MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-210A16
Chromosome	6 (Build37)
Map Location	69,612,384 - 69,613,512
singlet/doublet	singlet
Overlap gene	Igk
Upstream gene	Igkv2-95-1, EG434031, EG667550, Igkv2-93-1, Igkv19-93, Gm1408, ENSMUSG00000056850, Igkv4-90, Igkv13-89-1, Igkv12-89, Igkv1-88, Igkv13-87, Gm459, Igkv13-85, Igkv13-84, Igkv4-83, Igkv13-82, Gm460, Igkv13-80-1, Igkv4-80, Gm194, EG628498, Igkv4-78, EG667621, Igkv13-76, Igkv4-75, Igkv13-74-1, LOC236047, Igkv13-73-1, EG628516, Gm1499, Igkv13-71-1, Igkv4-71, Gm1502, EG628541, Gm1419, Igkv12-67, Igkv12-66, Igkv4-65, Igkv13-64, EG628571, Igkv13-62-1, EG636752, Igkv13-61-1, Igkv4-61, EG667683, Igkv4-60, Gm1077, Igkv13-57-2, Gm1418, Igkv13-57-1, Gm189, Igkv13-56-1, Igkv4-56, Igkv13-55-1, Gm1524, Igkv13-54-1, Igkv4-54, Gm1420
Downstream gene	Igkv4-51, Gm1069, Igkv12-49, Igkv5-48, ENSMUSG00000029975, Igkv12-46, Igkv5-45, Igkv12-44, Igkv5-43, Igkv12-42, Igkv12-41, Igkv5-40-1, Igkv12-40, Gm1409, Igkv12-38, Gm1410, Igkv18-36, Igkv1-35, Igkv8-34, U29423, ENSMUSG00000053690, Igkv8-31, Igkv8-30, LOC545852, Igkv6-29, Igkv8-28, Igkv8-27, Igkv8-26, LOC667812, Igkv6-25, Igkv8-24, Igkv8-23-1, Igkv6-23, LOC667829, Igkv8-22, Igk-V8-21, EG667840, Igk-V19-20, Igk-V8-19, Igk-V8-18, LOC667863, Igk-V19-17, Igk-V8-16, Igk-V19-15, LOC667872, LOC620497, Igk-V19-14, LOC667889, Igk-V19-13, LOC667902, Igkv3-12-1, Igk-V21-12, Igk-V21-11, Igk-V21-10, Igk-V21-9, Igk-V21-8, Igk-V21-7, Igk-V21-6, Igk-V21-5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Igk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243469 MGI:96494
definition	gene_synonym : kappa note : immunoglobulin kappa chain complex

name	Igkv2-95-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692163 IMGT/GENE-DB:IGKV2-95-1
definition	gene_synonym : hb24 note : immunoglobulin kappa chain variable pseudo : _no_value

name	EG434031 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434031 IMGT/GENE-DB:IGKV10-95 MGI:3644598
definition	gene_synonym : Igkv10-95; Vk10c note : predicted gene, EG434031

name	EG667550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667550 IMGT/GENE-DB:IGKV10-94 MGI:3646140
definition	gene_synonym : AJ2; Igkv10-94 note : predicted gene, EG667550

name	Igkv2-93-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692162 IMGT/GENE-DB:IGKV2-93-1
definition	gene_synonym : hh24 note : immunoglobulin kappa chain variable 2-93-1 pseudo : _no_value

name	Igkv19-93 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692161 IMGT/GENE-DB:IGKV19-93
definition	note : immunoglobulin kappa chain variable 19-93

name	Gm1408 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384410 IMGT/GENE-DB:IGKV4-92 MGI:2686254
definition	gene_synonym : Igkay4; IGKV4-92 note : gene model 1408, (NCBI)

name	ENSMUSG00000056850 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434033 IMGT/GENE-DB:IGKV4-91 MGI:3642277
definition	gene_synonym : Igkv4-91; kf4 note : predicted gene, ENSMUSG00000056850

name	Igkv4-90 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434034 IMGT/GENE-DB:IGKV4-90
definition	gene_synonym : an4 note : immunoglobulin light chain variable region

name	Igkv13-89-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692155 IMGT/GENE-DB:IGKV13-89-1
definition	gene_synonym : gf33 note : immunoglobulin kappa chain variable 13-89-1 pseudo : _no_value

name	Igkv12-89 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384411 IMGT/GENE-DB:IGKV12-89
definition	gene_synonym : fl12 note : immunoglobulin light chain variable region

name	Igkv1-88 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692154 IMGT/GENE-DB:IGKV1-88
definition	note : immunoglobulin kappa chain variable 1-88

name	Igkv13-87 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692153 IMGT/GENE-DB:IGKV13-87
definition	note : immunoglobulin kappa chain variable 13-87 pseudo : _no_value

name	Gm459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243451 IMGT/GENE-DB:IGKV4-86 MGI:2685305
definition	gene_synonym : IGKV4-86; kb4 note : gene model 459, (NCBI)

name	Igkv13-85 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434036 IMGT/GENE-DB:IGKV13-85
definition	gene_synonym : gn33 note : immunoglobulin light chain variable region

name	Igkv13-84 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692152 IMGT/GENE-DB:IGKV13-84
definition	gene_synonym : gm33 note : immunoglobulin kappa chain variable 13-84

name	Igkv4-83 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692145 IMGT/GENE-DB:IGKV4-83
definition	gene_synonym : kg4 note : immunoglobulin kappa chain variable 4-83 pseudo : _no_value

name	Igkv13-82 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692144 IMGT/GENE-DB:IGKV13-82
definition	note : immunoglobulin kappa chain variable 13-82 pseudo : _no_value

name	Gm460 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243453 IMGT/GENE-DB:IGKV4-81 MGI:2685306
definition	gene_synonym : IGKV4-81; IgVkag4 note : gene model 460, (NCBI)

name	Igkv13-80-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692143 IMGT/GENE-DB:IGKV13-80-1
definition	note : immunoglobulin kappa chain variable 13-80-1 pseudo : _no_value

name	Igkv4-80 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545848 IMGT/GENE-DB:IGKV4-80
definition	gene_synonym : af4 note : immunoglobulin kappa chain variable 4-80

name	Gm194 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213684 IMGT/GENE-DB:IGKV4-79 MGI:2685040
definition	gene_synonym : IGKV4-79; IgVkae4 note : gene model 194, (NCBI)

