MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-130L20
Chromosome	6 (Build37)
Map Location	141,754,284 - 141,755,391
singlet/doublet	singlet
Overlap gene	Slco1a4
Upstream gene	LOC664875, Pde3a, Slco1c1, Slco1b2, EG435927
Downstream gene	LOC100042750, EG664913, Slco1a1, EG625716, Slco1a6, Slco1a5, Iapp, BC027061, Recql, Golt1b, B230216G23Rik, Gys2, Ldhb, Kcnj8, Abcc9, 5330439B14Rik, Cmas, Gm766
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC664875 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 69 ESTs, 6 Proteins pseudo : _no_value

name	Pde3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54611 MGI:1860764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slco1c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58807 MGI:1889679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slco1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28253 MGI:1351899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG435927 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435927 MGI:3643685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	Slco1a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28250 MGI:1351896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042750 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG664913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664913 MGI:3644299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Slco1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28248 MGI:1351891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625716 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625716 MGI:3647159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slco1a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28254 MGI:1351906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slco1a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108096 MGI:1351865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iapp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15874 MGI:96382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC027061 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232491 MGI:2676395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Recql (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19691 MGI:103021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golt1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66964 MGI:1914214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230216G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319552 MGI:2442262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	Gys2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232493 MGI:2385254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldhb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16832 MGI:96763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16523 MGI:1100508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20928 MGI:1352630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	5330439B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321015 MGI:2447824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12764 MGI:1337124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm766 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330440 MGI:2685612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055303 GeneID:54611 MGI:1860764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 3A, cGMP inhibited transcript_id : NM_018779.1

name	Slco1c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946865 GeneID:58807 MGI:1889679
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 1c1 transcript_id : NM_021471.1

name	Slco1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14547898 GeneID:28253 MGI:1351899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 1b2 transcript_id : NM_020495.1

name	Slco1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130560 GeneID:28253 MGI:1351899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 1b2 transcript_id : NM_178235.2

name	EG435927 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256028 GeneID:435927 MGI:3643685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : predicted gene, EG435927 transcript_id : XM_973315.2

name	Slco1a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507613 GeneID:28250 MGI:1351896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 1a4 transcript_id : NM_030687.1

name	LOC100042750 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256030 GeneID:100042750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to ERV-BabFcenv provirus ancestral Env polyprotein precursor (Envelope polyprotein) (BabFcenv) transcript_id : XM_001478749.1

name	EG664913 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378325 GeneID:664913 MGI:3644299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG664913 transcript_id : XM_973397.1

name	Slco1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803170 GeneID:28248 MGI:1351891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 1a1 transcript_id : NM_013797.2

name	EG625716 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486774 GeneID:625716 MGI:3647159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG625716 transcript_id : NM_001081318.1

name	Slco1a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963796 GeneID:28254 MGI:1351906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 1a6 transcript_id : NM_023718.1

name	Slco1a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801812 GeneID:108096 MGI:1351865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 1a5 transcript_id : NM_130861.2

name	Iapp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754271 GeneID:15874 MGI:96382
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : islet amyloid polypeptide transcript_id : NM_010491.1

name	BC027061 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802981 GeneID:232491 MGI:2676395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC027061 transcript_id : NM_183165.3

name	Recql (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625689 GeneID:19691 MGI:103021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RecQ protein-like transcript_id : NM_023042.2

name	Golt1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130254 GeneID:66964 MGI:1914214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi transport 1 homolog B (S. cerevisiae) transcript_id : NM_025872.4

name	B230216G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378327 GeneID:319552 MGI:2442262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA B230216G23 gene transcript_id : XM_620381.3

name	Gys2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704149 GeneID:232493 MGI:2385254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycogen synthase 2 transcript_id : NM_145572.1

name	Ldhb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982224 GeneID:16832 MGI:96763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactate dehydrogenase B transcript_id : NM_008492.2

name	Kcnj8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802584 GeneID:16523 MGI:1100508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 8 transcript_id : NM_008428.3

name	Abcc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722104 GeneID:20928 MGI:1352630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 9 transcript_id : NM_021042.2

name	Abcc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722107 GeneID:20928 MGI:1352630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 9 transcript_id : NM_001044720.1

name	Abcc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722103 GeneID:20928 MGI:1352630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 9 transcript_id : NM_011511.2

