MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-134N19
Chromosome	6 (Build37)
Map Location	42,299,372 - 42,423,167
singlet/doublet	doublet
Overlap gene	Zyx, Epha1, Tas2r143, Tas2r135, Tas2r126, Olfr458, Olfr457
Upstream gene	Try10, Prss3, EG436523, EG386551, LOC100040233, Prss1, Prss2, Tcrb-V13, Ephb6, Trpv6, Trpv5, 1700034O15Rik, Kel, Olfr459, Pip, Sval2, Sval1, Sval3, Sva, Tas2r139, Tas2r144, Gstk1, Tmem139, Casp2, Clcn1, 6330503C03Rik
Downstream gene	Olfr456, LOC232745, EG546896, Eapa2, BC011487, 3321401G04Rik, LOC100039918, GA_x5J8B7W6337-801345-802245, Olfr453, Olfr38, Olfr452, Olfr451-ps1, Olfr450, Olfr449, Olfr448, Olfr447, Olfr446, GA_x5J8B7W6337-1014614-1015483, Olfr444, EG622841, Igk-V, Olfr443-ps1, GA_x5J8B7W6337-1183223-1183810, Olfr441, Olfr440-ps1, GA_x5J8B7W6337-1221999-1222591, Olfr438, Olfr437, Olfr13, GA_x5J8B7W6337-1270568-1271367, Olfr435, Olfr434, LOC665745, Olfr47, Arhgef5, Nobox, Tpk1, LOC665747
Link	Open Mouse BAC browser

Click to get alignment info.

name	Try10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436522 MGI:3687012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22073 MGI:102758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436523 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436523 MGI:3646222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG386551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386551 MGI:3643903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 116 ESTs, 98 Proteins

name	Prss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114228 MGI:98839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22072 MGI:102759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcrb-V13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269846 MGI:98587
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ephb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13848 MGI:1096338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64177 MGI:1927259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194352 MGI:2429764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700034O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76606 MGI:1923856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kel (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23925 MGI:1346053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258569 MGI:3030293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18716 MGI:102696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sval2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84543 MGI:1934254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sval1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71578 MGI:1918828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sval3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387564 MGI:3047714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sva (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20939 MGI:102785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353148 MGI:2681308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r144 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387515 MGI:2681312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76263 MGI:1923513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109218 MGI:1924444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12366 MGI:97295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clcn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12723 MGI:88417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330503C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76156 MGI:1923406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zyx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22793 MGI:103072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13835 MGI:107381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387514 MGI:2681310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r135 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387512 MGI:2681302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387353 MGI:2681273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr458 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258436 MGI:3030292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258989 MGI:3030291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr456 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259144 MGI:3030290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC232745 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	EG546896 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546896 MGI:3648300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eapa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403088 MGI:3042585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC011487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232748 MGI:2385258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3321401G04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77574 MGI:1914665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039918 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	GA_x5J8B7W6337-801345-802245 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257777
definition	note : olfactory receptor GA_x5J8B7W6337-801345-802245 pseudo : _no_value

name	Olfr453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258016 MGI:3030287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258988 MGI:1313140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr452 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258207 MGI:3030286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr451-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258017 MGI:3030285
definition	gene_synonym : MOR257-6 note : olfactory receptor 451, pseudogene 1 pseudo : _no_value

name	Olfr450 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258437 MGI:3030284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259067 MGI:3030283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr448 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258270 MGI:3030282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258990 MGI:3030281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258292 MGI:3030280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6337-1014614-1015483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257781
definition	note : olfactory receptor GA_x5J8B7W6337-1014614-1015483 pseudo : _no_value

name	Olfr444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258650 MGI:3030278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622841 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622841 MGI:3643501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	Igk-V (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16080 MGI:96499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 Proteins

name	Olfr443-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258106 MGI:3030277
definition	gene_synonym : MOR261-8P note : olfactory receptor 443, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W6337-1183223-1183810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257780
definition	note : olfactory receptor GA_x5J8B7W6337-1183223-1183810 pseudo : _no_value

name	Olfr441 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258649 MGI:3030275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr440-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258107 MGI:3030274
definition	gene_synonym : MOR261-7P note : olfactory receptor 440, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W6337-1221999-1222591 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257779
definition	note : olfactory receptor GA_x5J8B7W6337-1221999-1222591 pseudo : _no_value

name	Olfr438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258648 MGI:3030272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258293 MGI:3030271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18310 MGI:104812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6337-1270568-1271367 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257778
definition	note : olfactory receptor GA_x5J8B7W6337-1270568-1271367 pseudo : _no_value

name	Olfr435 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258647 MGI:3030269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr434 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258366 MGI:3030268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665745 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Olfr47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18346 MGI:1333821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54324 MGI:1858952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 5 Proteins

name	Nobox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18291 MGI:108011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29807 MGI:1352500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665747 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	Try10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781770 GeneID:436522 MGI:3687012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trypsin 10 transcript_id : NM_001038996.1

name	Prss3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755890 GeneID:22073 MGI:102758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 3 transcript_id : NM_011645.1

name	EG436523 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781767 GeneID:436523 MGI:3646222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436523 transcript_id : NM_001038997.1

name	EG386551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092302 GeneID:386551 MGI:3643903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG386551 transcript_id : NM_001003664.1

name	LOC100040233 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255073 GeneID:100040233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 116 ESTs, 98 Proteins product : similar to trypsinogen 15 transcript_id : XM_001474605.1

name	Prss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716568 GeneID:114228 MGI:98839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 1 (trypsin 1) transcript_id : NM_053243.1

name	Prss2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678438 GeneID:22072 MGI:102759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 2 transcript_id : NM_009430.1

name	Ephb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354026 GeneID:13848 MGI:1096338
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B6 transcript_id : NM_007680.3

name	Trpv6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374373 GeneID:64177 MGI:1927259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 6 transcript_id : NM_022413.3