name	EG628498 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628498 IMGT/GENE-DB:IGKV13-78-1 MGI:3647961
definition	gene_synonym : gb33r; Igkv13-78-1 note : predicted gene, EG628498 pseudo : _no_value

name	Igkv4-78 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545849 IMGT/GENE-DB:IGKV4-78
definition	gene_synonym : ad4 note : immunoglobulin light chain variable region

name	EG667621 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667621 IMGT/GENE-DB:IGKV4-77 MGI:3647937
definition	gene_synonym : aj4; Igkv4-77 note : predicted gene, EG667621 pseudo : _no_value

name	Igkv13-76 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692142 IMGT/GENE-DB:IGKV13-76
definition	note : immunoglobulin kappa chain variable 13-76 pseudo : _no_value

name	Igkv4-75 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692141 IMGT/GENE-DB:IGKV4-75
definition	note : immunoglobulin kappa chain variable 4-75 pseudo : _no_value

name	Igkv13-74-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692140 IMGT/GENE-DB:IGKV13-74-1
definition	note : immunoglobulin kappa chain variable 13-74-1 pseudo : _no_value

name	LOC236047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236047 IMGT/GENE-DB:IGKV4-74
definition	gene_synonym : Gm192; IGKV4-74; IgVkai4 note : immunoglobulin kappa chain variable 4-74

name	Igkv13-73-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692139 IMGT/GENE-DB:IGKV13-73-1
definition	note : immunoglobulin kappa chain variable 13-73-1 pseudo : _no_value

name	EG628516 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628516 IMGT/GENE-DB:IGKV4-73 MGI:3645825
definition	gene_synonym : ah4; Igkv4-73 note : predicted gene, EG628516

name	Gm1499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385109 IMGT/GENE-DB:IGKV4-72 MGI:2686345
definition	gene_synonym : am4; IGKV4-72 note : gene model 1499, (NCBI)

name	Igkv13-71-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692138 IMGT/GENE-DB:IGKV13-71-1
definition	gene_synonym : gd33r note : immunoglobulin kappa chain variable 13-71-1 pseudo : _no_value

name	Igkv4-71 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434586 IMGT/GENE-DB:IGKV4-71
definition	gene_synonym : al4 note : immunoglobulin kappa chain variable 4-71

name	Gm1502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385120 IMGT/GENE-DB:IGKV4-70 MGI:2686348
definition	gene_synonym : IGKV4-70; kn4 note : gene model 1502, (NCBI)

name	EG628541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628541 IMGT/GENE-DB:IGKV4-69 MGI:3648668
definition	gene_synonym : Igkv4-69; km4 note : predicted gene, EG628541

name	Gm1419 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384515 IMGT/GENE-DB:IGKV4-68 MGI:2686265
definition	gene_synonym : aa4; Gm151; Gm636; IGKV4-68; IgVk note : gene model 1419, (NCBI)

name	Igkv12-67 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628551 IMGT/GENE-DB:IGKV12-67
definition	gene_synonym : fg12 note : immunoglobulin kappa chain variable 12-67 pseudo : _no_value

name	Igkv12-66 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692133 IMGT/GENE-DB:IGKV12-66
definition	gene_synonym : fr12 note : immunoglobulin kappa chain variable 12-66 pseudo : _no_value

name	Igkv4-65 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667670 IMGT/GENE-DB:IGKV4-65
definition	gene_synonym : ki4 note : immunoglobulin kappa chain variable 4-65 pseudo : _no_value

name	Igkv13-64 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628564 IMGT/GENE-DB:IGKV13-64
definition	gene_synonym : gu33 note : immunoglobulin kappa chain variable 13-64 pseudo : _no_value

name	EG628571 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628571 IMGT/GENE-DB:IGKV4-63 MGI:3645235
definition	gene_synonym : ac4; Igkv4-63 note : predicted gene, EG628571

name	Igkv13-62-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692119 IMGT/GENE-DB:IGKV13-62-1
definition	gene_synonym : gc33r note : immunoglobulin kappa chain variable 13-62-1 pseudo : _no_value

name	EG636752 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636752 IMGT/GENE-DB:IGKV4-62 MGI:3643587
definition	gene_synonym : ab4; Igkv4-62 note : predicted gene, EG636752

name	Igkv13-61-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692118 IMGT/GENE-DB:IGKV13-61-1
definition	gene_synonym : gh33r note : immunoglobulin kappa chain variable 13-61-1 pseudo : _no_value

name	Igkv4-61 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546244 IMGT/GENE-DB:IGKV4-61
definition	gene_synonym : aq4 note : immunoglobulin kappa chain variable 4-61

name	EG667683 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667683 IMGT/GENE-DB:IGKV4-59 MGI:3646808
definition	gene_synonym : Igkv4-59; kk4 note : predicted gene, EG667683

name	Igkv4-60 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385277 IMGT/GENE-DB:IGKV4-60
definition	gene_synonym : Gm1529; kl4 note : immunoglobulin kappa chain variable 4-60

name	Gm1077 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381831 IMGT/GENE-DB:IGKV4-58 MGI:2685923
definition	gene_synonym : IGKV4-58; kj4 note : gene model 1077, (NCBI)

name	Igkv13-57-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:724106 IMGT/GENE-DB:IGKV13-57-2
definition	note : immunoglobulin kappa variable 13-57-2 pseudo : _no_value

name	Gm1418 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384514 IMGT/GENE-DB:IGKV4-57-1 MGI:2686264
definition	gene_synonym : IGKV4-57-1 note : gene model 1418, (NCBI)

name	Igkv13-57-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692114 IMGT/GENE-DB:IGKV13-57-1
definition	gene_synonym : gz33r note : immunoglobulin kappa chain variable 13-57-1 pseudo : _no_value

name	Gm189 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235952 IMGT/GENE-DB:IGKV4-57 MGI:2685035
definition	gene_synonym : IGKV4-57 note : gene model 189, (NCBI)

name	Igkv13-56-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692113 IMGT/GENE-DB:IGKV13-56-1
definition	gene_synonym : gg33r note : immunoglobulin kappa chain variable 13-56-1 pseudo : _no_value

name	Igkv4-56 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619743 IMGT/GENE-DB:IGKV4-56
definition	gene_synonym : ao4 note : immunoglobulin kappa chain variable 4-56 pseudo : _no_value

