MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-367C04
Chromosome	5 (Build37)
Map Location	34,517,509 - 34,517,670
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Spon2, Ctbp1, Maea, 4933407H18Rik, LOC672284, 2410018C17Rik, Slbp, Tmem129, Tacc3, Fgfr3, Letm1, LOC100040332, Whsc1, Whsc2, Gm1673, LOC100040427, Nat8l, Poln, BC023882
Downstream gene	Mxd4, Zfyve28, EG433874, A830049F12Rik, LOC100040061, Rnf4, BC037112, LOC100040480, Tnip2, Sh3bp2, Add1, 0610009O03Rik, Nol14, Gprk2l, Hdh, A930005I04Rik, Rgs12, Hgfac, Dok7, Lrpap1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Spon2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100689 MGI:1923724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13016 MGI:1201685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maea (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59003 MGI:1891748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933407H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71101 MGI:1918351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672284 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 Proteins

name	2410018C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74504 MGI:1919225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20492 MGI:108402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68366 MGI:1915616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tacc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21335 MGI:1341163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgfr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14184 MGI:95524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Letm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56384 MGI:1932557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 403 ESTs, 4 Proteins

name	Whsc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107823 MGI:1276574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Whsc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24116 MGI:1346098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1673 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381633 MGI:2686519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040427 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Nat8l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269642 MGI:2447776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Poln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272158 MGI:2675617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC023882 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231123 MGI:2387633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17122 MGI:104991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfyve28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231125 MGI:2684992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433874 MGI:3646114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 9 Proteins

name	A830049F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319915 MGI:2442971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100040061 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rnf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19822 MGI:1201691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC037112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231128 MGI:2447768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tnip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231130 MGI:2386643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24055 MGI:1346349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Add1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11518 MGI:87918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	0610009O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68294 MGI:1915544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75416 MGI:1922666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprk2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14772 MGI:95801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15194 MGI:96067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930005I04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403174 MGI:2684990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71729 MGI:1918979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgfac (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54426 MGI:1859281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dok7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231134 MGI:3584043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrpap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16976 MGI:96829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spon2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981610 GeneID:100689 MGI:1923724
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spondin 2, extracellular matrix protein transcript_id : NM_133903.2

name	Ctbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129918 GeneID:13016 MGI:1201685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-terminal binding protein 1 transcript_id : NM_013502.2

name	Maea (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407042 GeneID:59003 MGI:1891748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage erythroblast attacher transcript_id : NM_021500.2

name	4933407H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487375 GeneID:71101 MGI:1918351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933407H18 gene transcript_id : NM_001081101.1

name	LOC672284 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253842 GeneID:672284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 Proteins product : similar to homeodomain protein Sax2 transcript_id : XM_001473635.1

name	2410018C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341609 GeneID:74504 MGI:1919225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410018C17 gene transcript_id : NM_178390.2

name	Slbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677986 GeneID:20492 MGI:108402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stem-loop binding protein transcript_id : NM_009193.1

name	Tmem129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73853455 GeneID:68366 MGI:1915616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 129 transcript_id : NM_026698.2

name	Tacc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430562 GeneID:21335 MGI:1341163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming, acidic coiled-coil containing protein 3 transcript_id : NM_001040435.2

name	Fgfr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91932800 GeneID:14184 MGI:95524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 3 transcript_id : NM_008010.3

name	Letm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789996 GeneID:56384 MGI:1932557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper-EF-hand containing transmembrane protein 1 transcript_id : NM_019694.1

name	LOC100040332 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253850 GeneID:100040332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 403 ESTs, 4 Proteins product : similar to 40S ribosomal protein S29 transcript_id : XM_001475194.1

name	Whsc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487396 GeneID:107823 MGI:1276574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 1 (human) transcript_id : NM_001081102.1

name	Whsc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130005 GeneID:24116 MGI:1346098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 2 (human) transcript_id : NM_011914.2

name	Gm1673 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801766 GeneID:381633 MGI:2686519
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1673, (NCBI) transcript_id : NM_001033458.2

name	LOC100040427 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253852 GeneID:100040427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : hypothetical protein LOC100040427 transcript_id : XM_001475320.1

name	Nat8l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288911 GeneID:269642 MGI:2447776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase 8-like transcript_id : NM_001001985.3

name	Poln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158584 GeneID:272158 MGI:2675617
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA polymerase N transcript_id : NM_181857.2