name	Abcc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722106 GeneID:20928 MGI:1352630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 9 transcript_id : NM_021041.2

name	5330439B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351790 GeneID:321015 MGI:2447824
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5330439B14 gene transcript_id : NM_177314.3

name	Cmas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208853 GeneID:12764 MGI:1337124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytidine monophospho-N-acetylneuraminic acid synthetase transcript_id : NM_009908.1

name	Gm766 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386702 GeneID:330440 MGI:2685612
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 766, (NCBI) transcript_id : NM_001033417.2

name	Pde3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055304 CCDS:CCDS20676.1 GeneID:54611 MGI:1860764
definition	GO_function : GO:0004119 - cGMP-inhibited cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 function : hydrolysis of cAMP and cGMP note : cGMP-inhibited phosphodiesterase product : phosphodiesterase 3A, cGMP inhibited protein_id : NP_061249.1

name	Slco1c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946866 CCDS:CCDS20677.1 GeneID:58807 MGI:1889679
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 21 (organic anion transporter), member 14 product : solute carrier organic anion transporter family, member 1c1 protein_id : NP_067446.1

name	Slco1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14547899 CCDS:CCDS20678.1 GeneID:28253 MGI:1351899
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; liver-specific organic anion transporter 1; liver-specific organic anion transporter; solute carrier family (organic anion transporter) member 10; solute carrier family 21 (organic anion transporter), member 6; solute carrier family 21 (organic anion transporter), member 10 product : solute carrier organic anion transporter family, member 1b2 isoform 1 protein_id : NP_065241.1

name	Slco1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30102937 CCDS:CCDS20679.1 GeneID:28253 MGI:1351899
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; liver-specific organic anion transporter 1; liver-specific organic anion transporter; solute carrier family (organic anion transporter) member 10; solute carrier family 21 (organic anion transporter), member 6; solute carrier family 21 (organic anion transporter), member 10 product : solute carrier organic anion transporter family, member 1b2 isoform 2 protein_id : NP_839953.1

name	EG435927 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256029 GeneID:435927 MGI:3643685
definition	codon_start : 1 product : similar to organic anion transporting polypeptide 2 protein_id : XP_978409.2

name	Slco1a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507614 GeneID:28250 MGI:1351896
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : organic anion transporting polypeptide 2; solute carrier family 21 (organic anion transporter), member 5 product : solute carrier organic anion transporter family, member 1a4 protein_id : NP_109612.1

name	LOC100042750 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256031 GeneID:100042750
definition	codon_start : 1 product : similar to ERV-BabFcenv provirus ancestral Env polyprotein precursor (Envelope polyprotein) (BabFcenv) protein_id : XP_001478799.1

name	EG664913 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378326 GeneID:664913 MGI:3644299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978491.1

name	Slco1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305497 GeneID:28248 MGI:1351891
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015711 - organic anion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 function : mediates transport of organic solutes note : solute carrier family 21 (organic anion transporter), member 1 product : solute carrier organic anion transporter family, member 1a1 protein_id : NP_038825.1

name	EG625716 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486775 GeneID:625716 MGI:3647159
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : predicted gene, EG625716 protein_id : NP_001074787.1

name	Slco1a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963797 GeneID:28254 MGI:1351906
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : organic anion-transporting polypeptide; solute carrier family (organic anion transporter) member 13; solute carrier family 21 (organic anion transporter), member 13 product : solute carrier organic anion transporter family, member 1a6 protein_id : NP_076207.1

name	Slco1a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700000 GeneID:108096 MGI:1351865
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015125 - bile acid transporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : solute carrier family 21 (organic anion transporter), member 7 product : solute carrier organic anion transporter family, member 1a5 protein_id : NP_570931.1

name	Iapp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754272 GeneID:15874 MGI:96382
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : islet amyloid polypeptide protein_id : NP_034621.1

name	BC027061 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625837 CCDS:CCDS20681.1 GeneID:232491 MGI:2676395
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232491 protein_id : NP_898988.2

name	Recql (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625690 GeneID:19691 MGI:103021
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA] codon_start : 1 product : RecQ protein-like protein_id : NP_075529.2

name	Golt1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385354 CCDS:CCDS20682.1 GeneID:66964 MGI:1914214
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : golgi transport 1 homolog B protein_id : NP_080148.1