name	Igkv13-55-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692112 IMGT/GENE-DB:IGKV13-55-1
definition	gene_synonym : gx33r note : immunoglobulin kappa chain variable 13-55-1 pseudo : _no_value

name	Gm1524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385253 IMGT/GENE-DB:IGKV4-55 MGI:2686370
definition	gene_synonym : at4; IGKV4-55 note : gene model 1524, (NCBI)

name	Igkv13-54-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692105 IMGT/GENE-DB:IGKV13-54-1
definition	gene_synonym : gy33r note : immunoglobulin kappa chain variable 13-54-1 pseudo : _no_value

name	Igkv4-54 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385291 IMGT/GENE-DB:IGKV4-54
definition	gene_synonym : ar4; Gm1530; ko4 note : immunoglobulin kappa chain variable 4-54

name	Gm1420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546213 IMGT/GENE-DB:IGKV4-53 MGI:2686266
definition	gene_synonym : Gm1526; IGKV4-53; IgVkkh4; kh4 note : gene model 1420, (NCBI)

name	Igkv4-51 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619806 IMGT/GENE-DB:IGKV4-51
definition	note : immunoglobulin kappa chain variable 4-51

name	Gm1069 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381782 IMGT/GENE-DB:IGKV4-50 MGI:2685915
definition	gene_synonym : IGKV4-50; IgVk4-50 note : gene model 1069, (NCBI)

name	Igkv12-49 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619824 IMGT/GENE-DB:IGKV12-49
definition	note : immunoglobulin kappa chain variable 12-49 pseudo : _no_value

name	Igkv5-48 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619846 IMGT/GENE-DB:IGKV5-48
definition	note : immunoglobulin kappa chain variable 5-48

name	ENSMUSG00000029975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434037 IMGT/GENE-DB:IGKV12-47 MGI:3642817
definition	gene_synonym : Igkv12-47 note : predicted gene, ENSMUSG00000029975 pseudo : _no_value

name	Igkv12-46 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692245 IMGT/GENE-DB:IGKV12-46
definition	note : immunoglobulin kappa chain variable 12-46

name	Igkv5-45 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545850 IMGT/GENE-DB:IGKV5-45
definition	gene_synonym : 23-45 note : immunoglobulin light chain variable region

name	Igkv12-44 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545851 IMGT/GENE-DB:IGKV12-44
definition	note : immunoglobulin kappa chain variable 12-44

name	Igkv5-43 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381783 IMGT/GENE-DB:IGKV5-43
definition	note : immunoglobulin kappa chain variable 5-43

name	Igkv12-42 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677861 IMGT/GENE-DB:IGKV12-42
definition	note : immunoglobulin kappa chain variable 12-42 pseudo : _no_value

name	Igkv12-41 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619960 IMGT/GENE-DB:IGKV12-41
definition	note : immunoglobulin kappa chain variable 12-41

name	Igkv5-40-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619974 IMGT/GENE-DB:IGKV5-40-1
definition	gene_synonym : fp23r note : immunoglobulin kappa chain variable 5-40-1 pseudo : _no_value

name	Igkv12-40 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435904 IMGT/GENE-DB:IGKV12-40
definition	note : immunoglobulin kappa chain variable 12-40 pseudo : _no_value

name	Gm1409 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620017 IMGT/GENE-DB:IGKV5-39 MGI:2686255
definition	gene_synonym : 23-39; IGKV5-39 note : gene model 1409, (NCBI)

name	Igkv12-38 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620050 IMGT/GENE-DB:IGKV12-38
definition	note : immunoglobulin kappa chain variable 12-38

name	Gm1410 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384417 IMGT/GENE-DB:IGKV5-37 MGI:2686256
definition	gene_synonym : 23-37; IGKV5-37 note : gene model 1410, (NCBI)

name	Igkv18-36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620088 IMGT/GENE-DB:IGKV18-36
definition	gene_synonym : dv-36 note : immunoglobulin kappa chain variable 18-36

name	Igkv1-35 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620105 IMGT/GENE-DB:IGKV1-35
definition	gene_synonym : cu2 note : immunoglobulin kappa chain variable 1-35

name	Igkv8-34 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620126 IMGT/GENE-DB:IGKV8-34
definition	note : immunoglobulin kappa chain variable 8-34

name	U29423 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243461 IMGT/GENE-DB:IGKV7-33 MGI:3577282
definition	gene_synonym : Igk-V22; IGKV7-33; vk22/Jk5 note : cDNA sequence U29423

name	ENSMUSG00000053690 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434039 IMGT/GENE-DB:IGKV6-32 MGI:3641634
definition	gene_synonym : 19-32; Igk-v19-32; Igkv6-32; Igkv6-b note : predicted gene, ENSMUSG00000053690

name	Igkv8-31 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546905 IMGT/GENE-DB:IGKV8-31
definition	note : immunoglobulin kappa chain variable 8-31 pseudo : _no_value

name	Igkv8-30 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384419 IMGT/GENE-DB:IGKV8-30
definition	note : immunoglobulin light chain variable region

name	LOC545852 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545852
definition	note : S-adenosylmethionine decarboxylase 1 pseudogene pseudo : _no_value

name	Igkv6-29 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620191 IMGT/GENE-DB:IGKV6-29
definition	gene_synonym : 19-29 note : immunoglobulin kappa chain variable 6-29

name	Igkv8-28 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434040 IMGT/GENE-DB:IGKV8-28
definition	note : immunoglobulin light chain variable region

name	Igkv8-27 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434041 IMGT/GENE-DB:IGKV8-27
definition	note : immunoglobulin kappa chain variable 8-27

name	Igkv8-26 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620240 IMGT/GENE-DB:IGKV8-26
definition	note : immunoglobulin kappa chain variable 8-26

name	LOC667812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667812
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igkv6-25 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381784 IMGT/GENE-DB:IGKV6-25
definition	gene_synonym : 19-25 note : immunoglobulin kappa chain variable 6-25

name	Igkv8-24 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677858 IMGT/GENE-DB:IGKV8-24
definition	note : immunoglobulin kappa chain variable 8-24

name	Igkv8-23-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434685
definition	note : immunoglobulin kappa variable 8-23-1