name	BC023882 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122692 GeneID:231123 MGI:2387633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023882 transcript_id : NM_146159.1

name	Mxd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560565 GeneID:17122 MGI:104991
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Max dimerization protein 4 transcript_id : NM_010753.2

name	Zfyve28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62632712 GeneID:231125 MGI:2684992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 28 transcript_id : NM_001015039.1

name	EG433874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374678 GeneID:433874 MGI:3646114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 9 Proteins product : predicted gene, EG433874 transcript_id : XM_485592.4

name	A830049F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253854 GeneID:319915 MGI:2442971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA A830049F12 gene transcript_id : XM_001475358.1

name	LOC100040061 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253844 GeneID:100040061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100040061 transcript_id : XM_001474014.1

name	Rnf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386312 GeneID:19822 MGI:1201691
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 4 transcript_id : NM_011278.2

name	BC037112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701587 GeneID:231128 MGI:2447768
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC037112 transcript_id : NM_001030306.1

name	LOC100040480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253856 GeneID:100040480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Gapdh protein transcript_id : XM_001475378.1

name	Tnip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892273 GeneID:231130 MGI:2386643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TNFAIP3 interacting protein 2 transcript_id : NM_139064.2

name	Sh3bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981345 GeneID:24055 MGI:1346349
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain binding protein 2 transcript_id : NM_011893.2

name	Add1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129930 GeneID:11518 MGI:87918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adducin 1 (alpha) transcript_id : NM_013457.2

name	Add1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345213 GeneID:11518 MGI:87918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adducin 1 (alpha) transcript_id : NM_001024458.2

name	0610009O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980871 GeneID:68294 MGI:1915544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610009O03 gene transcript_id : NM_026660.2

name	Nol14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158700 GeneID:75416 MGI:1922666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 14 transcript_id : NM_029278.2

name	Gprk2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001567 GeneID:14772 MGI:95801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase 2, groucho gene related (Drosophila) transcript_id : NM_019497.2

name	Gprk2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001565 GeneID:14772 MGI:95801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase 2, groucho gene related (Drosophila) transcript_id : NM_001080743.1

name	Hdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45439303 GeneID:15194 MGI:96067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Huntington disease gene homolog transcript_id : NM_010414.1

name	A930005I04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402310 GeneID:403174 MGI:2684990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930005I04 gene transcript_id : NM_207277.1

name	Rgs12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27777688 GeneID:71729 MGI:1918979
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 12 transcript_id : NM_173402.1

name	Hgfac (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506778 GeneID:54426 MGI:1859281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepatocyte growth factor activator transcript_id : NM_019447.1

name	Dok7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802689 GeneID:231134 MGI:3584043
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : docking protein 7 transcript_id : NM_172708.2

name	Lrpap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63999379 GeneID:16976 MGI:96829
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor-related protein associated protein 1 transcript_id : NM_013587.2

name	Spon2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981611 CCDS:CCDS19200.1 GeneID:100689 MGI:1923724
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : spondin 2, extracellular matrix protein protein_id : NP_598664.2

name	Ctbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304989 CCDS:CCDS19201.1 GeneID:13016 MGI:1201685
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006564 - L-serine biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : C-terminal binding protein 1 protein_id : NP_038530.1

name	Maea (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407043 GeneID:59003 MGI:1891748
definition	codon_start : 1 product : erythroblast macrophage protein protein_id : NP_067475.2

name	4933407H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487376 GeneID:71101 MGI:1918351
definition	codon_start : 1 product : hypothetical protein LOC71101 protein_id : NP_001074570.1

name	LOC672284 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253843 GeneID:672284
definition	codon_start : 1 product : similar to homeodomain protein Sax2 protein_id : XP_001473685.1

name	2410018C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409990 CCDS:CCDS19203.1 GeneID:74504 MGI:1919225
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dorsal neural-tube nuclear protein protein_id : NP_848477.1

name	Slbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677987 CCDS:CCDS19205.1 GeneID:20492 MGI:108402
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006398 - histone mRNA 3'-end processing [Evidence IDA]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 function : RNA binding protein function : involved in histone mRNA metabolism product : stem-loop binding protein protein_id : NP_033219.1

name	Tmem129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73853456 CCDS:CCDS19206.1 GeneID:68366 MGI:1915616
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68366 protein_id : NP_080974.2