name	B230216G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378328 GeneID:319552 MGI:2442262
definition	codon_start : 1 product : hypothetical protein LOC319552 protein_id : XP_620381.2

name	Gys2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704150 CCDS:CCDS20683.1 GeneID:232493 MGI:2385254
definition	codon_start : 1 exception : mismatches in translation product : glycogen synthase 2 protein_id : NP_663547.1

name	Ldhb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678674 CCDS:CCDS20684.1 GeneID:16832 MGI:96763
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004459 - L-lactate dehydrogenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0019642 - anaerobic glycolysis [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA] codon_start : 1 note : lactate dehydrogenase-B product : lactate dehydrogenase 2, B chain protein_id : NP_032518.1

name	Kcnj8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680534 CCDS:CCDS20685.1 GeneID:16523 MGI:1100508
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium inwardly-rectifying channel J8 protein_id : NP_032454.1

name	Abcc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755696 GeneID:20928 MGI:1352630
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0030017 - sarcomere [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008281 - sulfonylurea receptor activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; sulfonylurea-binding protein 2; sulfonylurea receptor 2 product : ATP-binding cassette, sub-family C, member 9 isoform a protein_id : NP_035641.1

name	Abcc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722105 GeneID:20928 MGI:1352630
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0030017 - sarcomere [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008281 - sulfonylurea receptor activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 4; sulfonylurea-binding protein 2; sulfonylurea receptor 2 product : ATP-binding cassette, sub-family C, member 9 isoform c protein_id : NP_066379.2

name	Abcc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722108 GeneID:20928 MGI:1352630
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0030017 - sarcomere [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008281 - sulfonylurea receptor activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform d is encoded by transcript variant 5; sulfonylurea-binding protein 2; sulfonylurea receptor 2 product : ATP-binding cassette, sub-family C, member 9 isoform d protein_id : NP_001038185.1

name	Abcc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11038664 GeneID:20928 MGI:1352630
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0030017 - sarcomere [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008281 - sulfonylurea receptor activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; sulfonylurea-binding protein 2; sulfonylurea receptor 2 product : ATP-binding cassette, sub-family C, member 9 isoform b protein_id : NP_066378.1

name	5330439B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893427 GeneID:321015 MGI:2447824
definition	codon_start : 1 product : hypothetical protein LOC321015 protein_id : NP_796288.1

name	Cmas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208854 CCDS:CCDS20687.1 GeneID:12764 MGI:1337124
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008781 - N-acylneuraminate cytidylyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006055 - CMP-N-acetylneuraminate biosynthesis [Evidence ISS]; GO:0009103 - lipopolysaccharide biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CMP-Neu5Ac synthase; CMP-sialic acid synthetase product : cytidine monophospho-N-acetylneuraminic acid synthetase protein_id : NP_034038.1

name	Gm766 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701919 GeneID:330440 MGI:2685612
definition	GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC330440 protein_id : NP_001028589.1

name	(CDS detail)
type	STS
link
xref	UniSTS:224771
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:123705
definition	standard_name : 25.MMHAP94FLA4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123949
definition	standard_name : 31.MMHAP63FLC4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:235570
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179486
definition	standard_name : C87899

name	(CDS detail)
type	STS
link
xref	UniSTS:208045
definition	standard_name : BB361933

name	(CDS detail)
type	STS
link
xref	UniSTS:225370
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130655
definition	standard_name : D6Mit112

name	(CDS detail)
type	STS
link
xref	UniSTS:165496
definition	standard_name : AI785519

name	(CDS detail)
type	STS
link
xref	UniSTS:164342
definition	standard_name : AI790453

name	(CDS detail)
type	STS
link
xref	UniSTS:130680
definition	standard_name : D6Mit136

name	(CDS detail)
type	STS
link
xref	UniSTS:164342
definition	standard_name : AI790453

name	(CDS detail)
type	STS
link
xref	UniSTS:130843
definition	standard_name : D6Mit293.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130842
definition	standard_name : D6Mit293

name	(CDS detail)
type	STS
link
xref	UniSTS:209451
definition	standard_name : BB464475

name	(CDS detail)
type	STS
link
xref	UniSTS:224094
definition	standard_name : Slc21a7

name	(CDS detail)
type	STS
link
xref	UniSTS:130959
definition	standard_name : D6Mit58

