MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-509B08
Chromosome	5 (Build37)
Map Location	123,017,349 - 123,017,886
singlet/doublet	singlet
Overlap gene	Ift81
Upstream gene	Aldh2, 9330129D05Rik, Acad10, Brap, Atxn2, Sh2b3, A230106M15Rik, Cutl2, LOC100042693, Myl2, Ccdc63, Ppp1cc, Hvcn1, Tect1, Pptc7, Rad9b, Vps29, 1500011H22Rik, Atpbd1c, Arpc3, Anapc7, Atp2a2
Downstream gene	P2rx7, P2rx4, Camkk2, Anapc5, Rnf34, Fbxl10, LOC100039895, Tmem142a, Morn3, LOC623672, BC022593, Rhof, 4932422M17Rik, Setd1b, Hpd, Psmd9, Wdr66, LOC100042824, Bcl7a, Mlxip, LOC673222, Il31, Lrrc43, B3gnt4, Diablo, Vps33a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aldh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11669 MGI:99600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9330129D05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338350 MGI:2443320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 5 Proteins

name	Acad10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71985 MGI:1919235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72399 MGI:1919649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atxn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20239 MGI:1277223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16923 MGI:893598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230106M15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231717 MGI:2442708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cutl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13048 MGI:107321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042693 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Myl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17906 MGI:97272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330188 MGI:3607777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1cc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19047 MGI:104872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hvcn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74096 MGI:1921346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tect1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pptc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320717 MGI:2444593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231724 MGI:2385231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56433 MGI:1928344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500011H22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68948 MGI:1916198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpbd1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68080 MGI:1289326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56378 MGI:1928375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anapc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56317 MGI:1929711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11938 MGI:88110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ift81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12589 MGI:1098597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18439 MGI:1339957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	P2rx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18438 MGI:1338859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camkk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207565 MGI:2444812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anapc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59008 MGI:1929722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rnf34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80751 MGI:2153340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30841 MGI:1354737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100039895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Tmem142a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109305 MGI:1925542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74890 MGI:1922140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 238 ESTs, 6 Proteins pseudo : _no_value

name	BC022593 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330189 MGI:3603158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhof (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23912 MGI:1345629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932422M17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74366 MGI:1921616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs

name	Setd1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208043 MGI:2652820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15445 MGI:96213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67151 MGI:1914401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr66 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269701 MGI:1918495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 29 Proteins

name	LOC100042824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 543 ESTs, 5 Proteins

name	Bcl7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77045 MGI:1924295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlxip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208104 MGI:2141183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC673222 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Il31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76399 MGI:1923649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 1 Protein

name	Lrrc43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381741 MGI:2685907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231727 MGI:2680208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Diablo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66593 MGI:1913843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps33a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77573 MGI:1924823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371450 GeneID:11669 MGI:99600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 2, mitochondrial transcript_id : NM_009656.3

name	9330129D05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375630 GeneID:338350 MGI:2443320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 5 Proteins product : RIKEN cDNA 9330129D05 gene, transcript variant 1 transcript_id : XM_488540.4

name	Acad10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351050 GeneID:71985 MGI:1919235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase family, member 10 transcript_id : NM_028037.2

name	Brap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608138 GeneID:72399 MGI:1919649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BRCA1 associated protein transcript_id : NM_028227.2

name	Atxn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244103 GeneID:20239 MGI:1277223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxin 2 transcript_id : NM_009125.2

name	Sh2b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802577 GeneID:16923 MGI:893598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2B adaptor protein 3 transcript_id : NM_008507.3

name	A230106M15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385230 GeneID:231717 MGI:2442708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230106M15 gene transcript_id : NM_175474.3

name	Cutl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789276 GeneID:13048 MGI:107321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cut-like 2 (Drosophila) transcript_id : NM_007804.2

name	LOC100042693 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254575 GeneID:100042693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042693 transcript_id : XM_001479641.1

name	Myl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657924 GeneID:17906 MGI:97272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 2, regulatory, cardiac, slow transcript_id : NM_010861.2

name	Ccdc63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803026 GeneID:330188 MGI:3607777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 63 transcript_id : NM_183307.2

name	Ppp1cc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130839 GeneID:19047 MGI:104872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, catalytic subunit, gamma isoform transcript_id : NM_013636.3

name	Hvcn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809756 GeneID:74096 MGI:1921346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydrogen voltage-gated channel 1 transcript_id : NM_001042489.1

name	Hvcn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809754 GeneID:74096 MGI:1921346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydrogen voltage-gated channel 1 transcript_id : NM_028752.2

name	Tect1 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:109809734 GeneID:654470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tectonic 1 transcript_id : NM_001039153.2

name	Pptc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130366 GeneID:320717 MGI:2444593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PTC7 protein phosphatase homolog (S. cerevisiae) transcript_id : NM_177242.4

name	Rad9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130068 GeneID:231724 MGI:2385231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD9 homolog B (S. cerevisiae) transcript_id : NM_144912.3

name	Vps29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790284 GeneID:56433 MGI:1928344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 29 (S. pombe) transcript_id : NM_019780.1