name	Tacc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94681040 GeneID:21335 MGI:1341163
definition	GO_component : GO:0005813 - centrosome [Evidence IDA] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0042994 - cytoplasmic sequestering of transcription factor [Evidence IDA]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IGI]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : Arnt interacting protein product : transforming, acidic coiled-coil containing protein 3 protein_id : NP_001035525.1

name	Fgfr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877057 GeneID:14184 MGI:95524
definition	GO_component : GO:0009898 - internal side of plasma membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IDA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0000165 - MAPKKK cascade [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0045597 - positive regulation of cell differentiation [Evidence IMP]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : fibroblast growth factor receptor 3 protein_id : NP_032036.2

name	Letm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789997 CCDS:CCDS19207.1 GeneID:56384 MGI:1932557
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 note : leucine zipper-EF-hand containing transmembrane protein 1 product : leucine zipper-EF-hand containing transmembrane protein 1 protein_id : NP_062668.1

name	LOC100040332 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253851 GeneID:100040332
definition	codon_start : 1 product : similar to 40S ribosomal protein S29 protein_id : XP_001475244.1

name	Whsc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487397 GeneID:107823 MGI:1276574
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : IL5 promoter REII region-binding protein; trithorax/ash1-related protein 5; Wolf-Hirschhorn syndrome candidate 1-like product : Wolf-Hirschhorn syndrome candidate 1 protein_id : NP_001074571.1

name	Whsc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859652 CCDS:CCDS19208.1 GeneID:24116 MGI:1346098
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Wolf-Hirschhorn syndrome candidate 2 homolog protein_id : NP_036044.1

name	Gm1673 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701981 CCDS:CCDS19209.1 GeneID:381633 MGI:2686519
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381633 protein_id : NP_001028630.1

name	LOC100040427 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253853 GeneID:100040427
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475370.1

name	Nat8l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288912 CCDS:CCDS19210.1 GeneID:269642 MGI:2447776
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : N-acetyltransferase 8-like protein_id : NP_001001985.3

name	Poln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309579 GeneID:272158 MGI:2675617
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence ISS] [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006261 - DNA-dependent DNA replication [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : DNA polymerase N protein_id : NP_862905.1

name	BC023882 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122693 CCDS:CCDS19211.1 GeneID:231123 MGI:2387633
definition	codon_start : 1 product : hypothetical protein LOC231123 protein_id : NP_666271.1

name	Mxd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560566 CCDS:CCDS19212.1 GeneID:17122 MGI:104991
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Max dimerization protein 4 protein_id : NP_034883.2

name	Zfyve28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62632713 GeneID:231125 MGI:2684992
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : zinc finger, FYVE domain containing 28 protein_id : NP_001015039.1

name	EG433874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897342 GeneID:433874 MGI:3646114
definition	codon_start : 1 product : similar to Ormdl2 protein protein_id : XP_485592.3

name	LOC100040061 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253845 GeneID:100040061
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474064.1

name	A830049F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253855 GeneID:319915 MGI:2442971
definition	codon_start : 1 product : hypothetical protein LOC319915 protein_id : XP_001475408.1

name	Rnf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859620 GeneID:19822 MGI:1201691
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : ring finger protein 4 protein_id : NP_035408.1

name	BC037112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701588 CCDS:CCDS19213.1 GeneID:231128 MGI:2447768
definition	codon_start : 1 product : hypothetical protein LOC231128 protein_id : NP_001025477.1

name	LOC100040480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253857 GeneID:100040480
definition	codon_start : 1 product : similar to Gapdh protein protein_id : XP_001475428.1

name	Tnip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20532344 CCDS:CCDS19214.1 GeneID:231130 MGI:2386643
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence IDA] codon_start : 1 note : A20 binding inhibitor of NF-kappaB activation-2 product : TNFAIP3 interacting protein 2 protein_id : NP_620703.1

name	Sh3bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981346 CCDS:CCDS19215.1 GeneID:24055 MGI:1346349
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SH3-domain binding protein 2 protein_id : NP_036023.2

name	Add1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792810 CCDS:CCDS19216.1 GeneID:11518 MGI:87918
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : adducin 1 (alpha) isoform 1 protein_id : NP_001019629.1

name	Add1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304861 GeneID:11518 MGI:87918
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : adducin 1 (alpha) isoform 2 protein_id : NP_038485.1