name	(CDS detail)
type	STS
link
xref	UniSTS:179487
definition	standard_name : AI957250

name	(CDS detail)
type	STS
link
xref	UniSTS:179488
definition	standard_name : AU024291

name	(CDS detail)
type	STS
link
xref	UniSTS:162495
definition	standard_name : RH125739

name	(CDS detail)
type	STS
link
xref	UniSTS:159585
definition	standard_name : MHAa34g10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179489
definition	standard_name : AI790582

name	(CDS detail)
type	STS
link
xref	UniSTS:224332
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130962
definition	standard_name : D6Mit60

name	(CDS detail)
type	STS
link
xref	UniSTS:159584
definition	standard_name : D88159

name	(CDS detail)
type	STS
link
xref	UniSTS:179491
definition	standard_name : AI448900

name	(CDS detail)
type	STS
link
xref	UniSTS:159586
definition	standard_name : AI414027

name	(CDS detail)
type	STS
link
xref	UniSTS:179485
definition	standard_name : AI449286

name	(CDS detail)
type	STS
link
xref	UniSTS:116330
definition	standard_name : D6Mit259

name	(CDS detail)
type	STS
link
xref	UniSTS:179492
definition	standard_name : AJ006215

name	(CDS detail)
type	STS
link
xref	UniSTS:141354
definition	standard_name : Cmas

name	(CDS detail)
type	STS
link
xref	UniSTS:179490
definition	standard_name : AW208911

name	LOC664875 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256019 GeneID:664875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 69 ESTs, 6 Proteins product : similar to putative ribosomal protein L11 protein pseudo : _no_value transcript_id : XR_030598.1