name	Trpv5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186473 GeneID:194352 MGI:2429764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 5 transcript_id : NM_001007572.2

name	1700034O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130645 GeneID:76606 MGI:1923856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700034O15 gene transcript_id : NM_029671.2

name	Kel (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896654 GeneID:23925 MGI:1346053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kell blood group transcript_id : NM_032540.2

name	Olfr459 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129496 GeneID:258569 MGI:3030293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 459 transcript_id : NM_146576.1

name	Pip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352912 GeneID:18716 MGI:102696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin induced protein transcript_id : NM_008843.3

name	Sval2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14211543 GeneID:84543 MGI:1934254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen-like 2 transcript_id : NM_032542.1

name	Sval1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377710 GeneID:71578 MGI:1918828
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen-like 1 transcript_id : NM_027832.2

name	Sval3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56710337 GeneID:387564 MGI:3047714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen-like 3 transcript_id : NM_001003952.1

name	Sva (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678186 GeneID:20939 MGI:102785
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen transcript_id : NM_009299.1

name	Tas2r139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044478 GeneID:353148 MGI:2681308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 139 transcript_id : NM_181275.1

name	Tas2r144 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47824892 GeneID:387515 MGI:2681312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 144 transcript_id : NM_001001453.1

name	Gstk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130626 GeneID:76263 MGI:1923513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase kappa 1 transcript_id : NM_029555.2

name	Tmem139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803111 GeneID:109218 MGI:1924444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 139 transcript_id : NM_175408.3

name	Casp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680847 GeneID:12366 MGI:97295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 2 transcript_id : NM_007610.1

name	Clcn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383369 GeneID:12723 MGI:88417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 1 transcript_id : NM_013491.2

name	6330503C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803180 GeneID:76156 MGI:1923406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330503C03 gene transcript_id : NM_029528.3

name	Zyx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487367 GeneID:22793 MGI:103072
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zyxin transcript_id : NM_011777.2

name	Epha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362584 GeneID:13835 MGI:107381
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor A1 transcript_id : NM_023580.3

name	Tas2r143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47824877 GeneID:387514 MGI:2681310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 143 transcript_id : NM_001001452.1

name	Tas2r135 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255300 GeneID:387512 MGI:2681302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 135 transcript_id : NM_199159.1

name	Tas2r126 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309600 GeneID:387353 MGI:2681273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 126 transcript_id : NM_207028.1

name	Olfr458 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238925 GeneID:258436 MGI:3030292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 458 transcript_id : NM_146444.1

name	Olfr457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128962 GeneID:258989 MGI:3030291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 457 transcript_id : NM_146987.1

name	Olfr456 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372127 GeneID:259144 MGI:3030290
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 456 transcript_id : NM_001011528.1

name	EG546896 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486824 GeneID:546896 MGI:3648300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546896 transcript_id : NM_001081301.1

name	Eapa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42794266 GeneID:403088 MGI:3042585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : experimental autoimmune prostatitis antigen 2 transcript_id : NM_203396.1

name	BC011487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122712 GeneID:232748 MGI:2385258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC011487 transcript_id : NM_146174.1

name	3321401G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801726 GeneID:77574 MGI:1914665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3321401G04 gene transcript_id : NM_029930.2

name	LOC100039918 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255066 GeneID:100039918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039918 transcript_id : XM_001473783.1

name	Olfr453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801363 GeneID:258016 MGI:3030287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 453 transcript_id : NM_001011799.1

name	Olfr38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128960 GeneID:258988 MGI:1313140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 38 transcript_id : NM_146986.1

name	Olfr452 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801491 GeneID:258207 MGI:3030286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 452 transcript_id : NM_001011869.1

name	Olfr450 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238923 GeneID:258437 MGI:3030284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 450 transcript_id : NM_146445.1

name	Olfr449 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128826 GeneID:259067 MGI:3030283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 449 transcript_id : NM_147064.1

name	Olfr448 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129736 GeneID:258270 MGI:3030282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 448 transcript_id : NM_146273.1

name	Olfr447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128956 GeneID:258990 MGI:3030281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 447 transcript_id : NM_146988.1

name	Olfr446 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129698 GeneID:258292 MGI:3030280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 446 transcript_id : NM_146295.1

name	Olfr444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238921 GeneID:258650 MGI:3030278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 444 transcript_id : NM_146656.1

name	Olfr441 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238915 GeneID:258649 MGI:3030275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 441 transcript_id : NM_146655.1

name	Olfr438 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238917 GeneID:258648 MGI:3030272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 438 transcript_id : NM_146654.1

name	Olfr437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129692 GeneID:258293 MGI:3030271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 437 transcript_id : NM_146296.1

name	Olfr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203790 GeneID:18310 MGI:104812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 13 transcript_id : NM_146652.1

name	Olfr435 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238911 GeneID:258647 MGI:3030269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 435 transcript_id : NM_146653.1

name	Olfr434 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129564 GeneID:258366 MGI:3030268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 434 transcript_id : NM_146369.1

name	Olfr47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203776 GeneID:18346 MGI:1333821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 47 transcript_id : NM_146370.1

name	Arhgef5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255069 GeneID:54324 MGI:1858952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 5 Proteins product : Rho guanine nucleotide exchange factor (GEF) 5 transcript_id : XM_001481282.1

name	Nobox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351686 GeneID:18291 MGI:108011
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NOBOX oogenesis homeobox transcript_id : NM_130869.2

name	Tpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365527 GeneID:29807 MGI:1352500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thiamine pyrophosphokinase transcript_id : NM_013861.2

name	Try10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781771 CCDS:CCDS20046.1 GeneID:436522 MGI:3687012
definition	codon_start : 1 product : trypsinogen 10 protein_id : NP_001034085.1

name	Prss3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755891 CCDS:CCDS20047.1 GeneID:22073 MGI:102758
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mesotrypsin; trypsin 3; trypsinogen; trypsinogen 15 product : protease, serine, 3 protein_id : NP_035775.1

