 10 9 9 12 9 9 9 8 8 8 8 8 8 8 8 8 10 11 11 13 16 11 11 11 11 11 16 16 8 8 8 8 8 10 8 9 13 8 8 8 8 9 11 11 13 13 23 12 8 8 8 8 10 12 24 12 10 8 8 8 8 18 15 10 6 7 7 9 10 12 9 6 8 8 9 9 7 8 8 8 10 10 11 8 8 10 11 12 12 10 9 8 7 7 8 8 11 8 8 8 12 9 11 8 8 8 8 8 8 8 6 8 6 6 8 8 9 9 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 6 7 8 8 10 10 8 8 6 6 6 7 10 10 8 8 8 8 6 7 10 12 10 10 8 8 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 9 13 18 11 10 10 10 13 11 11 11 6 6 6 6 6 6 9 9 9 11 11 12 12 12 12 8 8 3 0 3 8 9 10 8 8 8 9 8 8 6 6 8 8 12 8 8 11 12 11 9 9 8 8 8 8 9 10 6 8 6 6 8 6 7 7 6 6 8 8 8 10 10 10 8 8 10 8 8 8 9 9 9 9 12 12 12 16 10 12 10 9 10 10 14 11 8 8 8 8 9 9 10 10 10 10 11 6 8 19 8 8 8 8 6 6 10 8 8 8 8 11 16 15 15 15 11 11 11 11 10 8 8 9 9 6 6 6 6 8 8 8 9 10 11 10 8 10 12 6 9 9 9 8 7 6 6 8 8 8 8 12 11 8 8 8 8 8 8 6 6 7 8 8 8 8 8 8 8 8 10 8 7 12 11 18 11 9 13 13 10 10 10 9 8 8 10 3 0 3 8 13 13 12 12 8 8 8 8 12 10 12 12 9 8 11 8 9 9 9 9 8 9 8 8 10 6 6 8 8 10 8 8 8 8 8 8 10 10 16 9 11 8 8 8 8 11 12 11 10 12 12 11 8 8 6 9 10 7 8 8 8 12 10 10 8 8 8 13 16 8 10 10 10 10 9 11 11 11 10 10 11 8 8 8 9 10 8 8 6 6 8 8 8 8 6 6 8 8 12 13 15 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no123_b17.g1 MSMg01no123_b17.g1 CHROMAT_FILE:
MSMg01no123_b17.g1 PHD_FILE: MSMg01no123_b17.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:32:22 2005
         (329 letters)



>mm_chr5_139867475_139868203
          Length = 729

 Score =  574 bits (297), Expect = e-168
 Identities = 321/333 (96%), Gaps = 7/333 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagactgcaacatgggctctgcgctgccccgtgggtcagtgaccatgggggaggaaagga 60
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 201 cagactgcaacatgggctctgtgctgccccgtgggtcagtgaccatgggggaggaaagga 260

                                                                       
Query: 61  atgcccaggctcacccaggcctcccacgtctcccagcattgctggatctaggtgcccagc 120
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 atgcccgggctcacccaggcctcccacgtctcccagcattgctggatctaggtgcccagc 320

                                                                       
Query: 121 aacctagcaagcttcaagataactacaaagggcctgcccatctgggggaaattatgtggg 180
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 321 aacctagcaagcttcaagataactacaaagggcctgcccatctgagggaaattatgtggg 380

                                                                       
Query: 181 cacaatgcagccagcatccatgttcagtcccaggccttgtcagcctgggaggtgcctgtg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 cacaatgcagccagcatccatgttcagtcccaggccttgtcagcctgggaggtgcctgtg 440

                                                                       
Query: 241 cctcctgcctcc-------acacacctcccgggcagctcttcaggcccctttctcagggt 293
           ||||||||||||       ||||||||||||||||||||||||||||||  |||||||||
Sbjct: 441 cctcctgcctcctgcctccacacacctcccgggcagctcttcaggccccgctctcagggt 500

                                            
Query: 294 acggtgcagggggctacaggtgtgcaacaccca 326
           |||||||||||||||||||||||||||||||||
Sbjct: 501 acggtgcagggggctacaggtgtgcaacaccca 533


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 329
Length of database: 729
Length adjustment: 9
Effective length of query: 320
Effective length of database: 720
Effective search space:   230400
Effective search space used:   230400
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information