clone name	MSMg01-350A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-472P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183L14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-207N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-341G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067B05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-130L20.b	B6Ng01-130L20.g
ACC	DH931976	DH931977
length	1,099	981
definition	DH931976\|Mus musculus domesticus DNA, BAC clone: B6Ng01-130L20, 5' end.	DH931977\|Mus musculus domesticus DNA, BAC clone: B6Ng01-130L20, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccagttttatagcaaaagtcagtattacaactttcaaattttttc atttattaattgatttttggtggggcatgcacaattaaaataaaaaggca tagggcaacttgcaagagtttgttcttttctcctgccatgttgatcccag ggatcacaacaaccttgtcaggctgaggggcaaacagttctttccattga accttctagctggtccctcttgaaagcttttactctacggttattattaa tgttaatagtcatgtgctctatggctcgttaatagaatgaacactgagcc gtcaaagttctatgaatatgagaattagtcttctcagaatatctgatact acatctagacaagtgatttttattactttatcagtttactctaccttgtg gttgaactcagggcctcacatgtattaggcaatcacatatccaccgagat acagcccatctcgacaaggagcctttaaaaggactagttttctcccattc ttgattttaaggaagagtttcatgaccagctgtgaattgctagggaaaaa agttccaatcatttttgctacatgatttttaacaacctgattaaagtttt caatgatgcaaaagaaatgaccaactgtgtgacaggagtaatgaaagaag ggactgaaaacaggagatggccactgtggagagtctaaccttggaagtct tgactagagtaaagcagagagagttagcactcctaagtacataacaacag atgtagagatctttcacacacagaggataaaacaaattatttcagtgtgg cttaacaaagttgcctattttgagctctaaatacctccagcatcaaaata taaatgaaaaacatttaaatagtctttctgcaatagaaaagtttcaagct tatttgaagatatgtgggaaacatccatttcccttgagttaaagagaaca tactttttgaaatgaggcagctttaatgttaggtgggggtttgctacaga agttttcctgggaaatcttaaggtgcttcatcacctttctggaaatgcta tcagtaatatttttttatcatggagtaaggtattgaggccttaagaata	gaattcatgtgtaattctgataggtctgtctttatatgttacttgacctt tttcccttactgcttttaatattctttgttttgtgcatttggtgttttga ttattatgtgatggaaggaatttcttttttggtccagactcttttgagtt ctgctgtcttcttgtatattcatgggcatctctttctttaggttggggaa gttttcctctataattttgttgaagatatttactgtccctttaagctgga aatcttccttctcatctatacttattatccttaggtttgatcttctcatt gggccctagatttcctggatgtttttggtttaggatctttttgcatttca tattttctttgattgtcaatgttttctatggtatcttctgaagctgagat tccctcttctatctcttctattctgttgttgatgcttgcatctatgactc ctgatctctttcctagattttctatctccatagttgtctccctttgtgat ttctttaagggagttatttatgccctttttatagtcctccatcatcatca tgagaagtgactttggatccacatcttgctcttctggtgtaatggtgtat tcaggatttgctatggtgggagagttgggttctgatgatgccacatatcc ttgctttctgtggcttctgtttttatgattgcctcccaacatctgattat ctcaagtgccccctgccctcaatatatctgatttggagtctgtccttcct gtaatcctgggttgagacagaattcctcagagtccagctttctctgttga tcctgtgatttcagcatcctgtgatcctgagattctgggtgtgtcagagt tcttggctgtcaagctcctctgagaccccagatcctgtgtgctcagctcc tgggatcttggatcctaagatcctagacatgttaagagccataagtggta cctctctggggaccgtgatgctgtctctgag
quality values	Open. Hide. 47 24 33 38 53 50 37 13 37 61 61 61 47 50 61 47 47 61 55 61 61 61 47 61 61 37 15 21 17 15 19 18 19 16 16 25 55 61 61 59 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 55 55 61 61 61 59 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 55 61 59 61 61 61 59 61 61 61 61 61 61 61 59 59 59 55 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 59 43 52 59 59 59 55 59 61 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 52 59 55 52 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 55 52 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 50 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 55 55 50 55 50 43 50 55 55 55 55 55 55 55 50 55 53 39 53 61 61 53 50 50 37 50 52 61 61 61 61 61 50 61 61 61 50 61 61 61 61 61 