name	Igkv6-23 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637227 IMGT/GENE-DB:IGKV6-23
definition	gene_synonym : 19-23; IgK note : immunoglobulin kappa chain variable 6-23

name	LOC667829 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667829
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igkv8-22 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620387 IMGT/GENE-DB:IGKV8-22
definition	note : immunoglobulin kappa chain variable 8-22 pseudo : _no_value

name	Igk-V8-21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620400 IMGT/GENE-DB:IGKV8-21 MGI:1330840
definition	gene_synonym : IGKV8-21 note : immunoglobulin kappa chain variable 8 (V8)-21

name	EG667840 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667840 MGI:3647577
definition	note : predicted gene, EG667840; S-adenosylmethionine decarboxylase 1 pseudogene pseudo : _no_value

name	Igk-V19-20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108024 IMGT/GENE-DB:IGKV6-20 MGI:1330836
definition	gene_synonym : IGKV6-20 note : immunoglobulin kappa chain variable 19 (V19)-20

name	Igk-V8-19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232065 IMGT/GENE-DB:IGKV8-19 MGI:1330844
definition	gene_synonym : IGKV8-19 note : immunoglobulin kappa chain variable 8 (V8)-19

name	Igk-V8-18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667859 IMGT/GENE-DB:IGKV8-18 MGI:1330845
definition	gene_synonym : IGKV8-18 note : immunoglobulin kappa chain variable 8 (V8)-18

name	LOC667863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667863
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igk-V19-17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667865 IMGT/GENE-DB:IGKV6-17 MGI:1330833
definition	gene_synonym : IGKV6-17 note : immunoglobulin kappa chain variable 19 (V19)-17

name	Igk-V8-16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640340 IMGT/GENE-DB:IGKV8-16 MGI:1330843
definition	gene_synonym : IGKV8-16 note : immunoglobulin kappa chain variable 8 (V8)-16

name	Igk-V19-15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108022 IMGT/GENE-DB:IGKV6-15 MGI:1330831
definition	gene_synonym : IGKV6-15 note : immunoglobulin kappa chain variable 19 (V19)-15

name	LOC667872 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667872
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	LOC620497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620497
definition	note : solute carrier family 5 (sodium-dependent vitamin transporter), member 6 pseudogene pseudo : _no_value

name	Igk-V19-14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667881 IMGT/GENE-DB:IGKV6-14 MGI:1330830
definition	gene_synonym : IGKV6-14 note : immunoglobulin kappa chain variable 19 (V19)-14

name	LOC667889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667889
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igk-V19-13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667899 IMGT/GENE-DB:IGKV6-13 MGI:1330829
definition	gene_synonym : IGKV6-13 note : immunoglobulin kappa chain variable 19 (V19)-13

name	LOC667902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667902
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igkv3-12-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667908 IMGT/GENE-DB:IGKV3-12-1
definition	note : immunoglobulin kappa chain variable 3-12-1 pseudo : _no_value

name	Igk-V21-12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667914 IMGT/GENE-DB:IGKV3-12 MGI:1330815
definition	gene_synonym : IgK21-12; IGKV3-12 note : immunoglobulin kappa chain variable 21 (V21)-12

name	Igk-V21-11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667917 IMGT/GENE-DB:IGKV3-11 MGI:1330820
definition	gene_synonym : IGKV3-11 note : immunoglobulin kappa chain variable 21 (V21)-11 pseudo : _no_value

name	Igk-V21-10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667924 IMGT/GENE-DB:IGKV3-10 MGI:1330821
definition	gene_synonym : IgK21-10; IGKV3-10 note : immunoglobulin kappa chain variable 21 (V21)-10

name	Igk-V21-9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667928 IMGT/GENE-DB:IGKV3-9 MGI:1330856
definition	gene_synonym : IGKV3-9 note : immunoglobulin kappa chain variable 21 (V21)-9

name	Igk-V21-8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108010 IMGT/GENE-DB:IGKV3-8 MGI:1330857
definition	gene_synonym : IGKV3-8 note : immunoglobulin kappa chain variable 21 (V21)-8 pseudo : _no_value

name	Igk-V21-7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108005 IMGT/GENE-DB:IGKV3-7 MGI:1330852
definition	gene_synonym : IgK21-7; IGKV3-7 note : immunoglobulin kappa chain variable 21 (V21)-7

name	Igk-V21-6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667936 IMGT/GENE-DB:IGKV3-6 MGI:1330853
definition	gene_synonym : IGKV3-6 note : immunoglobulin kappa chain variable 21 (V21)-6 pseudo : _no_value

name	Igk-V21-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667940 IMGT/GENE-DB:IGKV3-5 MGI:1330854
definition	gene_synonym : IgK21-5; IGKV3-5 note : immunoglobulin kappa chain variable 21 (V21)-5

name	Igkv2-95-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692163 IMGT/GENE-DB:IGKV2-95-1
definition	codon_start : 1 gene_synonym : hb24 pseudo : _no_value

name	EG434031 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434031 IMGT/GENE-DB:IGKV10-95 MGI:3644598
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv10-95; Vk10c

name	EG667550 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667550 IMGT/GENE-DB:IGKV10-94 MGI:3646140
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : AJ2; Igkv10-94

name	Igkv2-93-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692162 IMGT/GENE-DB:IGKV2-93-1
definition	codon_start : 1 gene_synonym : hh24 pseudo : _no_value

name	Igkv19-93 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692161 IMGT/GENE-DB:IGKV19-93
definition	codon_start : 1 exception : rearrangement required for product

name	Gm1408 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:384410 IMGT/GENE-DB:IGKV4-92 MGI:2686254
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkay4; IGKV4-92

name	ENSMUSG00000056850 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434033 IMGT/GENE-DB:IGKV4-91 MGI:3642277
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv4-91; kf4

name	Igkv4-90 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434034 IMGT/GENE-DB:IGKV4-90
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : an4

name	Igkv13-89-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692155 IMGT/GENE-DB:IGKV13-89-1
definition	codon_start : 1 gene_synonym : gf33 pseudo : _no_value

name	Igkv12-89 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:384411 IMGT/GENE-DB:IGKV12-89
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : fl12

name	Igkv1-88 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692154 IMGT/GENE-DB:IGKV1-88
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv13-87 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692153 IMGT/GENE-DB:IGKV13-87
definition	codon_start : 1 pseudo : _no_value