name	0610009O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386144 CCDS:CCDS19217.1 GeneID:68294 MGI:1915544
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : tetracycline transporter-like protein protein_id : NP_080936.1

name	Nol14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158701 CCDS:CCDS19218.1 GeneID:75416 MGI:1922666
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : probable nucleolar complex protein 14 protein_id : NP_083554.2

name	Gprk2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001568 CCDS:CCDS19219.1 GeneID:14772 MGI:95801
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; G protein-coupled receptor kinase 4 product : G protein-coupled receptor kinase 2, groucho gene related isoform 1 protein_id : NP_062370.2

name	Gprk2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001566 GeneID:14772 MGI:95801
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; G protein-coupled receptor kinase 4 product : G protein-coupled receptor kinase 2, groucho gene related isoform 2 protein_id : NP_001074212.1

name	Hdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45439304 CCDS:CCDS19220.1 GeneID:15194 MGI:96067
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016234 - inclusion body [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0048341 - paraxial mesoderm formation [Evidence IMP]; GO:0047496 - vesicle transport along microtubule [Evidence IDA] codon_start : 1 product : huntingtin protein_id : NP_034544.1

name	A930005I04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402311 CCDS:CCDS19221.1 GeneID:403174 MGI:2684990
definition	codon_start : 1 product : hypothetical protein LOC403174 protein_id : NP_997160.1

name	Rgs12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777689 CCDS:CCDS19222.1 GeneID:71729 MGI:1918979
definition	codon_start : 1 exception : mismatches in translation product : regulator of G-protein signalling 12 protein_id : NP_775578.1

name	Hgfac (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506779 CCDS:CCDS19223.1 GeneID:54426 MGI:1859281
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hepatocyte growth factor activator protein_id : NP_062320.1

name	Dok7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370024 CCDS:CCDS19224.1 GeneID:231134 MGI:3584043
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0031594 - neuromuscular junction [Evidence IDA]; GO:0045202 - synapse [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007528 - neuromuscular junction development [Evidence IGI] [Evidence IDA]; GO:0001934 - positive regulation of protein amino acid phosphorylation [Evidence IMP]; GO:0043113 - receptor clustering [Evidence IGI] [Evidence IDA] codon_start : 1 product : downstream of tyrosine kinase 7 protein_id : NP_766296.1

name	Lrpap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63999380 CCDS:CCDS19225.1 GeneID:16976 MGI:96829
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0008201 - heparin binding [Evidence IEA]; GO:0050750 - low-density lipoprotein receptor binding [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : low density lipoprotein receptor related protein, associated protein 1 product : low density lipoprotein receptor-related protein associated protein 1 protein_id : NP_038615.2