name	EG436523 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781768 CCDS:CCDS20048.1 GeneID:436523 MGI:3646222
definition	codon_start : 1 product : trypsinogen 12 protein_id : NP_001034086.1

name	EG386551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092303 GeneID:386551 MGI:3643903
definition	codon_start : 1 function : serine protease product : Try10-like trypsinogen protein_id : NP_001003664.1

name	LOC100040233 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255074 GeneID:100040233
definition	codon_start : 1 product : similar to trypsinogen 15 protein_id : XP_001474655.1

name	Prss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716569 CCDS:CCDS20049.1 GeneID:114228 MGI:98839
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004295 - trypsin activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : trypsinogen 16; trypsin 1 product : protease, serine, 1 protein_id : NP_444473.1

name	Prss2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678439 CCDS:CCDS20050.1 GeneID:22072 MGI:102759
definition	GO_component : GO:0031012 - extracellular matrix [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004295 - trypsin activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence ISS]; GO:0007586 - digestion [Evidence IEA]; GO:0045785 - positive regulation of cell adhesion [Evidence ISS]; GO:0030307 - positive regulation of cell growth [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : trypsin 2; trypsinogen 20 product : protease, serine, 2 protein_id : NP_033456.1

name	Tcrb-V13 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:269846 MGI:98587
definition	codon_start : 1 exception : rearrangement required for product

name	Ephb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982461 CCDS:CCDS20051.1 GeneID:13848 MGI:1096338
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chicken eph/elk receptor-like protein product : Eph receptor B6 protein_id : NP_031706.2

name	Trpv6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28376639 CCDS:CCDS20052.1 GeneID:64177 MGI:1927259
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : osmosensitive transient receptor potential channel 3; epithelial calcium channel 2 product : transient receptor potential cation channel, subfamily V, member 6 protein_id : NP_071858.2

name	Trpv5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090239 CCDS:CCDS20053.1 GeneID:194352 MGI:2429764
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IDA] [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence NAS]; GO:0006816 - calcium ion transport [Evidence IDA] [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0051262 - protein tetramerization [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : epithelial calcium channel 1 product : transient receptor potential cation channel, subfamily V, member 5 protein_id : NP_001007573.1

name	1700034O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037451 CCDS:CCDS20054.1 GeneID:76606 MGI:1923856
definition	codon_start : 1 product : hypothetical protein LOC76606 protein_id : NP_083947.1

name	Kel (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71896655 CCDS:CCDS20055.1 GeneID:23925 MGI:1346053
definition	GO_function : GO:0004175 - endopeptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Kell protein; Kel blood group protein product : Kell blood group protein_id : NP_115929.2

name	Olfr459 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129497 CCDS:CCDS20056.1 GeneID:258569 MGI:3030293
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-5780974-5781915; olfactory receptor MOR120-1 product : olfactory receptor 459 protein_id : NP_666787.1

name	Pip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601068 GeneID:18716 MGI:102696
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : gross cystic disease fluid protein 15 product : prolactin induced protein protein_id : NP_032869.2

name	Sval2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14211544 CCDS:CCDS20057.1 GeneID:84543 MGI:1934254
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : SLP in the mammary gland; SVA-like protein in the mammary gland product : seminal vesicle antigen-like 2 protein_id : NP_115931.1

name	Sval1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14269570 CCDS:CCDS20058.1 GeneID:71578 MGI:1918828
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : SVA-like protein in the colon product : seminal vesicle antigen-like 1 protein_id : NP_082108.1

name	Sval3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56710338 CCDS:CCDS20059.1 GeneID:387564 MGI:3047714
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : seminal vesicle autoantigen like protein 3 product : seminal vesicle antigen-like 3 protein_id : NP_001003952.1

name	Sva (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678187 CCDS:CCDS20060.1 GeneID:20939 MGI:102785
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence TAS] codon_start : 1 exception : mismatches in translation product : seminal vesicle antigen protein_id : NP_033325.1

name	Tas2r139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044479 CCDS:CCDS20061.1 GeneID:353148 MGI:2681308
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : candidate taste receptor mt2r34 product : taste receptor, type 2, member 139 protein_id : NP_851792.1

name	Tas2r144 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824893 CCDS:CCDS20062.1 GeneID:387515 MGI:2681312
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 144 protein_id : NP_001001453.1

name	Gstk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313138 CCDS:CCDS20063.1 GeneID:76263 MGI:1923513
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030288 - periplasmic space (sensu Proteobacteria) [Evidence IEA] GO_function : GO:0004602 - glutathione peroxidase activity [Evidence IDA]; GO:0004364 - glutathione transferase activity [Evidence IDA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA] codon_start : 1 product : glutathione S-transferase class kappa protein_id : NP_083831.1

name	Tmem139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425120 GeneID:109218 MGI:1924444
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC109218 protein_id : NP_780617.1

name	Casp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680848 CCDS:CCDS20064.1 GeneID:12366 MGI:97295
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence ISS] [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 function : cysteine protease product : caspase 2 protein_id : NP_031636.1

name	Clcn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789048 GeneID:12723 MGI:88417
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : arrested development of righting response; chloride channel protein product : chloride channel 1 protein_id : NP_038519.1

name	6330503C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625815 GeneID:76156 MGI:1923406
definition	codon_start : 1 product : hypothetical protein LOC76156 protein_id : NP_083804.2

name	Zyx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756085 CCDS:CCDS20066.1 GeneID:22793 MGI:103072
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : zyxin protein_id : NP_035907.1

name	Epha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980651 CCDS:CCDS20067.1 GeneID:13835 MGI:107381
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : Eph receptor A1 protein_id : NP_076069.2

name	Tas2r143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824878 CCDS:CCDS20068.1 GeneID:387514 MGI:2681310
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 143 protein_id : NP_001001452.1