61 61 52 53 50 50 50 53 61 61 61 61 61 43 47 61 61 61 53 61 61 61 61 61 53 61 61 61 61 61 61 61 53 53 61 47 35 43 45 53 61 61 61 61 61 61 53 53 61 46 53 52 61 61 61 61 61 61 61 61 57 36 40 50 50 47 45 50 57 57 53 53 47 47 42 47 47 46 47 47 53 50 53 57 53 43 57 57 57 53 53 53 43 42 37 34 34 42 46 53 53 57 53 57 57 57 52 57 57 57 50 38 46 57 57 57 47 53 53 43 47 57 57 38 57 47 28 34 52 43 26 39 32 43 47 52 53 53 57 53 53 41 43 35 45 57 43 39 53 53 52 38 52 53 57 57 50 57 57 45 53 50 41 32 53 53 57 43 43 47 50 39 34 57 52 28 32 27 47 38 22 43 34 38 53 53 50 52 57 53 36 52 34 37 40 50 42 47 39 41 25 47 52 53 53 47 38 37 38 36 46 53 50 36 33 33 44 53 44 42 38 41 53 32 33 47 28 57 15 57 36 57 37 52 40 33 40 48 40 34 40 42 37 32 36 52 32 37 35 53 27 34 25 26 31 19 23 39 27 35 48 30 48 40 41 37 53 37 32 29 32 29 57 31 27 29 38 37 39 30 41 33 33 40 21 44 37 27 17 53 53 40 30 36 48 29 23 48 41 33 51 41 36 31 34 30 47 32 36 47 25 32 31 22 22 22 11 26 30 32 36 36 31 30 36 30 29 20 46 51 30 26 44 34 29 30 29 33 33 51 29 18 19 29 29 29 29 29 19 37 29 25 31 31 33 51 51 28 35 28 28 16 51 29 29 31 28 46 39 39 24 16 16 29 51 33 27 46 32 29 29 33 22 30 35 51 29 28 27 28 29 22 26 28 28 15 51 46 46 41 24 29 51 28 25 18 33 31 29 26 27 11 28 51 33 19 28 31 17 26 13 22 27 29 25 38 51 20 35 51 17 13 16 31 21 19 20 28 43 20 23 16 26 16 22 27 29 16 23 27 43 51 31 21 43 23 35 21 14 14 24 31 28 25 51 51 51 30 20 32 51 36 18 19 8 6 12 10 28 26 27 29 51 27 17 22 25 31 15 9 12 7 18 7 12 44 39 39 28 11 33 20 21 20 26 17 22 9 17 33 30 14 30 44 39 17 20 17 22 13 35 24 13 42 29 8 21 13 29 11 22 6 9 8 16 26 18 6 4 4 5 4 4 3 10 22 24 6 7 11 19 10 11 34 20 12 29 22 13 5 5 10 17 13 12 22 31 6 7 10 30 34 42 30 34 14 26 24 29 16 17 12 6 8 5 7 24 13 7 9 9 11 6 6 8 21 4 11 8 10 10 13 19 9 7 24 19 9 26	Open. Hide. 61 61 49 49 52 36 24 19 20 28 24 36 24 27 61 61 61 59 59 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 55 34 59 61 61 61 61 61 61 61 61 61 59 59 44 44 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 47 52 61 50 61 50 61 53 61 61 53 52 61 61 61 61 61 53 61 61 61 61 61 61 39 52 50 61 52 61 61 61 61 53 61 33 61 61 53 61 61 52 61 61 53 61 61 61 45 61 61 50 52 61 47 39 61 61 61 47 61 53 53 61 61 45 53 52 61 61 61 61 61 47 53 57 57 46 53 53 57 47 47 47 40 50 53 52 57 53 50 57 53 43 40 57 47 52 27 47 47 53 57 53 57 43 57 50 53 53 53 39 57 53 53 53 34 57 30 50 53 46 47 34 25 53 50 53 53 52 20 30 53 24 36 47 52 39 50 28 53 53 47 47 25 12 41 52 47 52 24 24 21 7 23 25 50 36 28 40 45 45 35 37 18 50 53 50 47 26 24 45 50 39 36 38 45 46 42 45 57 50 47 30 42 31 47 42 25 27 24 10 21 30 42 50 36 29 18 53 39 45 50 34 45 34 34 34 45 41 23 57 52 37 33 33 42 30 24 42 42 38 27 38 31 28 7 52 11 52 24 37 15 35 39 40 53 30 30 26 22 33 31 27 24 37 24 19 52 22 25 31 36 37 53 20 38 21 27 53 14 40 31 37 21 37 29 21 18 17 23 29 19 27 12 34 12 36 40 31 36 12 37 32 57 33 34 24 31 20 29 6 12 18 18 12 29 25 21 29 21 32 31 24 53 33 40 30 33 29 30 32 37 33 35 41 16 25 36 29 40 17 18 20 18 8 24 14 22 28 36 39 46 24 30 36 10 19 32 20 29 12 43 12 27 17 24 30 33 32 38 19 38 31 35 33 33 33 23 16 33 12 20 35 21 26 29 48 14 31 11 47 36 14 37 20 29 28 23 19 30 11 16 33 15 37 7 15 21 28 18 36 27 21 26 29 26 14 8 17 13 14 10 8 12 29 14 11 18 29 28 14 30 16 24 17 28 28 30 34 13 12 8 5 20 20 22 23 7 14 5 7 10 30 21 5 11 11 27 17 12 21 30 21 23 16 10 7 7 10 9 10 7 13 11 7 16 19 24 13 21 28 28 15 11 6 9 12 7 9 16 14 14 15 22 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_141754284_141755391
seq2: B6Ng01-130L20.b_48_1146