name	Gm459 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243451 IMGT/GENE-DB:IGKV4-86 MGI:2685305
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-86; kb4

name	Igkv13-85 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434036 IMGT/GENE-DB:IGKV13-85
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : gn33

name	Igkv13-84 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692152 IMGT/GENE-DB:IGKV13-84
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : gm33

name	Igkv4-83 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692145 IMGT/GENE-DB:IGKV4-83
definition	codon_start : 1 gene_synonym : kg4 pseudo : _no_value

name	Igkv13-82 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692144 IMGT/GENE-DB:IGKV13-82
definition	codon_start : 1 pseudo : _no_value

name	Gm460 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243453 IMGT/GENE-DB:IGKV4-81 MGI:2685306
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-81; IgVkag4

name	Igkv13-80-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692143 IMGT/GENE-DB:IGKV13-80-1
definition	codon_start : 1 pseudo : _no_value

name	Igkv4-80 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:545848 IMGT/GENE-DB:IGKV4-80
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : af4

name	Gm194 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:213684 IMGT/GENE-DB:IGKV4-79 MGI:2685040
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-79; IgVkae4

name	EG628498 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628498 IMGT/GENE-DB:IGKV13-78-1 MGI:3647961
definition	codon_start : 1 gene_synonym : gb33r; Igkv13-78-1 pseudo : _no_value

name	Igkv4-78 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:545849 IMGT/GENE-DB:IGKV4-78
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : ad4

name	EG667621 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667621 IMGT/GENE-DB:IGKV4-77 MGI:3647937
definition	codon_start : 1 gene_synonym : aj4; Igkv4-77 pseudo : _no_value

name	Igkv13-76 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692142 IMGT/GENE-DB:IGKV13-76
definition	codon_start : 1 pseudo : _no_value

name	Igkv4-75 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692141 IMGT/GENE-DB:IGKV4-75
definition	codon_start : 1 pseudo : _no_value

name	Igkv13-74-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692140 IMGT/GENE-DB:IGKV13-74-1
definition	codon_start : 1 pseudo : _no_value

name	LOC236047 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:236047 IMGT/GENE-DB:IGKV4-74
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Gm192; IGKV4-74; IgVkai4

name	Igkv13-73-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692139 IMGT/GENE-DB:IGKV13-73-1
definition	codon_start : 1 pseudo : _no_value

name	EG628516 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628516 IMGT/GENE-DB:IGKV4-73 MGI:3645825
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : ah4; Igkv4-73

name	Gm1499 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:385109 IMGT/GENE-DB:IGKV4-72 MGI:2686345
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : am4; IGKV4-72

name	Igkv13-71-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692138 IMGT/GENE-DB:IGKV13-71-1
definition	codon_start : 1 gene_synonym : gd33r pseudo : _no_value

name	Igkv4-71 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434586 IMGT/GENE-DB:IGKV4-71
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : al4

name	Gm1502 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:385120 IMGT/GENE-DB:IGKV4-70 MGI:2686348
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-70; kn4

name	EG628541 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628541 IMGT/GENE-DB:IGKV4-69 MGI:3648668
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv4-69; km4

name	Gm1419 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:384515 IMGT/GENE-DB:IGKV4-68 MGI:2686265
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : aa4; Gm151; Gm636; IGKV4-68; IgVk

name	Igkv12-67 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628551 IMGT/GENE-DB:IGKV12-67
definition	codon_start : 1 gene_synonym : fg12 pseudo : _no_value

name	Igkv12-66 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692133 IMGT/GENE-DB:IGKV12-66
definition	codon_start : 1 gene_synonym : fr12 pseudo : _no_value

name	Igkv4-65 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:667670 IMGT/GENE-DB:IGKV4-65
definition	codon_start : 1 gene_synonym : ki4 pseudo : _no_value

name	Igkv13-64 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628564 IMGT/GENE-DB:IGKV13-64
definition	codon_start : 1 gene_synonym : gu33 pseudo : _no_value

name	EG628571 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628571 IMGT/GENE-DB:IGKV4-63 MGI:3645235
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : ac4; Igkv4-63

name	Igkv13-62-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692119 IMGT/GENE-DB:IGKV13-62-1
definition	codon_start : 1 gene_synonym : gc33r pseudo : _no_value

name	EG636752 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:636752 IMGT/GENE-DB:IGKV4-62 MGI:3643587
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : ab4; Igkv4-62

name	Igkv13-61-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692118 IMGT/GENE-DB:IGKV13-61-1
definition	codon_start : 1 gene_synonym : gh33r pseudo : _no_value

name	Igkv4-61 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:546244 IMGT/GENE-DB:IGKV4-61
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : aq4

name	EG667683 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667683 IMGT/GENE-DB:IGKV4-59 MGI:3646808
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv4-59; kk4

name	Igkv4-60 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:385277 IMGT/GENE-DB:IGKV4-60
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Gm1529; kl4

name	Gm1077 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:381831 IMGT/GENE-DB:IGKV4-58 MGI:2685923
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-58; kj4

name	Igkv13-57-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:724106 IMGT/GENE-DB:IGKV13-57-2
definition	codon_start : 1 pseudo : _no_value

name	Gm1418 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:384514 IMGT/GENE-DB:IGKV4-57-1 MGI:2686264
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-57-1

name	Igkv13-57-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692114 IMGT/GENE-DB:IGKV13-57-1
definition	codon_start : 1 gene_synonym : gz33r pseudo : _no_value

name	Gm189 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:235952 IMGT/GENE-DB:IGKV4-57 MGI:2685035
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-57

name	Igkv13-56-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692113 IMGT/GENE-DB:IGKV13-56-1
definition	codon_start : 1 gene_synonym : gg33r pseudo : _no_value

name	Igkv4-56 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619743 IMGT/GENE-DB:IGKV4-56
definition	codon_start : 1 gene_synonym : ao4 pseudo : _no_value

name	Igkv13-55-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692112 IMGT/GENE-DB:IGKV13-55-1
definition	codon_start : 1 gene_synonym : gx33r pseudo : _no_value

name	Gm1524 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:385253 IMGT/GENE-DB:IGKV4-55 MGI:2686370
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : at4; IGKV4-55

name	Igkv13-54-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692105 IMGT/GENE-DB:IGKV13-54-1
definition	codon_start : 1 gene_synonym : gy33r pseudo : _no_value