name	Tas2r135 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255301 CCDS:CCDS20069.1 GeneID:387512 MGI:2681302
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 135 protein_id : NP_954610.1

name	Tas2r126 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309601 CCDS:CCDS20070.1 GeneID:387353 MGI:2681273
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 126 protein_id : NP_996911.1

name	Olfr458 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238926 CCDS:CCDS20071.1 GeneID:258436 MGI:3030292
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-5100053-5100994; olfactory receptor MOR257-4 product : olfactory receptor 458 protein_id : NP_666655.1

name	Olfr457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128963 CCDS:CCDS20072.1 GeneID:258989 MGI:3030291
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-5088893-5089834; olfactory receptor MOR257-1 product : olfactory receptor 457 protein_id : NP_667198.1

name	Olfr456 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372128 CCDS:CCDS20073.1 GeneID:259144 MGI:3030290
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P3E9-5073878-5074816; olfactory receptor MOR257-7P product : olfactory receptor 456 protein_id : NP_001011528.1

name	EG546896 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486825 GeneID:546896 MGI:3648300
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : predicted gene, EG546896 protein_id : NP_001074770.1

name	Eapa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42794267 CCDS:CCDS20074.1 GeneID:403088 MGI:3042585
definition	codon_start : 1 product : experimental autoimmune prostatitis antigen 2 protein_id : NP_981933.1

name	BC011487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122713 CCDS:CCDS20075.1 GeneID:232748 MGI:2385258
definition	codon_start : 1 product : hypothetical protein LOC232748 protein_id : NP_666286.1

name	3321401G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037491 CCDS:CCDS20076.1 GeneID:77574 MGI:1914665
definition	codon_start : 1 product : hypothetical protein LOC77574 protein_id : NP_084206.1

name	LOC100039918 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255067 GeneID:100039918
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473833.1

name	Olfr453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801364 CCDS:CCDS20077.1 GeneID:258016 MGI:3030287
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4815856-4814903; olfactory receptor MOR257-8P product : olfactory receptor 453 protein_id : NP_001011799.1

name	Olfr38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128961 CCDS:CCDS20078.1 GeneID:258988 MGI:1313140
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4797841-4796888 product : olfactory receptor 38 protein_id : NP_667197.1

name	Olfr452 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801492 CCDS:CCDS20079.1 GeneID:258207 MGI:3030286
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4769843-4768890; olfactory receptor MOR257-5P product : olfactory receptor 452 protein_id : NP_001011869.1

name	Olfr450 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238924 CCDS:CCDS20080.1 GeneID:258437 MGI:3030284
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4742413-4741481; olfactory receptor MOR257-3 product : olfactory receptor 450 protein_id : NP_666656.1

name	Olfr449 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128827 CCDS:CCDS20081.1 GeneID:259067 MGI:3030283
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4722003-4721068; olfactory receptor MOR103-1 product : olfactory receptor 449 protein_id : NP_667275.1

name	Olfr448 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129737 CCDS:CCDS20082.1 GeneID:258270 MGI:3030282
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4663051-4662119; olfactory receptor MOR261-13 product : olfactory receptor 448 protein_id : NP_666385.1

name	Olfr447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128957 CCDS:CCDS20083.1 GeneID:258990 MGI:3030281
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4647978-4647046; olfactory receptor MOR261-1 product : olfactory receptor 447 protein_id : NP_667199.1

name	Olfr446 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129699 CCDS:CCDS20084.1 GeneID:258292 MGI:3030280
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4632269-4631343; olfactory receptor MOR261-12 product : olfactory receptor 446 protein_id : NP_666407.1

name	Olfr444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238922 CCDS:CCDS20085.1 GeneID:258650 MGI:3030278
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4602571-4601639; olfactory receptor MOR261-2 product : olfactory receptor 444 protein_id : NP_666867.1

name	EG622841 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:622841 MGI:3643501
definition	codon_start : 1 exception : rearrangement required for product

name	Igk-V (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16080 MGI:96499
definition	codon_start : 1 exception : rearrangement required for product

name	Olfr441 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238916 CCDS:CCDS20086.1 GeneID:258649 MGI:3030275
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4442577-4441645; olfactory receptor MOR261-3 product : olfactory receptor 441 protein_id : NP_666866.1

name	Olfr438 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238918 CCDS:CCDS20087.1 GeneID:258648 MGI:3030272
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4404793-4403861; olfactory receptor MOR261-4 product : olfactory receptor 438 protein_id : NP_666865.1

name	Olfr437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129693 CCDS:CCDS20088.1 GeneID:258293 MGI:3030271
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4391088-4390156; olfactory receptor MOR261-11 product : olfactory receptor 437 protein_id : NP_666408.1

name	Olfr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203791 CCDS:CCDS20089.1 GeneID:18310 MGI:104812
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR261-6; GA_x6K02T2P3E9-4384160-4383228; odorant receptor product : olfactory receptor 13 protein_id : NP_666863.1

name	Olfr435 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238912 CCDS:CCDS20090.1 GeneID:258647 MGI:3030269
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4356476-4355535; olfactory receptor MOR261-5 product : olfactory receptor 435 protein_id : NP_666864.1

name	Olfr434 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129565 CCDS:CCDS20091.1 GeneID:258366 MGI:3030268
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4341246-4340281; olfactory receptor MOR261-10 product : olfactory receptor 434 protein_id : NP_666481.1

name	Olfr47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203777 CCDS:CCDS20092.1 GeneID:18346 MGI:1333821
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-4322325-4321360; olfactory receptor MOR261-9 product : olfactory receptor 47 protein_id : NP_666482.1