name	1500011H22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354512 GeneID:68948 MGI:1916198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500011H22 gene transcript_id : NM_026883.2

name	Atpbd1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312641 GeneID:68080 MGI:1289326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP binding domain 1 family, member C transcript_id : NM_024216.1

name	Arpc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361460 GeneID:56378 MGI:1928375
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 3 transcript_id : NM_019824.3

name	Anapc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387395 GeneID:56317 MGI:1929711
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase promoting complex subunit 7 transcript_id : NM_019805.3

name	Atp2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386634 GeneID:11938 MGI:88110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 transcript_id : NM_009722.2

name	Ift81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15638941 GeneID:12589 MGI:1098597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intraflagellar transport 81 homolog (Chlamydomonas) transcript_id : NM_009879.2

name	P2rx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130974 GeneID:18439 MGI:1339957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 7 transcript_id : NM_001038845.2

name	P2rx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781765 GeneID:18439 MGI:1339957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 7 transcript_id : NM_011027.2

name	P2rx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781761 GeneID:18439 MGI:1339957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 7 transcript_id : NM_001038839.1

name	P2rx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781763 GeneID:18439 MGI:1339957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 7 transcript_id : NM_001038887.1

name	P2rx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676373 GeneID:18438 MGI:1338859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel 4 transcript_id : NM_011026.2

name	Camkk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703721 GeneID:207565 MGI:2444812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase kinase 2, beta transcript_id : NM_145358.1

name	Anapc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809752 GeneID:59008 MGI:1929722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase-promoting complex subunit 5 transcript_id : NM_001042491.1

name	Anapc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809750 GeneID:59008 MGI:1929722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase-promoting complex subunit 5 transcript_id : NM_021505.2

name	Rnf34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385489 GeneID:80751 MGI:2153340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 34 transcript_id : NM_030564.1

name	Fbxl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607021 GeneID:30841 MGI:1354737
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 10 transcript_id : NM_001003953.1

name	Fbxl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607023 GeneID:30841 MGI:1354737
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 10 transcript_id : NM_001005866.1

name	Fbxl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607025 GeneID:30841 MGI:1354737
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 10 transcript_id : NM_013910.2

name	LOC100039895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254557 GeneID:100039895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039895 transcript_id : XM_001473736.1

name	Tmem142a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93277106 GeneID:109305 MGI:1925542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 142A transcript_id : NM_175423.3

name	Morn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626065 GeneID:74890 MGI:1922140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MORN repeat containing 3 transcript_id : NM_029112.1

name	BC022593 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:105554532 GeneID:330189 MGI:3603158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC022593 transcript_id : NM_001039723.2

name	Rhof (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:101943786 GeneID:23912 MGI:1345629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member f transcript_id : NM_175092.3

name	4932422M17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254559 GeneID:74366 MGI:1921616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : RIKEN cDNA 4932422M17 gene transcript_id : XM_001473799.1

name	Setd1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94536714 GeneID:208043 MGI:2652820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain containing 1B transcript_id : NM_001040398.1

name	Hpd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803320 GeneID:15445 MGI:96213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 4-hydroxyphenylpyruvic acid dioxygenase transcript_id : NM_008277.2

name	Psmd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508440 GeneID:67151 MGI:1914401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 transcript_id : NM_026000.2

name	Wdr66 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254561 GeneID:269701 MGI:1918495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 29 Proteins product : WD repeat domain 66 transcript_id : XM_485681.5

name	LOC100042824 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254578 GeneID:100042824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 543 ESTs, 5 Proteins product : similar to ribosomal protein L35a transcript_id : XM_001479819.1

name	Bcl7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542219 GeneID:77045 MGI:1924295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 7A transcript_id : NM_029850.2

name	Mlxip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849804 GeneID:208104 MGI:2141183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MLX interacting protein transcript_id : NM_177582.1

name	Mlxip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776544 GeneID:208104 MGI:2141183
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MLX interacting protein transcript_id : NM_133917.1

name	Il31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375601 GeneID:76399 MGI:1923649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 1 Protein product : interleukin 31 transcript_id : XM_132344.6

name	Lrrc43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802033 GeneID:381741 MGI:2685907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 43 transcript_id : NM_001033461.2

name	B3gnt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348467 GeneID:231727 MGI:2680208
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4 transcript_id : NM_198611.1

name	Diablo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677503 GeneID:66593 MGI:1913843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diablo homolog (Drosophila) transcript_id : NM_023232.3

name	Vps33a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543949 GeneID:77573 MGI:1924823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 33A (yeast) transcript_id : NM_029929.2

name	Aldh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753036 CCDS:CCDS19638.1 GeneID:11669 MGI:99600
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0004029 - aldehyde dehydrogenase (NAD) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : aldehyde dehydrogenase 2, mitochondrial protein_id : NP_033786.1

name	9330129D05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899437 GeneID:338350 MGI:2443320
definition	codon_start : 1 product : hypothetical protein LOC338350 isoform 1 protein_id : XP_488540.2

name	Acad10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794396 GeneID:71985 MGI:1919235
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : acyl-Coenzyme A dehydrogenase family, member 10 protein_id : NP_082313.1