name	Igkv4-54 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:385291 IMGT/GENE-DB:IGKV4-54
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : ar4; Gm1530; ko4

name	Gm1420 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:546213 IMGT/GENE-DB:IGKV4-53 MGI:2686266
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Gm1526; IGKV4-53; IgVkkh4; kh4

name	Igkv4-51 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619806 IMGT/GENE-DB:IGKV4-51
definition	codon_start : 1 exception : rearrangement required for product

name	Gm1069 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:381782 IMGT/GENE-DB:IGKV4-50 MGI:2685915
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-50; IgVk4-50

name	Igkv12-49 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619824 IMGT/GENE-DB:IGKV12-49
definition	codon_start : 1 pseudo : _no_value

name	Igkv5-48 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619846 IMGT/GENE-DB:IGKV5-48
definition	codon_start : 1 exception : rearrangement required for product

name	ENSMUSG00000029975 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434037 IMGT/GENE-DB:IGKV12-47 MGI:3642817
definition	codon_start : 1 gene_synonym : Igkv12-47 pseudo : _no_value

name	Igkv12-46 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692245 IMGT/GENE-DB:IGKV12-46
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv5-45 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:545850 IMGT/GENE-DB:IGKV5-45
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 23-45

name	Igkv12-44 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:545851 IMGT/GENE-DB:IGKV12-44
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv5-43 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:381783 IMGT/GENE-DB:IGKV5-43
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv12-42 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:677861 IMGT/GENE-DB:IGKV12-42
definition	codon_start : 1 pseudo : _no_value

name	Igkv12-41 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619960 IMGT/GENE-DB:IGKV12-41
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv5-40-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619974 IMGT/GENE-DB:IGKV5-40-1
definition	codon_start : 1 gene_synonym : fp23r pseudo : _no_value

name	Igkv12-40 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:435904 IMGT/GENE-DB:IGKV12-40
definition	codon_start : 1 pseudo : _no_value

name	Gm1409 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:620017 IMGT/GENE-DB:IGKV5-39 MGI:2686255
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 23-39; IGKV5-39

name	Igkv12-38 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620050 IMGT/GENE-DB:IGKV12-38
definition	codon_start : 1 exception : rearrangement required for product

name	Gm1410 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:384417 IMGT/GENE-DB:IGKV5-37 MGI:2686256
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 23-37; IGKV5-37

name	Igkv18-36 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620088 IMGT/GENE-DB:IGKV18-36
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : dv-36

name	Igkv1-35 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620105 IMGT/GENE-DB:IGKV1-35
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : cu2

name	Igkv8-34 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620126 IMGT/GENE-DB:IGKV8-34
definition	codon_start : 1 exception : rearrangement required for product

name	U29423 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243461 IMGT/GENE-DB:IGKV7-33 MGI:3577282
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igk-V22; IGKV7-33; vk22/Jk5

name	ENSMUSG00000053690 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434039 IMGT/GENE-DB:IGKV6-32 MGI:3641634
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 19-32; Igk-v19-32; Igkv6-32; Igkv6-b

name	Igkv8-31 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:546905 IMGT/GENE-DB:IGKV8-31
definition	codon_start : 1 pseudo : _no_value

name	Igkv8-30 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:384419 IMGT/GENE-DB:IGKV8-30
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv6-29 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620191 IMGT/GENE-DB:IGKV6-29
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 19-29

name	Igkv8-28 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434040 IMGT/GENE-DB:IGKV8-28
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv8-27 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434041 IMGT/GENE-DB:IGKV8-27
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv8-26 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620240 IMGT/GENE-DB:IGKV8-26
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv6-25 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:381784 IMGT/GENE-DB:IGKV6-25
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 19-25

name	Igkv8-24 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:677858 IMGT/GENE-DB:IGKV8-24
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv8-23-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434685
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv6-23 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:637227 IMGT/GENE-DB:IGKV6-23
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 19-23; IgK

name	Igkv8-22 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620387 IMGT/GENE-DB:IGKV8-22
definition	codon_start : 1 pseudo : _no_value

name	Igk-V8-21 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:620400 IMGT/GENE-DB:IGKV8-21 MGI:1330840
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-21

name	Igk-V19-20 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108024 IMGT/GENE-DB:IGKV6-20 MGI:1330836
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-20

name	Igk-V8-19 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:232065 IMGT/GENE-DB:IGKV8-19 MGI:1330844
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-19

name	Igk-V8-18 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667859 IMGT/GENE-DB:IGKV8-18 MGI:1330845
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-18

name	Igk-V19-17 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667865 IMGT/GENE-DB:IGKV6-17 MGI:1330833
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-17

name	Igk-V8-16 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:640340 IMGT/GENE-DB:IGKV8-16 MGI:1330843
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-16

name	Igk-V19-15 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108022 IMGT/GENE-DB:IGKV6-15 MGI:1330831
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-15

name	Igk-V19-14 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667881 IMGT/GENE-DB:IGKV6-14 MGI:1330830
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-14

name	Igk-V19-13 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667899 IMGT/GENE-DB:IGKV6-13 MGI:1330829
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-13

name	Igkv3-12-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:667908 IMGT/GENE-DB:IGKV3-12-1
definition	codon_start : 1 pseudo : _no_value

name	Igk-V21-12 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667914 IMGT/GENE-DB:IGKV3-12 MGI:1330815
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-12; IGKV3-12

name	Igk-V21-11 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667917 IMGT/GENE-DB:IGKV3-11 MGI:1330820
definition	codon_start : 1 gene_synonym : IGKV3-11 pseudo : _no_value

name	Igk-V21-10 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667924 IMGT/GENE-DB:IGKV3-10 MGI:1330821
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-10; IGKV3-10

name	Igk-V21-9 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667928 IMGT/GENE-DB:IGKV3-9 MGI:1330856
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV3-9

name	Igk-V21-8 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108010 IMGT/GENE-DB:IGKV3-8 MGI:1330857
definition	codon_start : 1 gene_synonym : IGKV3-8 pseudo : _no_value

name	Igk-V21-7 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108005 IMGT/GENE-DB:IGKV3-7 MGI:1330852
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-7; IGKV3-7

name	Igk-V21-6 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667936 IMGT/GENE-DB:IGKV3-6 MGI:1330853
definition	codon_start : 1 gene_synonym : IGKV3-6 pseudo : _no_value