name	Arhgef5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255070 GeneID:54324 MGI:1858952
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : Rho guanine nucleotide exchange factor (GEF) 5 protein_id : XP_001481332.1 transl_except : (pos:43222314..43222316,aa:OTHER) transl_except : (pos:43222365..43222367,aa:OTHER) transl_except : (pos:43222374..43222376,aa:OTHER) transl_except : (pos:43222398..43222400,aa:OTHER) transl_except : (pos:43222485..43222487,aa:OTHER) transl_except : (pos:43222488..43222490,aa:OTHER) transl_except : (pos:43222506..43222508,aa:OTHER) transl_except : (pos:43222635..43222637,aa:OTHER) transl_except : (pos:43222671..43222673,aa:OTHER) transl_except : (pos:43222716..43222718,aa:OTHER) transl_except : (pos:43222734..43222736,aa:OTHER) transl_except : (pos:43222779..43222781,aa:OTHER) transl_except : (pos:43223025..43223027,aa:OTHER) transl_except : (pos:43223049..43223051,aa:OTHER) transl_except : (pos:43223202..43223204,aa:OTHER) transl_except : (pos:43223211..43223213,aa:OTHER) transl_except : (pos:43223262..43223264,aa:OTHER) transl_except : (pos:43223322..43223324,aa:OTHER) transl_except : (pos:43223352..43223354,aa:OTHER) transl_except : (pos:43223355..43223357,aa:OTHER) transl_except : (pos:43223373..43223375,aa:OTHER) transl_except : (pos:43223412..43223414,aa:OTHER) transl_except : (pos:43223421..43223423,aa:OTHER) transl_except : (pos:43223442..43223444,aa:OTHER) transl_except : (pos:43223550..43223552,aa:OTHER) transl_except : (pos:43223649..43223651,aa:OTHER) transl_except : (pos:43223778..43223780,aa:OTHER) transl_except : (pos:43224081..43224083,aa:OTHER) transl_except : (pos:43224207..43224209,aa:OTHER) transl_except : (pos:43224279..43224281,aa:OTHER) transl_except : (pos:43224378..43224380,aa:OTHER) transl_except : (pos:43224426..43224428,aa:OTHER) transl_except : (pos:43224486..43224488,aa:OTHER) transl_except : (pos:43224516..43224518,aa:OTHER) transl_except : (pos:43224528..43224530,aa:OTHER) transl_except : (pos:43224555..43224557,aa:OTHER) transl_except : (pos:43224561..43224563,aa:OTHER) transl_except : (pos:43224603..43224605,aa:OTHER) transl_except : (pos:43224696..43224698,aa:OTHER) transl_except : (pos:43224810..43224812,aa:OTHER) transl_except : (pos:43225056..43225058,aa:OTHER) transl_except : (pos:43225164..43225166,aa:OTHER) transl_except : (pos:43225227..43225229,aa:OTHER) transl_except : (pos:43226839..43226841,aa:OTHER) transl_except : (pos:43227028..43227030,aa:OTHER) transl_except : (pos:43229455..43229457,aa:OTHER) transl_except : (pos:43229488..43229490,aa:OTHER) transl_except : (pos:43229494..43229496,aa:OTHER) transl_except : (pos:43230174..43230176,aa:OTHER) transl_except : (pos:43230228..43230230,aa:OTHER) transl_except : (pos:43230309..43230311,aa:OTHER) transl_except : (pos:43230312,aa:OTHER) transl_except : (pos:43230597..43230598,aa:OTHER) transl_except : (pos:43230635..43230637,aa:OTHER) transl_except : (pos:43230680..43230682,aa:OTHER) transl_except : (pos:43230957..43230959,aa:OTHER) transl_except : (pos:43231017..43231019,aa:OTHER) transl_except : (pos:43231423..43231425,aa:OTHER) transl_except : (pos:43231483..43231485,aa:OTHER) transl_except : (pos:43233207..43233209,aa:OTHER) transl_except : (pos:43233222..43233224,aa:OTHER) transl_except : (pos:43233255..43233257,aa:OTHER) transl_except : (pos:43233267..43233269,aa:OTHER) transl_except : (pos:43233957..43233959,aa:OTHER) transl_except : (pos:43237599..43237601,aa:OTHER) transl_except : (pos:43237617..43237619,aa:OTHER) transl_except : (pos:43238628..43238630,aa:OTHER) transl_except : (pos:43238673..43238675,aa:OTHER) transl_except : (pos:43238754..43238756,aa:OTHER)

name	Nobox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536236 CCDS:CCDS20093.1 GeneID:18291 MGI:108011
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : newborn ovary homeobox product : OG2 homeobox protein_id : NP_570939.1

name	Tpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305589 GeneID:29807 MGI:1352500
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004788 - thiamin diphosphokinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009229 - thiamin diphosphate biosynthesis [Evidence IEA]; GO:0006772 - thiamin metabolism [Evidence IDA] codon_start : 1 product : thiamin pyrophosphokinase protein_id : NP_038889.1

name	LOC665745 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665745
definition	number : 1 pseudo : _no_value

name	LOC665745 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665745
definition	number : 2 pseudo : _no_value

name	Igk-V (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:16080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 Proteins standard_name : Igk-V

name	Tcrb-V13 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:269846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins standard_name : Tcrb-V13

name	EG622841 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:622841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins standard_name : EG622841

name	(CDS detail)
type	STS
link
xref	UniSTS:124936
definition	standard_name : M22605

name	(CDS detail)
type	STS
link
xref	UniSTS:144580
definition	standard_name : Tcrb-C

name	(CDS detail)
type	STS
link
xref	UniSTS:144578
definition	standard_name : Tcrb

name	(CDS detail)
type	STS
link
xref	UniSTS:116606
definition	standard_name : D6Mit117

name	(CDS detail)
type	STS
link
xref	UniSTS:495891
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:502658
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:266995
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:159494
definition	standard_name : L77867

name	(CDS detail)
type	STS
link
xref	UniSTS:207941
definition	standard_name : BB111090

name	(CDS detail)
type	STS
link
xref	UniSTS:125978
definition	standard_name : mHAa31g5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:226138
definition	standard_name : Kel

name	(CDS detail)
type	STS
link
xref	UniSTS:491665
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:123745
definition	standard_name : 26.MMHAP59FRA11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207940
definition	standard_name : BE630354