seq1  GAATTCCAGTTTTATAGCAAAAGTCAGTATTACAACTTTCAAATTTTTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGTTTTATAGCAAAAGTCAGTATTACAACTTTCAAATTTTTTC  50

seq1  ATTTATTAATTGATTTTTGGTGGGGCATGCACAATTAAAATAAAAAGGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATTAATTGATTTTTGGTGGGGCATGCACAATTAAAATAAAAAGGCA  100

seq1  TAGGGCAACTTGCAAGAGTTTGTTCTTTTCTCCTGCCATGTTGATCCCAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGGCAACTTGCAAGAGTTTGTTCTTTTCTCCTGCCATGTTGATCCCAG  150

seq1  GGATCACAACAACCTTGTCAGGCTGAGGGGCAAACAGTTCTTTCCATTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCACAACAACCTTGTCAGGCTGAGGGGCAAACAGTTCTTTCCATTGA  200

seq1  ACCTTCTAGCTGGTCCCTCTTGAAAGCTTTTACTCTACGGTTATTATTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTCTAGCTGGTCCCTCTTGAAAGCTTTTACTCTACGGTTATTATTAA  250

seq1  TGTTAATAGTCATGTGCTCTATGGCTCGTTAATAGAATGAACACTGAGCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAATAGTCATGTGCTCTATGGCTCGTTAATAGAATGAACACTGAGCC  300

seq1  GTCAAAGTTCTATGAATATGAGAATTAGTCTTCTCAGAATATCTGATACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAAAGTTCTATGAATATGAGAATTAGTCTTCTCAGAATATCTGATACT  350

seq1  ACATCTAGACAAGTGATTTTTATTACTTTATCAGTTTACTCTACCTTGTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTAGACAAGTGATTTTTATTACTTTATCAGTTTACTCTACCTTGTG  400

seq1  GTTGAACTCAGGGCCTCACATGTATTAGGCAATCACATATCCACCGAGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGAACTCAGGGCCTCACATGTATTAGGCAATCACATATCCACCGAGAT  450

seq1  ACAGCCCATCTCGACAAGGAGCCTTTAAAAGGACTAGTTTTCTCCCATTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCCCATCTCGACAAGGAGCCTTTAAAAGGACTAGTTTTCTCCCATTC  500

seq1  TTGATTTTAAGGAAGAGTTTCATGACCAGCTGTGAATTGCTAGGGAAAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATTTTAAGGAAGAGTTTCATGACCAGCTGTGAATTGCTAGGGAAAAA  550

seq1  AGTTCCAATCATTTTTGCTACATGATTTTTAACAACCTGATTAAAGTTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCCAATCATTTTTGCTACATGATTTTTAACAACCTGATTAAAGTTTT  600

seq1  CAATGATGCAAAAGAAATGACCAACTGTGTGACAGGAGTAATGAAAGAAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGATGCAAAAGAAATGACCAACTGTGTGACAGGAGTAATGAAAGAAG  650

seq1  GGACTGAAAACAGGAGATGGCCACTGTGGAGAGTCTAACCTTGGAAGTCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTGAAAACAGGAGATGGCCACTGTGGAGAGTCTAACCTTGGAAGTCT  700

seq1  TGACTAGAGTAAAGCAGAGAGAGTTAGCACTCCTAAGTACATAACAACAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTAGAGTAAAGCAGAGAGAGTTAGCACTCCTAAGTACATAACAACAG  750

seq1  ATGTAGAGATCTTTCACACACAGAGGATAAAACAAATTATTTCAGTGTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAGAGATCTTTCACACACAGAGGATAAAACAAATTATTTCAGTGTGG  800

seq1  CTTAACAAAGTTGCCTATTTTGAGCTCTAAATACCTCCAGCATCAAAATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAACAAAGTTGCCTATTTTGAGCTCTAAATACCTCCAGCATCAAAATA  850

seq1  TAAATGAAAAACATTTAAATAGTCTTTCTGCAATAGAAAAGTTTCAAGCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGAAAAACATTTAAATAGTCTTTCTGCAATAGAAAAGTTTCAAGCT  900

seq1  TATTTGAAGATATGTGGGAAACATCCATTTCCCTTGAGTTAAAAGAGAAC  950
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  TATTTGAAGATATGTGGGAAACATCCATTTCCCTTGAGTT-AAAGAGAAC  949

seq1  ATACTTTTTGAAAATGAAGGCAGCTTTAATGTTAAGGGTGGGGGTTTGCT  1000
      |||||||||| ||||| |||||||||||||||||  ||||||||||||||
seq2  ATACTTTTTG-AAATG-AGGCAGCTTTAATGTTA--GGTGGGGGTTTGCT  995

seq1  ACAGAAGTTTTCCCTGGGAAAATCTTAA-GTGCTACACCAACCTTCTGGA  1049
      ||||||||||| |||||| ||||||||| ||||| || || | |||||||
seq2  ACAGAAGTTTT-CCTGGG-AAATCTTAAGGTGCTTCATCACCTTTCTGGA  1043

seq1  AATGCTATCAGTAAATATTTTTTATCAT-GAGTAAAGTAATTTTGAAGGC  1098
      ||||||||||||||   ||||||||||| |||||| |||   ||| ||||
seq2  AATGCTATCAGTAATATTTTTTTATCATGGAGTAAGGTA---TTG-AGGC  1089

seq1  CTTAAGAATA  1108
      ||||||||||
seq2  CTTAAGAATA  1099

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information