name	Igk-V21-5 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667940 IMGT/GENE-DB:IGKV3-5 MGI:1330854
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-5; IGKV3-5

name	Igkv2-95-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692163
definition	gene_synonym : hb24 pseudo : _no_value standard_name : IGKV2-95-1

name	EG434031 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434031
definition	gene_synonym : Igkv10-95; Vk10c standard_name : IGKV10-95

name	EG667550 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667550
definition	gene_synonym : AJ2; Igkv10-94 standard_name : IGKV10-94

name	Igkv2-93-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692162
definition	gene_synonym : hh24 pseudo : _no_value standard_name : IGKV2-93-1

name	Igkv19-93 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692161
definition	standard_name : IGKV19-93

name	Gm1408 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384410
definition	gene_synonym : Igkay4; IGKV4-92 standard_name : IGKV4-92

name	ENSMUSG00000056850 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434033
definition	gene_synonym : Igkv4-91; kf4 standard_name : IGKV4-91

name	Igkv4-90 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434034
definition	gene_synonym : an4 standard_name : IGKV4-90

name	Igkv13-89-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692155
definition	gene_synonym : gf33 pseudo : _no_value standard_name : IGKV13-89-1

name	Igkv12-89 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384411
definition	gene_synonym : fl12 standard_name : IGKV12-89

name	Igkv1-88 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692154
definition	standard_name : IGKV1-88

name	Igkv13-87 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692153
definition	pseudo : _no_value standard_name : IGKV13-87

name	Gm459 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243451
definition	allele : IGKV4-86 gene_synonym : IGKV4-86; kb4

name	Igkv13-85 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434036
definition	gene_synonym : gn33 standard_name : IGKV13-85

name	Igkv13-84 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692152
definition	gene_synonym : gm33 standard_name : IGKV13-84

name	Igkv4-83 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692145
definition	gene_synonym : kg4 pseudo : _no_value standard_name : IGKV4-83

name	Igkv13-82 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692144
definition	pseudo : _no_value standard_name : IGKV13-82

name	Gm460 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243453
definition	gene_synonym : IGKV4-81; IgVkag4 standard_name : IGKV4-81

name	Igkv13-80-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692143
definition	pseudo : _no_value standard_name : IGKV13-80-1

name	Igkv4-80 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:545848
definition	gene_synonym : af4 standard_name : IGKV4-80

name	Gm194 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:213684
definition	gene_synonym : IGKV4-79; IgVkae4 standard_name : IGKV4-79

name	EG628498 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628498
definition	gene_synonym : gb33r; Igkv13-78-1 pseudo : _no_value standard_name : IGKV13-78-1

name	Igkv4-78 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:545849
definition	gene_synonym : ad4 standard_name : IGKV4-78

name	EG667621 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667621
definition	gene_synonym : aj4; Igkv4-77 pseudo : _no_value standard_name : IGKV4-77

name	Igkv13-76 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692142
definition	pseudo : _no_value standard_name : IGKV13-76

name	Igkv4-75 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692141
definition	pseudo : _no_value standard_name : IGKV4-75

name	Igkv13-74-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692140
definition	pseudo : _no_value standard_name : IGKV13-74-1

name	LOC236047 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:236047
definition	gene_synonym : Gm192; IGKV4-74; IgVkai4 standard_name : IGKV4-74

name	Igkv13-73-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692139
definition	pseudo : _no_value standard_name : IGKV13-73-1

name	EG628516 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628516
definition	gene_synonym : ah4; Igkv4-73 standard_name : IGKV4-73

name	Gm1499 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:385109
definition	gene_synonym : am4; IGKV4-72 standard_name : IGKV4-72

name	Igkv4-71 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434586
definition	gene_synonym : al4 standard_name : IGKV4-71

name	Gm1502 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:385120
definition	gene_synonym : IGKV4-70; kn4 standard_name : IGKV4-70

name	EG628541 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628541
definition	gene_synonym : Igkv4-69; km4 standard_name : IGKV4-69

name	Gm1419 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384515
definition	gene_synonym : aa4; Gm151; Gm636; IGKV4-68; IgVk standard_name : IGKV4-68

name	Igkv12-67 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628551
definition	gene_synonym : fg12 pseudo : _no_value standard_name : IGKV12-67

name	Igkv12-66 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692133
definition	gene_synonym : fr12 pseudo : _no_value standard_name : IGKV12-66

name	Igkv4-65 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667670
definition	gene_synonym : ki4 pseudo : _no_value standard_name : IGKV4-65

name	Igkv13-64 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628564
definition	gene_synonym : gu33 pseudo : _no_value standard_name : IGKV13-64

name	EG628571 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628571
definition	gene_synonym : ac4; Igkv4-63 standard_name : IGKV4-63

name	Igkv13-62-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692119
definition	gene_synonym : gc33r pseudo : _no_value standard_name : IGKV13-62-1

name	EG636752 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:636752
definition	gene_synonym : ab4; Igkv4-62 standard_name : IGKV4-62

name	Igkv13-61-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692118
definition	gene_synonym : gh33r pseudo : _no_value standard_name : IGKV13-61-1

name	Igkv4-61 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:546244
definition	gene_synonym : aq4 standard_name : IGKV4-61

name	EG667683 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667683
definition	gene_synonym : Igkv4-59; kk4 standard_name : IGKV4-59

name	Igkv4-60 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:385277
definition	gene_synonym : Gm1529; kl4 standard_name : IGKV4-60

name	Gm1077 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381831
definition	gene_synonym : IGKV4-58; kj4 standard_name : IGKV4-58

name	Igkv13-57-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:724106
definition	pseudo : _no_value standard_name : IGKV13-57-2

name	Gm1418 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384514
definition	gene_synonym : IGKV4-57-1 standard_name : IGKV4-57-1

name	Igkv13-57-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692114
definition	gene_synonym : gz33r pseudo : _no_value standard_name : IGKV13-57-1

name	Gm189 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:235952
definition	gene_synonym : IGKV4-57 standard_name : IGKV4-57

name	Igkv13-56-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692113
definition	gene_synonym : gg33r pseudo : _no_value standard_name : IGKV13-56-1

name	Igkv4-56 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619743
definition	gene_synonym : ao4 pseudo : _no_value standard_name : IGKV4-56