name	(CDS detail)
type	STS
link
xref	UniSTS:207938
definition	standard_name : BE627963

name	(CDS detail)
type	STS
link
xref	UniSTS:179365
definition	standard_name : AU046084

name	(CDS detail)
type	STS
link
xref	UniSTS:495716
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488647
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495460
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488670
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130818
definition	standard_name : D6Mit271

name	(CDS detail)
type	STS
link
xref	UniSTS:178669
definition	standard_name : AW260476

name	(CDS detail)
type	STS
link
xref	UniSTS:493102
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159495
definition	standard_name : Y13085

name	(CDS detail)
type	STS
link
xref	UniSTS:141230
definition	standard_name : Casp2

name	(CDS detail)
type	STS
link
xref	UniSTS:210786
definition	standard_name : RH127476

name	(CDS detail)
type	STS
link
xref	UniSTS:164323
definition	standard_name : AV277466

name	(CDS detail)
type	STS
link
xref	UniSTS:224737
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161999
definition	standard_name : RH125177

name	(CDS detail)
type	STS
link
xref	UniSTS:115356
definition	standard_name : D4Got51

name	(CDS detail)
type	STS
link
xref	UniSTS:161029
definition	standard_name : RH124207

name	(CDS detail)
type	STS
link
xref	UniSTS:495879
definition	standard_name : Epha1

name	(CDS detail)
type	STS
link
xref	UniSTS:490635
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487849
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488669
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488668
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489351
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492723
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179366
definition	standard_name : AI848529

name	(CDS detail)
type	STS
link
xref	UniSTS:222719
definition	standard_name : RH140650

name	(CDS detail)
type	STS
link
xref	UniSTS:485200
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142599
definition	standard_name : D6Nds4

name	(CDS detail)
type	STS
link
xref	UniSTS:491637
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492964
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485062
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489486
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495351
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167489
definition	standard_name : D6Ertd456e

name	(CDS detail)
type	STS
link
xref	UniSTS:485136
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492945
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492929
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492687
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489402
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494966
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495340
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179367
definition	standard_name : AW495314

name	(CDS detail)
type	STS
link
xref	UniSTS:235430
definition

name	LOC232745 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255079 GeneID:232745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to 60S ribosomal protein L7a (Surfeit locus protein 3) pseudo : _no_value transcript_id : XR_032251.1

name	LOC665747 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255080 GeneID:665747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase pseudo : _no_value transcript_id : XR_032342.1