name	Brap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608139 CCDS:CCDS19640.1 GeneID:72399 MGI:1919649
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008139 - nuclear localization sequence binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000165 - MAPKKK cascade [Evidence ISS]; GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : BRCA1 associated protein protein_id : NP_082503.2

name	Atxn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244104 GeneID:20239 MGI:1277223
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0050692 - DBD domain binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2); spinocerebellar ataxia 2 homolog product : ataxin 2 protein_id : NP_033151.2

name	Sh2b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678706 CCDS:CCDS19641.1 GeneID:16923 MGI:893598
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IDA] [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IDA] codon_start : 1 product : linker of T-cell receptor pathways protein_id : NP_032533.1

name	A230106M15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425218 CCDS:CCDS19642.1 GeneID:231717 MGI:2442708
definition	codon_start : 1 product : hypothetical protein LOC231717 protein_id : NP_780683.1

name	Cutl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789277 GeneID:13048 MGI:107321
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cut-like 2 protein_id : NP_031830.2

name	LOC100042693 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254576 GeneID:100042693
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479691.1

name	Myl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657925 GeneID:17906 MGI:97272
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myosin light chain, phosphorylatable, cardiac ventricles; ventricular myosin regulatory light chain; myosin light chain 2v product : myosin, light polypeptide 2, regulatory, cardiac, slow protein_id : NP_034991.2

name	Ccdc63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34303985 GeneID:330188 MGI:3607777
definition	codon_start : 1 product : coiled-coil domain containing 63 protein_id : NP_899130.1

name	Ppp1cc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980772 CCDS:CCDS19643.1 GeneID:19047 MGI:104872
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0000163 - protein phosphatase type 1 activity [Evidence IDA] [Evidence IMP] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 note : PP1C gamma; PP1C gamma 1; PP1C gamma 2 product : protein phosphatase 1, catalytic subunit, gamma isoform protein_id : NP_038664.2

name	Hvcn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109809757 GeneID:74096 MGI:1921346
definition	GO_component : GO:0016021 - integral to membrane [Evidence IC] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030171 - voltage-gated proton channel activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IDA]; GO:0009268 - response to pH [Evidence IDA]; GO:0010043 - response to zinc ion [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hydrogen voltage-gated channel 1 protein_id : NP_001035954.1

name	Hvcn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311863 CCDS:CCDS19644.1 GeneID:74096 MGI:1921346
definition	GO_component : GO:0016021 - integral to membrane [Evidence IC] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030171 - voltage-gated proton channel activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IDA]; GO:0009268 - response to pH [Evidence IDA]; GO:0010043 - response to zinc ion [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hydrogen voltage-gated channel 1 protein_id : NP_083028.1

name	Tect1 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:109809735 GeneID:654470
definition	codon_start : 1 note : essential modulator of Hedgehog signal transduction; tectonic product : tectonic 1 protein_id : NP_001034242.2

name	Pptc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195809 GeneID:320717 MGI:2444593
definition	GO_function : GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] codon_start : 1 product : T-cell activation protein phosphatase 2C protein_id : NP_796216.2

name	Rad9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649727 CCDS:CCDS19646.1 GeneID:231724 MGI:2385231
definition	GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : RAD9 homolog B protein_id : NP_659161.2

name	Vps29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790285 GeneID:56433 MGI:1928344
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] GO_process : GO:0006896 - Golgi to vacuole transport [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vacuolar sorting protein 29 product : vacuolar protein sorting 29 protein_id : NP_062754.1

name	1500011H22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312149 GeneID:68948 MGI:1916198
definition	codon_start : 1 product : hypothetical protein LOC68948 protein_id : NP_081159.1

name	Atpbd1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312642 CCDS:CCDS19647.1 GeneID:68080 MGI:1289326
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : protein x 0004 product : ATP binding domain 1 family, member C protein_id : NP_077178.1

name	Arpc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790141 CCDS:CCDS19648.1 GeneID:56378 MGI:1928375
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_process : GO:0030833 - regulation of actin filament polymerization [Evidence IEA] codon_start : 1 note : actin related protein 2/3 complex, subunit 3 (21 kDa); Arp2/3 complex subunit p21-Arc product : actin related protein 2/3 complex, subunit 3 protein_id : NP_062798.1

name	Anapc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980982 CCDS:CCDS19649.1 GeneID:56317 MGI:1929711
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : prediabetic NOD sera-reactive autoantigen product : anaphase-promoting complex subunit 7 protein_id : NP_062779.2

name	Atp2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6806903 GeneID:11938 MGI:88110
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0016529 - sarcoplasmic reticulum [Evidence TAS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP] [Evidence IDA] [Evidence IGI]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0002026 - cardiac inotropy [Evidence IGI]; GO:0006812 - cation transport [Evidence IEA]; GO:0006984 - ER-nuclear signaling pathway [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0045822 - negative regulation of heart contraction [Evidence IGI]; GO:0006937 - regulation of muscle contraction [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 function : Ca2+ transporting ATPase note : sarco/endoplasmic reticulum Ca2+-ATPase 2 product : ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 protein_id : NP_033852.1