clone name	MSMg01-120I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143H17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-066M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541K13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-406M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-292M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-367C04.T7 (MSMg01no367_c04.b1)	MSMg01-367C04.TJ (MSMg01no367_c04.g1)
ACC	AG474680	AG474681
length	832	943
length of high quality (start - end)	---	162 (151 - 312)
definition	CHROMAT_FILE: MSMg01no367_c04.b1 PHD_FILE: MSMg01no367_c04.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:04:12 2005	CHROMAT_FILE: MSMg01no367_c04.g1 PHD_FILE: MSMg01no367_c04.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:04:12 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NTGCCTCGTCCTTTNTTTNTAACAANNCNCCNCCCTCCCCCCTCCCNNNA GGCNCCNNNNNCNNCCGCCCCCCAAAGTAAGGGTGCCTTAGTTGTCGGTA GAGGGGGGNTGTGNCCTTGGTGCCCCTTTNTCCTCGTTNNCCCCTCCCCC TCTTCCTCTCCCGTGGCGTCCCTCGGTCCTCCCTCCCTTGCCTTAGTCTT TTCCCTTCCCCTTCCTCTCTCCTCCCCTTTCCTCTAGACTTCTATCCCTC CTTCGGTAGCCCGCCNNNNNCTCCNNNCAACAGGAAGGGGATGGAGGGAG GGGNNNTGNNNGGGGGTCTTGGGGGGTCGGAGAAAAANATTTTGGCGGGA CCCGGCCTAGATAACGGAACGTTCACCTATTATCCCCCNNANAAGGNNNA NAGCAGGCGGNGGNAATTTCCTGGATGCCTTGTAATCCCCCCCGGCATCC CTTTTCAGGAAACAGGTAACACCTGGAAAAGGTCCAGGGTTATTTGGCCT AGCCAAAAGCCTTCCAGNTGGGGCCCCCCTTTTCCCCCACCCTTCAAAAG GAAGGGTTTCCCCCCCAAAAAAAGGGGCTATTTTGTGGTTGTGCGTTTGG GAAGCCCCCCTCCTGAGAGGGAAAAAAAAGGGGGGGGAAGGGGGGGGAGA GGCAAGGGCTTGGGCTATTTCTCAAGGGGCCCAAAACCCCCCTAAAAAAA ACCCCCCCCCGGGGGGGCCCCGGGGGGGGGCCCCCCCCGGGGGGGAAAAA TTTTTTCCCCCCCCGGGGGGTCCCCGCGGGGGGGGGGCCCCCCCAAAAGA TCCCCCCCCCCCCCACCCAAAAATAAAAGGGG	TGGAGGAGGGAGGGGAGGAGGAAGAGAGAGGAGAGGAGAGTGTAGAGGGA GGAGAGAGAGTGGAGTGGTGGCACAATGGATAAGXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX AGGGCACATCAGGAGCCCTGGAGTTGTGGGTCCTTTAAACAAAGTCCTGT GCTAAGGGTAGGTGTGCTGGGGAGGTGCTTGGGCAGACACTGAAGCGCCC AGATGGGCAGAAAATGTTGACAGAACCAGCTTACTAGGATGTTGACGATC TTTCCTGGAGACANCCNTACTCCTAGGCCCTGCTGTCCACCTGTCATTCT GAGTGCCCACAGAGCAGGTTCTATGCCAGAGCTGTCTCCGGGAACCTCAT TCTTGCCTATCAGTTAGGCCTCTTCACCTTATGATGGCTCATTTGGTCAT GGACTGACACAATAAAACTAATGAAATTTTCCCCCCACCTATTTTTGGGA AAAAATTTGTTTTTTACTAAATTGGTTCCATTAAGTTAATGTCGTTTTAT TTCTGCTTGGTTGTGTGGGCCCTCCCCCCCCCCTTTGGCCNCNNCTAATA GCGATGTGGAATNNNNCNNTGCTAGGAGGAGGGCCGCCTTAGAATTTCAC TCTTATTGTCTTTTTGAGTGATTTTCTTTTGAGGGGTCTTTTTTTTCTAT TCTCTCTTTCCTTGTTTTTATCATCTATGGTTTTAGTTGATATTACCACA CATCTTTTAGCTTTCGCGTCTTCTCTGTTCCTATAGATCTGTCGTTGTAT TAATGTGTTTTAGGCCTATACCAATCTATCCAAGTTCTTCTTTCTTCTAT TCTCTTCTATCGTGTCGTTGTTCCCCATTTTTCGTTTTTACAATTATCTC TGTCTGTTCTACCGTTATCATCTACCATCCTTGTGTAGCCAGA