clone name	MSMg01-493B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-130F05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-260O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092N16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-157L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-070D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-545D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-364H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399F21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-068B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352K13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-463M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-331C07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-462B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302A15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-497A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-237O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-134N19.b	B6Ng01-134N19.g
ACC	DH935053	DH935054
length	457	1,144
definition	DH935053\|Mus musculus domesticus DNA, BAC clone: B6Ng01-134N19, 5' end.	DH935054\|Mus musculus domesticus DNA, BAC clone: B6Ng01-134N19, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(42,299,372 - 42,299,834)	(42,422,040 - 42,423,167)
sequence	ctagaagccttaagaggctgcctagctcaggaagttagcattcccccagc ttaggctcctgctcacacactagtgggttacagaaggccggcctgggagc caagtgcccgcagggccaacgtcccttcaccatcccccgcccacccagga gtacagttccatcccagtcctgcgttccgggactgaccacaggacacgtg ggacgcggagctgaagctgcagggaggggcggggtcggtcaatggcaggc aggcccggggtgcgcgactgagctgcttcaggaccgctgggattactagc cagcctgctcagcctggagtgcggacagtgagtcagttctccagcactcg cgggtcgggaggagggaggtggggtaggtggcaggtcaggaaatgacatc agaggcctgtgctggggaagggtggtctgtgcccggcgggggcggtcgtg agtaagg	gaattcccacagtgagaggattgagagcttcctcattacttcacgcttgg tgtcaatatgtctgcctcctattgctcaccaaaaactcacactttcttaa atatctaaataaaggctaaaatttaattattatccaattactgaccttgt tcttttcatagcatttaacacaatttaattaatgtgtataattttcaatt atactttgtgtccgtgattacattatatgaatgaagatggggggacttgt gattctgtcttgtgtatcacacagagagggacccctacaatactcctagc acacaggatgtatccatctcaaagagacacacatcctaaggactgatggc tacaggaaggagtatgtaggaggattctcttctacactgccacttacact ggagtttattgagaacaagaatagcagcagaatggatgctttcaaaatgt ttcaaaggaatgttgaagtacccatctcaggcccagtggtacccataaga ctttagctgctactgtctgatagagaagaatctgcctttcattccaattt tcccattgtaattaaaaccttttctttttcaagctttcctttaagagttt tgttgttgttattgttgtttgccctcactttcattttaaatcttgtatta ttctcctttttccatcattcattttacttgtattcagtcctacattggca gactactccttatattgtttcaattggaagagtgctagaaattttttaag gtaaattgagagtggagggttggctcttcgcaatctcatgtatttgtgtc agtggccaaatcttcctttctccattgttttggatatgtcctttccctaa tcacctaggttaaagcaccaggctgtgtcccaggtccaactgcaatccta gcctaaggactcagtgcatagcctatgctgacacctgtacttgccctctc tgactgctcttcctctactcctggccagcagtcccaactgcttccatgta ggagagaccattgcaccctgggtaagtgaggtttatccctcatgggttct ctccggtgacaaacaccatcccaagcctggacttctttgtcctcttgggg tcatctactgggtggaccctcggcctgggcaatgggcttcatcg
quality values	Open. Hide. 61 61 61 55 61 61 61 55 61 61 61 61 61 59 61 61 59 59 61 43 43 45 36 28 24 26 52 38 35 52 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 50 53 50 34 50 43 37 50 43 53 45 50 35 50 43 16 6 22 8 22 10 15 29 32 32 42 35 35 42 35 50 50 50 50 39 53 31 23 32 27 27 27 39 50 42 35 21 22 20 13 23 8 14 26 19 26 27 8 6 8 7 6 6 6 15 25 22 22 15 8 15 12	Open. Hide. 61 49 52 49 61 43 52 49 31 50 20 28 41 59 61 59 59 61 61 38 37 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 47 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 53 61 61 46 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 52 57 40 57 57 40 57 57 45 57 57 53 48 57 57 57 57 57 50 57 57 57 47 24 57 53 57 57 57 57 57 57 43 53 57 57 41 42 53 47 41 47 57 53 57 47 47 47 57 57 39 53 53 57 57 57 50 45 30 57 53 53 57 47 57 50 53 57 57 52 40 57 40 57 36 57 57 57 57 52 53 57 57 57 57 53 39 47 39 52 57 57 38 57 53 57 57 53 45 37 43 46 33 53 50 57 53 57 35 45 40 42 57 57 44 41 52 57 50 57 34 52 57 35 52 41 39 53 30 53 57 42 57 52 45 52 57 57 53 52 50 35 50 53 40 52 52 41 27 46 57 41 36 37 30 34 47 57 38 38 37 40 52 38 52 42 52 57 37 37 53 24 52 43 53 41 29 52 27 52 25 39 48 53 53 39 38 29 52 57 40 37 21 14 38 40 57 37 40 37 22 33 43 48 33 40 40 31 57 26 36 53 37 47 35 29 57 57 53 33 57 57 57 57 36 33 21 6 19 18 19 53 30 31 57 40 44 30 46 28 29 47 40 40 26 46 31 9 11 24 40 30 34 34 38 32 29 21 32 16 26 29 31 30 35 28 30 32 18 29 30 48 33 45 19 30 32 32 28 22 22 46 29 25 28 33 46 39 28 37 18 31 29 27 5 39 14 15 16 25 30 17 29 21 27 19 47 44 28 28 27 20 10 29 25 29 28 35 39 12 43 17 33 51 29 29 33 33 29 29 17 30 29 28 32 18 31 20 17 22 29 39 30 33 28 28 29 18 7 20 16 29 35 25 15 12 21 24 21 15 7 21 11 12 23 20 29 10 23 29 26 22 16 29 25 26 27 22 28 26 24 18 6 23 39 15 35 19 38 34 34 31 21 41 31 28 27 34 12 25 23 28 31 28 28 31 30 22 33 16 9 19 29 34 34 7 16 28 24 36 34 31 36 21 30 27 29 28 33 30 29 20 19 29 20 32 15 18 38 34 15 17 20 16 27 26 28 9 30 19 29 30 5 20 21 26 19 22 14 17 19 35 19 13 17 19 13 20 17 19 9 9 6 7 28 16 4 16 5 6 18 6 13 5 6 4 4 11 4 7 16 12 22 6 33 14 9 32 33 30 17 22 33 12 14 7 7 5 7 19 35 17 30 21 22 38 10 20 12 13 7 14 42 29 8 13 17 20 6 5 4 8 3 4 6 29 17 7 7 36 9 9 9 10 8 7 17 7 25 6 23 29 10 10 15 8 14 8 11 9 12 6 5 15 25 19 20 15 17 7 4 11 8 8 6 27 26 25 5 5 14 8 13 7 6 11 7 8 4 3 9 9 5 11 4 3 4 5 5 5 5 6 8 11 26 26 11 5 8 27 11 21 18 12 2 9 9 11 11 10 18 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_42299372_42299834
seq2: B6Ng01-134N19.b_45_507

seq1  GAATTCCTAGAAGCCTTAAGAGGCTGCCTAGCTCAGGAAGTTAGCATTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTAGAAGCCTTAAGAGGCTGCCTAGCTCAGGAAGTTAGCATTCC  50

seq1  CCCAGCTTAGGCTCCTGCTCACACACTAGTGGGTTACAGAAGGCCGGCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCTTAGGCTCCTGCTCACACACTAGTGGGTTACAGAAGGCCGGCCT  100

seq1  GGGAGCCAAGTGCCCGCAGGGCCAACGTCCCTTCACCATCCCCCGCCCAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGCCAAGTGCCCGCAGGGCCAACGTCCCTTCACCATCCCCCGCCCAC  150

seq1  CCAGGAGTACAGTTCCATCCCAGTCCTGCGTTCCGGGACTGACCACAGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGAGTACAGTTCCATCCCAGTCCTGCGTTCCGGGACTGACCACAGGA  200

seq1  CACGTGGGACGCGGAGCTGAAGCTGCAGGGAGGGGCGGGGTCGGTCAATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGTGGGACGCGGAGCTGAAGCTGCAGGGAGGGGCGGGGTCGGTCAATG  250

seq1  GCAGGCAGGCCCGGGGTGCGCGACTGAGCTGCTTCAGGACCGCTGGGATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGCAGGCCCGGGGTGCGCGACTGAGCTGCTTCAGGACCGCTGGGATT  300

seq1  ACTAGCCAGCCTGCTCAGCCTGGAGTGCGGACAGTGAGTCAGTTCTCCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAGCCAGCCTGCTCAGCCTGGAGTGCGGACAGTGAGTCAGTTCTCCAG  350

seq1  CACTCGCGGGTCGGGAGGAGGGAGGTGGGGTAGGTGGCAGGTCAGGAAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCGCGGGTCGGGAGGAGGGAGGTGGGGTAGGTGGCAGGTCAGGAAAT  400

seq1  GACATCAGAGGCCTGTGCTGGGGAAGGGTGGTCTGTGCCCGGCGGGGGCG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATCAGAGGCCTGTGCTGGGGAAGGGTGGTCTGTGCCCGGCGGGGGCG  450