name	Ift81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15638942 CCDS:CCDS19650.1 GeneID:12589 MGI:1098597
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEP] [Evidence IEA] codon_start : 1 product : carnitine deficiency-associated gene expressed in ventricle 1 protein_id : NP_034009.2

name	P2rx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781760 CCDS:CCDS19651.1 GeneID:18439 MGI:1339957
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IMP] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IMP]; GO:0004931 - ATP-gated cation channel activity [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IMP] GO_process : GO:0006812 - cation transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0045779 - negative regulation of bone resorption [Evidence IMP]; GO:0030501 - positive regulation of bone mineralization [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; P2X7 receptor product : purinergic receptor P2X7 isoform b protein_id : NP_001033934.1

name	P2rx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781762 GeneID:18439 MGI:1339957
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IMP] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IMP]; GO:0004931 - ATP-gated cation channel activity [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IMP] GO_process : GO:0006812 - cation transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0045779 - negative regulation of bone resorption [Evidence IMP]; GO:0030501 - positive regulation of bone mineralization [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; P2X7 receptor product : purinergic receptor P2X7 isoform c protein_id : NP_001033928.1

name	P2rx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781766 CCDS:CCDS19652.1 GeneID:18439 MGI:1339957
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IMP] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IMP]; GO:0004931 - ATP-gated cation channel activity [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IMP] GO_process : GO:0006812 - cation transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0045779 - negative regulation of bone resorption [Evidence IMP]; GO:0030501 - positive regulation of bone mineralization [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; P2X7 receptor product : purinergic receptor P2X7 isoform a protein_id : NP_035157.2

name	P2rx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781764 CCDS:CCDS19653.1 GeneID:18439 MGI:1339957
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IMP] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IMP]; GO:0004931 - ATP-gated cation channel activity [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IMP] GO_process : GO:0006812 - cation transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0045779 - negative regulation of bone resorption [Evidence IMP]; GO:0030501 - positive regulation of bone mineralization [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform d is encoded by transcript variant 4; P2X7 receptor product : purinergic receptor P2X7 isoform d protein_id : NP_001033976.1

name	P2rx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676374 CCDS:CCDS19654.1 GeneID:18438 MGI:1338859
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004931 - ATP-gated cation channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ionotropic purinergic receptor product : purinergic receptor P2X, ligand-gated ion channel 4 protein_id : NP_035156.2

name	Camkk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703722 CCDS:CCDS19655.1 GeneID:207565 MGI:2444812
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence ISS]; GO:0004685 - calcium- and calmodulin-dependent protein kinase activity [Evidence ISS]; GO:0005516 - calmodulin binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0019722 - calcium-mediated signaling [Evidence ISS]; GO:0000165 - MAPKKK cascade [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0046777 - protein amino acid autophosphorylation [Evidence ISS]; GO:0045859 - regulation of protein kinase activity [Evidence ISS] codon_start : 1 product : calcium/calmodulin-dependent protein kinase kinase 2, beta protein_id : NP_663333.1

name	Anapc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109809753 GeneID:59008 MGI:1929722
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : anaphase-promoting complex subunit 5 isoform b protein_id : NP_001035956.1

name	Anapc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109809751 GeneID:59008 MGI:1929722
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : anaphase-promoting complex subunit 5 isoform a protein_id : NP_067480.2

name	Rnf34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385490 CCDS:CCDS19656.1 GeneID:80751 MGI:2153340
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : phafin 1 product : ring finger protein 34 protein_id : NP_085041.1

name	Fbxl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607022 GeneID:30841 MGI:1354737
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; F-box protein containing leucine repeats 10 product : F-box and leucine-rich repeat protein 10 isoform 1 protein_id : NP_001003953.1

name	Fbxl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607024 GeneID:30841 MGI:1354737
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; F-box protein containing leucine repeats 10 product : F-box and leucine-rich repeat protein 10 isoform 3 protein_id : NP_001005866.1

name	Fbxl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930339 CCDS:CCDS19657.1 GeneID:30841 MGI:1354737
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; F-box protein containing leucine repeats 10 product : F-box and leucine-rich repeat protein 10 isoform 2 protein_id : NP_038938.1

name	LOC100039895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254558 GeneID:100039895
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473786.1

name	Tmem142a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425136 GeneID:109305 MGI:1925542
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0015279 - store-operated calcium channel activity [Evidence ISS] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0051928 - positive regulation of calcium ion transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : calcium release-activated calcium channel protein 1; calcium release-activated calcium channel 1 product : transmembrane protein 142A protein_id : NP_780632.1

name	Morn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626066 CCDS:CCDS19659.1 GeneID:74890 MGI:1922140
definition	codon_start : 1 product : MORN repeat containing 3 protein_id : NP_083388.1

name	BC022593 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89886443 GeneID:330189 MGI:3603158
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC330189 protein_id : NP_001034812.1

name	Rhof (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201958 GeneID:23912 MGI:1345629
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : induced in fatty liver dystrophy 1; ras homolog gene family, member f (in filopodia) product : ras homolog gene family, member f protein_id : NP_780301.1