quality values	Open. Hide. 0 3 6 6 8 6 6 8 6 6 8 8 8 3 0 3 11 3 0 3 17 6 6 6 3 0 0 3 0 3 3 0 3 7 6 8 8 8 12 12 17 8 8 8 8 3 0 0 0 3 6 7 3 0 3 3 0 0 0 0 0 3 0 0 3 6 6 8 8 8 13 12 13 7 7 6 6 6 6 6 6 8 8 9 9 9 6 10 9 9 9 9 8 8 8 8 8 8 8 8 9 9 10 12 11 9 12 3 0 3 8 8 3 0 3 7 8 8 8 8 8 8 19 19 21 21 18 23 3 0 3 9 10 8 10 8 8 3 0 0 3 7 7 17 13 8 17 15 14 8 10 8 8 10 10 10 11 10 10 9 10 8 6 6 8 8 10 10 8 8 8 8 10 9 9 10 10 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 8 8 11 8 10 11 11 11 10 10 10 19 10 10 10 8 8 8 13 8 8 11 13 10 10 8 8 8 8 8 8 8 17 11 11 10 10 11 8 8 8 8 8 6 6 6 6 8 10 8 6 6 8 8 10 9 9 9 10 10 10 12 11 11 10 8 6 7 6 6 8 3 0 0 0 0 0 3 8 8 3 0 0 0 3 7 6 6 6 6 6 6 6 6 8 10 9 9 9 8 8 8 8 8 8 9 9 8 8 3 0 0 0 3 3 0 0 0 3 12 12 8 8 6 6 8 6 6 6 6 6 6 8 8 8 10 12 8 8 8 8 10 13 3 0 3 9 15 9 10 10 9 9 9 12 7 6 6 6 6 6 6 6 8 8 6 6 8 8 8 8 8 6 8 8 8 10 11 10 12 14 15 9 9 10 10 9 10 9 9 11 11 10 10 3 0 0 3 0 3 9 12 3 0 0 0 3 0 3 6 6 6 6 6 8 8 3 0 3 3 0 3 8 8 10 25 26 26 16 17 9 9 9 9 10 9 9 6 6 6 6 6 6 6 9 9 17 15 9 8 8 8 8 8 8 8 9 9 8 8 8 8 6 8 8 8 8 12 8 8 8 8 9 10 9 10 10 10 8 8 8 9 9 9 10 12 15 15 14 15 15 16 12 9 8 8 8 8 8 8 8 11 11 8 8 8 8 11 8 8 8 8 8 8 10 7 6 6 6 6 6 6 6 3 0 3 6 7 7 12 11 11 21 21 25 16 16 10 14 9 9 9 11 10 10 10 8 10 8 8 8 8 10 10 8 8 8 8 8 8 13 13 12 12 10 8 8 8 8 9 9 14 16 16 12 14 9 9 9 9 8 8 7 6 6 6 6 10 8 7 6 6 6 6 6 6 6 6 6 6 6 9 10 10 10 10 23 17 10 10 9 9 14 17 17 15 11 9 6 6 6 6 6 6 6 8 6 6 6 8 9 15 15 18 15 12 19 19 22 31 37 25 22 11 11 12 14 14 25 24 20 14 12 8 8 8 6 10 8 8 8 8 8 11 10 9 9 9 9 13 12 8 8 8 8 7 6 6 6 8 8 11 10 20 19 17 12 12 12 12 11 10 10 11 12 12 11 10 10 10 10 9 14 17 19 19 11 9 9 11 14 13 15 18 21 16 15 13 11 12 10 10 10 9 11 10 10 10 11 17 18 22 19 10 9 9 9 9 12 18 29 22 15 10 10 10 10 12 17 16 14 12 11 10 11 10 12 12 13 18 21 14 10 10 10 14 22 29 16 15 12 12 12 11 11 8 8 8 8 9 7 6 6 6 6 6 13 18 16 18 24 10 8 7 7 8 17 21 23 14 13 13 11 13 11 11 11 11 11 12 11 11 14 16 16 14 13 13 10 13 8 6 6 10 10 14 14 10 10 8 8 8 8 10 13 12 12 15 15	Open. Hide. 8 8 8 8 6 6 6 6 10 8 11 11 17 9 9 9 11 10 10 10 9 8 8 6 6 8 8 10 13 12 17 17 9 9 9 10 10 10 14 9 15 12 9 9 12 13 10 13 6 6 8 8 10 10 19 17 20 11 15 8 12 8 8 8 8 10 10 8 9 9 9 8 9 9 6 6 6 6 6 8 10 9 13 9 8 10 8 8 8 15 13 22 21 27 24 24 21 15 23 14 12 17 15 17 10 10 9 9 9 15 17 23 22 19 22 18 28 22 36 32 38 36 36 35 30 30 28 44 41 59 41 27 23 9 12 8 9 9 19 19 25 43 37 39 29 29 28 28 25 29 39 50 50 50 50 50 43 48 48 48 42 42 42 47 47 47 68 57 48 36 41 41 42 42 68 68 68 68 68 57 57 59 59 68 59 59 54 54 54 54 54 54 57 59 54 54 57 59 57 68 68 68 68 68 68 57 57 57 57 57 57 57 59 59 54 54 57 57 59 57 57 57 57 57 57 57 57 57 57 59 59 57 47 42 42 37 43 37 37 37 44 42 37 37 37 46 44 47 47 47 47 47 47 43 43 28 30 30 41 41 44 28 28 35 47 44 68 68 68 68 68 68 68 68 57 57 57 57 59 54 57 57 57 57 57 57 50 48 48 47 47 47 57 57 57 57 57 57 57 57 57 59 59 59 48 46 40 41 41 39 23 10 3 0 3 3 0 3 15 8 6 6 6 6 6 15 19 15 10 10 12 16 25 34 34 39 34 32 28 35 33 37 37 