seq1  GTGGTGAGTAGGG  463
      || ||||||| ||
seq2  GTCGTGAGTAAGG  463

seq1: chr6_42422040_42423167
seq2: B6Ng01-134N19.g_69_1212 (reverse)

seq1  CGATG-AGCCCATTGCCCA-GCAGAG---TCAACAGGTAGATGACCCCAA  45
      ||||| ||||||||||||| || |||    || |  |||||||||||| |
seq2  CGATGAAGCCCATTGCCCAGGCCGAGGGTCCACCCAGTAGATGACCCC-A  49

seq1  AGAGGACAAAG-AGTCCA-GCTT-GGAT-GTGTTTGTCACTGGAGAG-AC  90
      ||||||||||| |||||| |||| |||| ||||||||||| |||||| ||
seq2  AGAGGACAAAGAAGTCCAGGCTTGGGATGGTGTTTGTCACCGGAGAGAAC  99

seq1  CCATGA-GGATAAA-CTCACTTACCCAGGTTGC-ATTGTCTCT-CTTCAT  136
      |||||| ||||||| |||||||||||||| ||| || |||||| || |||
seq2  CCATGAGGGATAAACCTCACTTACCCAGGGTGCAATGGTCTCTCCTACAT  149

seq1  GG-AGCAGTTGGGACTGCTGGCCAGGAGTAGAGGAAGAGCAGTCAGAGAG  185
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGCAGTTGGGACTGCTGGCCAGGAGTAGAGGAAGAGCAGTCAGAGAG  199

seq1  GGCAAGTACAGGTGTCAGCATAGGCTATGCACTGAGTCC-TAGGCTAGGA  234
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  GGCAAGTACAGGTGTCAGCATAGGCTATGCACTGAGTCCTTAGGCTAGGA  249

seq1  TTGCAGTTGGACCTGGGACACAGCCTGGTGCTTTAACCTAGGTGATTAGG  284
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAGTTGGACCTGGGACACAGCCTGGTGCTTTAACCTAGGTGATTAGG  299

seq1  G-AAGGACATATCCAAAACAATGGAGAAAGGAAGATTTGGCCACTGACAC  333
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGACATATCCAAAACAATGGAGAAAGGAAGATTTGGCCACTGACAC  349

seq1  AAATACATGAGATTGCGAAGAGCCAACCCTCCACTCTCAATTTACCTTAA  383
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACATGAGATTGCGAAGAGCCAACCCTCCACTCTCAATTTACCTTAA  399

seq1  AAAATTTCTAGCACTCTTCCAATTGAAACAATATAAGGAGTAGTCTGCCA  433
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTTCTAGCACTCTTCCAATTGAAACAATATAAGGAGTAGTCTGCCA  449

seq1  ATGTAGGACTGAATACAAGTAAAATGAATGATGGAAAAAGGAGAATAATA  483
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAGGACTGAATACAAGTAAAATGAATGATGGAAAAAGGAGAATAATA  499

seq1  CAAGATTTAAAATGAAAGTGAGGGCAAACAACAATAACAACAACAAAACT  533
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGATTTAAAATGAAAGTGAGGGCAAACAACAATAACAACAACAAAACT  549

seq1  CTTAAAGGAAAGCTTGAAAAAGAAAAGGTTTTAATTACAATGGGAAAATT  583
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAAGGAAAGCTTGAAAAAGAAAAGGTTTTAATTACAATGGGAAAATT  599

seq1  GGAATGAAAGGCAGATTCTTCTCTATCAGACAGTAGCAGCTAAAGTCTTA  633
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATGAAAGGCAGATTCTTCTCTATCAGACAGTAGCAGCTAAAGTCTTA  649

seq1  TGGGTACCACTGGGCCTGAGATGGGTACTTCAACATTCCTTTGAAACATT  683
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTACCACTGGGCCTGAGATGGGTACTTCAACATTCCTTTGAAACATT  699

seq1  TTGAAAGCATCCATTCTGCTGCTATTCTTGTTCTCAATAAACTCCAGTGT  733
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAGCATCCATTCTGCTGCTATTCTTGTTCTCAATAAACTCCAGTGT  749

seq1  AAGTGGCAGTGTAGAAGAGAATCCTCCTACATACTCCTTCCTGTAGCCAT  783
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGGCAGTGTAGAAGAGAATCCTCCTACATACTCCTTCCTGTAGCCAT  799

seq1  CAGTCCTTAGGATGTGTGTCTCTTTGAGATGGATACATCCTGTGTGCTAG  833
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCCTTAGGATGTGTGTCTCTTTGAGATGGATACATCCTGTGTGCTAG  849

seq1  GAGTATTGTAGGGGTCCCTCTCTGTGTGATACACAAGACAGAATCACAAG  883
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTATTGTAGGGGTCCCTCTCTGTGTGATACACAAGACAGAATCACAAG  899

seq1  TCCCCCCATCTTCATTCATATAATGTAATCACGGACACAAAGTATAATTG  933
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCCCATCTTCATTCATATAATGTAATCACGGACACAAAGTATAATTG  949

seq1  AAAATTATACACATTAATTAAATTGTGTTAAATGCTATGAAAAGAACAAG  983
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTATACACATTAATTAAATTGTGTTAAATGCTATGAAAAGAACAAG  999

seq1  GTCAGTAATTGGATAATAATTAAATTTTAGCCTTTATTTAGATATTTAAG  1033
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGTAATTGGATAATAATTAAATTTTAGCCTTTATTTAGATATTTAAG  1049

seq1  AAAGTGTGAGTTTTTGGTGAGCAATAGGAGGCAGACATATTGACACCAAG  1083
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTGTGAGTTTTTGGTGAGCAATAGGAGGCAGACATATTGACACCAAG  1099

seq1  CGTGAAGTAATGAGGAAGCTCTCAATCCTCTCACTGTGGGAATTC  1128
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGAAGTAATGAGGAAGCTCTCAATCCTCTCACTGTGGGAATTC  1144

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information