name	4932422M17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254560 GeneID:74366 MGI:1921616
definition	codon_start : 1 product : hypothetical protein LOC74366 protein_id : XP_001473849.1

name	Setd1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94536715 GeneID:208043 MGI:2652820
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : SET domain containing 1B protein_id : NP_001035488.1

name	Hpd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859486 GeneID:15445 MGI:96213
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003868 - 4-hydroxyphenylpyruvate dioxygenase activity [Evidence IEA] [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008127 - quercetin 2,3-dioxygenase activity [Evidence IEA] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IEA]; GO:0006559 - L-phenylalanine catabolism [Evidence IEA]; GO:0006572 - tyrosine catabolism [Evidence IEA] codon_start : 1 product : 4-hydroxyphenylpyruvic acid dioxygenase protein_id : NP_032303.1

name	Psmd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508441 GeneID:67151 MGI:1914401
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence ISS] codon_start : 1 product : proteasome 26S non-ATPase subunit 9 protein_id : NP_080276.2

name	Wdr66 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254562 GeneID:269701 MGI:1918495
definition	codon_start : 1 product : WD repeat domain 66 protein_id : XP_485681.5

name	LOC100042824 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254579 GeneID:100042824
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479869.1

name	Bcl7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296593 CCDS:CCDS19661.1 GeneID:77045 MGI:1924295
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : B-cell CLL/lymphoma 7A protein_id : NP_084126.1

name	Mlxip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776545 CCDS:CCDS19662.1 GeneID:208104 MGI:2141183
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; Mlx interactor; MondoA product : MLX interacting protein isoform 2 protein_id : NP_598678.1

name	Mlxip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849805 GeneID:208104 MGI:2141183
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Mlx interactor; MondoA product : MLX interacting protein isoform 1 protein_id : NP_808250.1

name	Il31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63533922 GeneID:76399 MGI:1923649
definition	codon_start : 1 product : interleukin 31 protein_id : XP_132344.2

name	Lrrc43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986581 CCDS:CCDS19664.1 GeneID:381741 MGI:2685907
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 43 protein_id : NP_001028633.1

name	B3gnt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348468 CCDS:CCDS19665.1 GeneID:231727 MGI:2680208
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4 protein_id : NP_941013.1

name	Diablo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677504 GeneID:66593 MGI:1913843
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006919 - caspase activation [Evidence IMP] [Evidence IDA]; GO:0008631 - induction of apoptosis by oxidative stress [Evidence IDA]; GO:0043065 - positive regulation of apoptosis [Evidence IDA] codon_start : 1 note : direct IAP binding protein with low PI; second mitochondria-derived activator of caspase product : diablo protein_id : NP_075721.3

name	Vps33a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543950 CCDS:CCDS19666.1 GeneID:77573 MGI:1924823
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030220 - platelet formation [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0048070 - regulation of developmental pigmentation [Evidence IMP]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : buff product : vacuolar sorting protein 33a protein_id : NP_084205.2

name	LOC673222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673222
definition	number : 1 pseudo : _no_value

name	LOC623672 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254577 GeneID:623672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 238 ESTs, 6 Proteins product : similar to NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11, mitochondrial pseudo : _no_value transcript_id : XR_034386.1