48 48 48 48 57 59 57 57 34 28 13 13 19 21 23 28 28 30 24 24 14 14 14 21 23 37 32 43 39 43 40 35 28 28 23 23 23 32 31 31 19 19 11 18 21 22 18 25 15 12 15 13 15 21 22 22 16 22 15 10 9 8 10 10 17 21 29 30 19 25 18 18 12 13 13 14 8 12 10 8 8 8 9 8 13 9 10 9 9 9 10 8 9 8 9 8 10 10 15 9 9 6 7 13 8 8 8 10 10 12 13 10 12 8 8 8 8 8 8 10 9 8 8 9 9 10 8 8 7 7 12 9 14 17 19 11 9 10 10 10 10 8 8 10 10 11 8 9 9 9 9 9 18 11 14 11 11 11 17 14 10 8 8 10 10 13 19 34 27 17 10 6 6 6 6 8 8 15 10 8 8 8 10 10 8 8 6 6 8 6 8 11 12 10 8 6 6 6 10 8 8 8 8 8 10 8 10 8 8 8 8 8 8 8 13 10 10 10 9 9 8 8 6 6 8 8 8 8 8 12 10 10 19 23 10 16 17 13 8 12 19 8 8 10 8 8 3 0 3 0 0 3 6 6 6 6 9 9 6 6 6 7 6 6 8 7 8 9 3 0 0 0 0 3 0 0 3 6 6 7 9 6 8 6 6 6 6 7 10 18 14 12 12 11 13 13 11 8 8 9 9 19 13 8 6 8 8 11 13 20 10 13 8 7 8 7 9 9 12 12 16 9 8 8 7 6 6 6 8 10 8 8 10 8 9 9 10 8 8 8 8 8 8 8 6 6 8 10 10 10 9 9 8 8 8 10 10 8 8 8 8 8 8 8 8 6 6 8 8 8 8 9 9 9 8 8 8 8 8 8 8 10 10 14 10 15 8 8 8 7 8 6 6 8 10 9 10 9 9 9 8 9 8 8 8 8 6 6 8 8 12 10 11 8 8 8 8 8 10 18 17 13 16 11 16 11 10 12 12 12 8 8 8 11 12 11 10 10 10 10 8 6 7 8 8 8 8 8 8 8 8 8 8 8 10 10 8 10 8 8 8 8 8 8 8 10 14 13 6 6 8 8 8 8 10 8 8 8 8 8 9 8 8 8 8 8 10 8 6 6 6 6 6 6 9 9 9 10 10 10 8 8 8 8 8 6 6 6 7 8 10 11 10 8 8 9 9 9 11 11 10 10 10 10 10 10 12 15 15 15 15 12 11 11 11 11 15 16 8 8 8 8 8 11 12 8 8 8 8 8 12 9 8 8 11 8 8 8 10 8 10 8 7 7 6 6 10 11 11 11 8 8 12 10 8 8 8 8 8 6 8 8 8 8 8 8 8 9 9 11 12 15 8 8 6 7 8 8 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no367_c04.g1 MSMg01no367_c04.g1 CHROMAT_FILE:
MSMg01no367_c04.g1 PHD_FILE: MSMg01no367_c04.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:04:12 2005
         (162 letters)



>mm_chr5_34517309_34517870
          Length = 562

 Score =  306 bits (158), Expect = 6e-88
 Identities = 161/162 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   agggcacatcaggagccctggagttgtgggtcctttaaacaaagtcctgtgctaagggta 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agggcacatcaggagccctggagttgtgggtcctttaaacaaagtcctgtgctaagggta 260

                                                                       
Query: 61  ggtgtgctggggaggtgcttgggcagacactgaagcgcccagatgggcagaaaatgttga 120
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 261 ggtgtgctggggaggtgcttgggcagacactgaagtgcccagatgggcagaaaatgttga 320

                                                     
Query: 121 cagaaccagcttactaggatgttgacgatctttcctggagac 162
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cagaaccagcttactaggatgttgacgatctttcctggagac 362


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 162
Length of database: 562
Length adjustment: 8
Effective length of query: 154
Effective length of database: 554
Effective search space:    85316
Effective search space used:    85316
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information