clone name	MSMg01-119D10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-465F16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-496A20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320H02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-057A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401E10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-500K23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-156E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151E17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-279G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280A13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-509B08.T7 (MSMg01no509_b08.b1)	MSMg01-509B08.TJ (MSMg01no509_b08.g1)
ACC	AG582844	AG582845
length	1,260	770
length of high quality (start - end)	---	538 (80 - 617)
definition	CHROMAT_FILE: MSMg01no509_b08.b1 PHD_FILE: MSMg01no509_b08.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:38:13 2005	CHROMAT_FILE: MSMg01no509_b08.g1 PHD_FILE: MSMg01no509_b08.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:38:13 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GCTATCTTACGGTCCCGCCTGGCCAGCAACGATCACATATTTCTCAAGAC GAAGTAGCGAGGATTGTTAGCGTGTTATTCTAAGAACAGTGAGTTGTGGT TGAGGTGGGGGAGCTGCGAGTTTTGGCTTTGTCTTGCCGCATTTCTTGTC TGTTTGGCAACCCCTATATAACATACGCGTGCATTCATGTCCCGCATGTT TGCCACCCATATTGTTACCGCCCGCGCACTAGTCAGAGCGTACGGTTTCT AGCTTGCGCGTGTACGCATTCTGGTTAGGGTTTCATGAGTATGAGCGCAA TTCTGTTTCCGACGTGCGCCCCTTTCCTTTGCGTAGTTTGCCCCTTATCA GTGTGCGCGTGGCCCTCTTCGGACGCTACGTGTACGTTAAGTTTTGTCTG CTATATACTTGTGTATCGCTCCCGCATATGCAATTGATCTTTAGNAGGTT TGATGTTGGGTGACAGGATTACCGGTCCGCTTATTACCGCTCCGTTGCCG GGATACGGATACACCGCGCATCGAGACGTCTCCTTTTTTCGAGTGACCAC TGACTATTACCACGTCTGTACACTAGCGCCACCATATTCTCGATTTCCTC TCCCGCGCATCGACTCGATTGGAGCGCGGCTCAGCGACCCCAGTATACAC GAGGGTCAGTCATCTAGCGCGCGTTCACTTCGCGCCCGGTTTCTGTTTTC ACTAACAACAACATATTCGCGTTGATTGGACGGTGGTGCGCGGCACGCCA TATGACGGTGGAGTTATTACGATGTTGCATGGAGTTTGGATAGGACACAA TCGCAAGAGATTTGNCGGCCACACATGGACGTATCGCAGTTTTGTATTAT GCACCGCATTCGCCACGCATATGTCACGTGTTTCCCATTATATACGTGCT CGCATCTATACGTTGTGCGTGCTGCGCCGCTTACTATTTTTCTACCGCCT CCTCACCGCATGTATCTTCGTATTCCCGCCCCTATTACGATTGAATCCAG TTTGTACTATTCACGCGCCATGTCTCTGACCCACTACCCACGCCACCTAT ACCACCCGGTTGTGAGTGGGTCTGTAACCATTTTACACGCGCGCCCGATG TATGTTACGACACGTCACACTTATGCACGGTNGNGAGACACCAACGCGTG ATATATATGACGCTGCCATACGATAGAGCGAAGAGTGGCATGGCGTGACG CACCGAGATGGCTGTAGTGCATGACACTCTGCCCTGGGTACTTCAGATCA TAATGATATG	NNNACGATGAAAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGTTTTTTCACCTGTCATTTA AAGCAAAAGACATGTCATTTAAAAAATGAAAAAAAGTGCTGCATACATAA AAATACTACTGCAGTCAAGTAAAGACTTAAAGAAATAAAACCTTTAATTA CTTTAGTGCCAAATAGTAGGAAAGAGATTGAATAGATGTTAGTTTCTTTT TTTCTTATTTTTTGGGGGATATAGGGTCTCACTATGTAGCTCTGGCTGTC CTCAAACTCACAGAGATTTGCCTGTCTCTGCTTCCCCAGTGCTAGGATTA TAGATGTGTGCCCGAGGTCTGGTTAATAGATGTGAACTCCGTAGCAAAGT GCAGGGCCACTTATTGGTTCTAAATGCCAGTTATCATGACCGCACACCAT GCTGAGAAGATGTCTGCAATCTAACACTGAAGCACAAAGCAACTACAAAT TACCTGTGTGCCATTATAATGTTATTGTCTATGAGACATGTGCAACTCAG GAGGTCACATAAATGAACACAAATATGCACGGGTGATTTTCAATATATGT AATGTGAATAACCTGACAGAAGAGGGGTCCTGGAGGCCTCCTCTATACTA AACACTAAGTATTTTTAGAAACTAGATTTGGGCGAAATCAGAAAGTTTGT AGGATACATTCTGGGAAAGTCTTTGAAGTTGGGGATGCAACTATCNTTTT TCCCTTTCTTTTTTTTTTTN
quality values	Open. Hide. 8 8 8 7 7 8 10 15 11 11 11 9 9 9 6 6 8 8 6 6 8 8 10 12 12 12 10 10 8 8 8 8 8 8 8 6 6 6 6 6 6 8 6 6 6 8 8 9 9 9 10 6 6 6 6 6 8 9 9 8 8 9 9 10 9 10 9 6 6 8 8 8 6 9 9 10 10 10 10 11 10 10 10 10 8 6 6 6 6 6 6 6 6 6 7 7 8 8 9 9 10 10 7 7 8 8 8 8 8 10 10 12 9 9 8 8 8 8 9 9 9 11 9 9 8 8 8 8 6 6 6 6 8 6 8 10 10 8 7 7 7 8 10 10 9 9 6 7 6 6 8 6 6 8 8 8 8 6 8 6 6 8 8 8 8 8 8 8 11 12 9 9 8 8 8 8 9 9 9 11 11 11 10 9 9 8 8 8 10 10 13 16 15 10 8 11 10 8 10 8 10 8 8 8 8 11 11 12 8 6 6 6 7 10 8 8 8 10 9 9 10 10 8 8 8 8 8 8 8 8 10 8 8 6 6 8 8 8 7 8 8 8 8 8 8 13 11 10 10 8 8 8 8 8 10 10 10 15 10 10 8 8 8 10 9 9 10 10 8 8 8 8 8 9 11 11 12 11 11 11 11 11 8 8 8 8 8 8 11 11 8 8 8 8 8 6 6 6 8 8 6 6 8 8 8 8 8 6 6 6 6 6 8 8 8 8 8 6 6 10 8 8 8 11 8 8 8 11 12 11 11 11 8 8 8 8 8 8 8 8 8 8 11 10 11 11 11 8 8 8 8 10 8 6 8 10 8 8 8 6 8 6 6 6 7 10 10 8 8 6 6 8 6 8 8 8 8 8 8 8 8 8 8 8 8 6 8 6 6 8 8 9 9 7 9 9 9 9 9 7 10 8 10 8 8 8 6 8 8 8 10 8 8 8 10 8 8 9 9 8 9 8 8 9 8 10 10 15 8 8 8 8 8 8 6 6 7 6 8 6 7 6 6 3 0 3 9 9 6 6 6 6 6 8 8 8 8 8 10 8 8 7 6 6 6 8 8 10 8 8 8 8 8 8 8 9 8 8 6 6 6 6 8 10 12 13 8 10 8 6 6 6 9 11 6 6 6 6 6 6 8 8 9 6 6 6 7 8 6 8 8 8 8 8 6 6 6 6 8 10 10 9 6 8 8 8 6 6 6 6 7 10 8 8 8 12 17 14 11 8 8 8 8 8 10 12 9 10 8 8 8 8 8 8 8 8 12 8 12 12 10 10 9 10 10 15 10 10 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 8 6 6 6 10 8 8 8 8 8 8 8 8 10 9 8 8 8 6 8 6 6 6 8 9 10 6 6 6 6 6 6 10 10 8 13 7 7 7 7 8 8 6 6 6 8 9 9 10 10 8 8 8 8 8 8 8 10 9 9 9 10 10 10 8 8 8 8 9 10 16 11 8 8 8 6 6 9 11 11 9 9 10 8 8 6 6 8 6 6 8 6 6 6 8 6 9 10 8 8 7 6 12 8 10 10 13 10 8 8 6 7 10 12 20 15 10 10 10 10 11 11 8 8 6 6 8 6 6 6 8 8 7 8 8 6 6 8 6 8 8 8 8 8 8 10 8 8 8 8 6 8 8 8 8 8 10 11 11 11 8 8 8 8 8 8 10 10 11 11 8 8 6 6 8 8 10 10 8 8 8 8 8 8 8 8 8 8 8 8 10 9 9 9 8 8 8 10 10 8 10 7 7 6 6 10 8 8 6 6 6 8 8 8 8 8 8 8 6 6 6 6 6 6 8 8 10 10 11 12 3 0 3 9 9 9 9 10 10 8 10 8 9 9 9 9 15 11 9 8 10 10 8 8 8 8 8 10 10 10 11 10 10 10 10 8 8 6 6 8 8 8 8 8 6 6 8 6 8 8 8 15 8 10 8 8 8 8 8 8 8 8 10 10 9 9 8 6 6 6 6 6 6 10 8 8 10 12 10 8 6 6 8 8 10 9 8 8 8 8 8 6 6 6 6 6 6 6 8 8 8 8 8 8 10 9 8 8 8 8 8 8 8 8 8 8 11 11 12 10 9 9 9 9 12 8 8 8 8 10 10 10 8 8 7 10 9 9 7 6 6 8 8 6 6 6 6 7 6 8 8 8 8 9 10 10 6 6 6 7 10 10 7 6 6 6 8 8 9 8 8 8 8 8 8 8 8 8 8 13 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 11 11 12 9 7 8 8 10 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 6 8 8 8 11 8 9 9 8 8 8 8 8 8 6 6 6 6 8 8 6 8 7 7 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 6 6 8 6 6 6 8 8 10 8 8 8 8 8 8 8 7 7 7 10 10 8 8 8 8 6 6 6 6 8 8 9 8 8 8 8 8 8 8 8 9 9 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 10 9 3 0 3 0 3 6 6 6 6 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 9 8 8 8 8 8 8 7 8 8 6 6 6 6 8 8 8 8 13 10 8 8 8 8 8 6 6 8 6 6 6 6 9 8 8 8 6 6 6 6 6 8 8 8 8 8 6 6 8 8 8 8 10 10 10 10 9 8 8 8 8 8 8 8 11 9 9 9 8 8 8 8 8 6 6 6 6 7 7 8 8 8 6 6 6 10 8 8 8 12 8 8 8 8 8 8 8 8	Open. Hide. 0 0 0 3 6 6 8 8 10 8 8 6 8 3 0 3 21 13 14 14 28 34 27 47 47 44 39 39 39 21 27 18 18 9 7 7 8 7 8 8 8 8 11 12 17 18 14 21 12 21 27 37 36 36 33 33 33 33 43 33 27 11 9 9 9 9 9 9 10 10 20 28 32 33 33 33 33 33 33 33 36 36 57 59 59 47 42 42 42 42 39 43 42 34 37 42 42 48 68 68 59 54 47 47 42 48 48 59 42 37 42 42 48 48 39 39 41 48 57 57 54 54 57 57 50 50 50 50 51 68 68 68 68 68 51 50 50 47 47 48 54 54 48 57 48 48 48 57 57 68 51 51 50 50 47 50 50 54 50 50 50 46 43 44 29 29 33 44 44 59 68 68 57 57 52 52 52 57 59 68 68 68 51 51 50 50 50 50 44 43 35 35 43 44 57 68 68 57 57 52 52 52 44 44 68 59 44 43 39 35 35 44 44 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 62 62 52 52 52 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 44 44 35 35 43 43 52 62 62 62 62 68 62 62 43 43 41 43 43 59 43 62 43 44 39 35 43 43 35 35 44 43 62 43 39 39 43 43 62 62 68 68 68 62 62 62 45 45 43 44 35 35 39 41 41 62 62 62 62 62 62 62 43 43 44 44 52 62 62 62 62 68 68 68 68 62 62 68 68 68 68 68 68 62 62 43 43 39 27 27 44 44 44 39 39 43 44 44 62 68 68 68 68 68 68 68 68 68 68 59 59 44 57 43 43 35 21 32 38 35 35 43 44 59 57 57 43 57 35 59 41 38 28 33 39 43 57 59 59 68 59 59 43 43 35 43 43 57 59 59 59 57 52 43 37 50 50 44 44 43 52 52 59 59 59 52 52 52 52 52 43 43 43 52 43 57 57 57 57 57 43 43 43 44 44 23 43 32 35 35 43 44 43 43 40 32 32 43 44 43 48 48 48 48 44 44 42 35 35 42 42 43 57 57 54 54 57 57 48 40 40 25 25 25 43 44 59 59 48 46 46 43 43 43 46 39 42 39 43 43 48 48 54 57 42 42 35 35 35 47 47 47 39 39 39 43 43 47 47 39 39 35 47 39 43 43 43 48 41 41 36 36 24 24 12 15 19 34 28 29 30 30 37 37 41 41 59 59 59 59 48 43 43 43 43 36 43 43 48 48 47 59 39 32 32 30 34 27 27 25 26 21 17 24 34 33 31 24 24 34 37 41 37 39 30 30 25 17 22 12 12 13 23 15 28 24 30 22 26 28 33 19 19 12 20 14 11 11 11 12 12 27 26 17 17 20 26 20 22 19 18 15 19 14 19 19 20 20 19 19 22 29 30 18 11 10 10 10 14 18 30 24 24 24 26 23 28 25 31 39 34 32 10 10 9 9 9 12 18 12 11 11 13 17 22 22 18 19 23 16 12 14 12 10 10 9 9 9 21 17 28 15 15 17 12 12 15 12 12 11 11 11 18 18 15 12 12 11 12 12 20 17 17 13 9 9 9 10 11 13 13 7 6 6 6 8 23 32 19 20 11 11 11 13 11 16 17 19 11 12 3 0 3 7 7 15 14 15 13 12 12 11 11 10 10 11 16 21 37 35 35 25 18 9 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no509_b08.g1 MSMg01no509_b08.g1 CHROMAT_FILE:
MSMg01no509_b08.g1 PHD_FILE: MSMg01no509_b08.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:38:13 2005
         (538 letters)



>mm_chr5_123017149_123018086
          Length = 938

 Score = 1033 bits (534), Expect = 0.0
 Identities = 537/538 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   agttttttcacctgtcatttaaagcaaaagacatgtcatttaaaaaatgaaaaaaagtgc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agttttttcacctgtcatttaaagcaaaagacatgtcatttaaaaaatgaaaaaaagtgc 260

                                                                       
Query: 61  tgcatacataaaaatactactgcagtcaagtaaagacttaaagaaataaaacctttaatt 120
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 261 tgcatacataaaaatactactgcagtcaagtaaagacttaaagaaataaaacttttaatt 320

                                                                       
Query: 121 actttagtgccaaatagtaggaaagagattgaatagatgttagtttctttttttcttatt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 actttagtgccaaatagtaggaaagagattgaatagatgttagtttctttttttcttatt 380

                                                                       
Query: 181 ttttgggggatatagggtctcactatgtagctctggctgtcctcaaactcacagagattt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 ttttgggggatatagggtctcactatgtagctctggctgtcctcaaactcacagagattt 440

                                                                       
Query: 241 gcctgtctctgcttccccagtgctaggattatagatgtgtgcccgaggtctggttaatag 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 gcctgtctctgcttccccagtgctaggattatagatgtgtgcccgaggtctggttaatag 500

                                                                       
Query: 301 atgtgaactccgtagcaaagtgcagggccacttattggttctaaatgccagttatcatga 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 atgtgaactccgtagcaaagtgcagggccacttattggttctaaatgccagttatcatga 560

                                                                       
Query: 361 ccgcacaccatgctgagaagatgtctgcaatctaacactgaagcacaaagcaactacaaa 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 ccgcacaccatgctgagaagatgtctgcaatctaacactgaagcacaaagcaactacaaa 620

                                                                       
Query: 421 ttacctgtgtgccattataatgttattgtctatgagacatgtgcaactcaggaggtcaca 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 ttacctgtgtgccattataatgttattgtctatgagacatgtgcaactcaggaggtcaca 680

                                                                     
Query: 481 taaatgaacacaaatatgcacgggtgattttcaatatatgtaatgtgaataacctgac 538
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 taaatgaacacaaatatgcacgggtgattttcaatatatgtaatgtgaataacctgac 738


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 25
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 538
Length of database: 938
Length adjustment: 10
Effective length of query: 528
Effective length of database: 928
Effective search space:   489984
Effective search space used:   489984
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information