name	Igkv13-55-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692112
definition	gene_synonym : gx33r pseudo : _no_value standard_name : IGKV13-55-1

name	Gm1524 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:385253
definition	gene_synonym : at4; IGKV4-55 standard_name : IGKV4-55

name	Igkv13-54-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692105
definition	gene_synonym : gy33r pseudo : _no_value standard_name : IGKV13-54-1

name	Igkv4-54 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:385291
definition	gene_synonym : ar4; Gm1530; ko4 standard_name : IGKV4-54

name	Gm1420 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:546213
definition	gene_synonym : Gm1526; IGKV4-53; IgVkkh4; kh4 standard_name : IGKV4-53

name	Igkv4-51 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619806
definition	standard_name : IGKV4-51

name	Gm1069 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381782
definition	gene_synonym : IGKV4-50; IgVk4-50 standard_name : IGKV4-50

name	Igkv12-49 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619824
definition	pseudo : _no_value standard_name : IGKV12-49

name	Igkv5-48 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619846
definition	standard_name : IGKV5-48

name	ENSMUSG00000029975 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434037
definition	gene_synonym : Igkv12-47 pseudo : _no_value standard_name : IGKV12-47

name	Igkv12-46 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692245
definition	standard_name : IGKV12-46

name	Igkv5-45 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:545850
definition	gene_synonym : 23-45 standard_name : IGKV5-45

name	Igkv12-44 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:545851
definition	standard_name : IGKV12-44

name	Igkv5-43 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381783
definition	standard_name : IGKV5-43

name	Igkv12-42 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:677861
definition	pseudo : _no_value standard_name : IGKV12-42

name	Igkv12-41 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619960
definition	standard_name : IGKV12-41

name	Igkv5-40-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619974
definition	gene_synonym : fp23r pseudo : _no_value standard_name : IGKV5-40-1

name	Igkv12-40 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435904
definition	pseudo : _no_value standard_name : IGKV12-40

name	Gm1409 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620017
definition	gene_synonym : 23-39; IGKV5-39 standard_name : IGKV5-39

name	Igkv12-38 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620050
definition	standard_name : IGKV12-38

name	Gm1410 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384417
definition	gene_synonym : 23-37; IGKV5-37 standard_name : IGKV5-37

name	Igkv18-36 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620088
definition	gene_synonym : dv-36 standard_name : IGKV18-36

name	Igkv1-35 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620105
definition	gene_synonym : cu2 standard_name : IGKV1-35

name	Igkv8-34 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620126
definition	standard_name : IGKV8-34

name	U29423 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243461
definition	gene_synonym : Igk-V22; IGKV7-33; vk22/Jk5 standard_name : IGKV7-33

name	ENSMUSG00000053690 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434039
definition	gene_synonym : 19-32; Igk-v19-32; Igkv6-32; Igkv6-b standard_name : IGKV6-32

name	Igkv8-31 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:546905
definition	pseudo : _no_value standard_name : IGKV8-31

name	Igkv8-30 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384419
definition	standard_name : IGKV8-30

name	Igkv6-29 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620191
definition	gene_synonym : 19-29 standard_name : IGKV6-29

name	Igkv8-28 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434040
definition	standard_name : IGKV8-28

name	Igkv8-27 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434041
definition	standard_name : IGKV8-27

name	Igkv8-26 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620240
definition	standard_name : IGKV8-26

name	Igkv6-25 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381784
definition	gene_synonym : 19-25 standard_name : IGKV6-25

name	Igkv8-24 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:677858
definition	standard_name : IGKV8-24

name	Igkv8-23-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434685
definition	standard_name : IGKV8-23-1

name	Igkv6-23 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:637227
definition	gene_synonym : 19-23; IgK standard_name : IGKV6-23

name	Igkv8-22 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620387
definition	pseudo : _no_value standard_name : IGKV8-22

name	Igk-V8-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620400
definition	gene_synonym : IGKV8-21 standard_name : IGKV8-21

name	Igk-V19-20 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108024
definition	gene_synonym : IGKV6-20 standard_name : IGKV6-20

name	Igk-V8-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:232065
definition	gene_synonym : IGKV8-19 standard_name : IGKV8-19

name	Igk-V8-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667859
definition	gene_synonym : IGKV8-18 standard_name : IGKV8-18

name	Igk-V19-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667865
definition	gene_synonym : IGKV6-17 standard_name : IGKV6-17

name	Igk-V8-16 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640340
definition	gene_synonym : IGKV8-16 standard_name : IGKV8-16

name	Igk-V19-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108022
definition	gene_synonym : IGKV6-15 standard_name : IGKV6-15

name	Igk-V19-14 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667881
definition	gene_synonym : IGKV6-14 standard_name : IGKV6-14

name	Igk-V19-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667899
definition	gene_synonym : IGKV6-13 standard_name : IGKV6-13

name	Igkv3-12-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667908
definition	pseudo : _no_value standard_name : IGKV3-12-1

name	Igk-V21-12 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667914
definition	gene_synonym : IgK21-12; IGKV3-12 standard_name : IGKV3-12

name	Igk-V21-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667917
definition	gene_synonym : IGKV3-11 pseudo : _no_value standard_name : IGKV3-11

name	Igk-V21-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667924
definition	gene_synonym : IgK21-10; IGKV3-10 standard_name : IGKV3-10

name	Igk-V21-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667928
definition	gene_synonym : IGKV3-9 standard_name : IGKV3-9

name	Igk-V21-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108010
definition	gene_synonym : IGKV3-8 pseudo : _no_value standard_name : IGKV3-8

name	Igk-V21-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108005
definition	gene_synonym : IgK21-7; IGKV3-7 standard_name : IGKV3-7

name	Igk-V21-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667936
definition	gene_synonym : IGKV3-6 pseudo : _no_value standard_name : IGKV3-6

name	Igk-V21-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667940
definition	gene_synonym : IgK21-5; IGKV3-5 standard_name : IGKV3-5

name	Igkv13-71-1 (CDS detail)
type	V_region
link	vega ensembl
xref	GeneID:692138
definition	gene_synonym : gd33r pseudo : _no_value standard_name : IGKV13-71-1

name	(CDS detail)
type	STS
link
xref	UniSTS:487865
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143523
definition	standard_name : Igk-V34

name	(CDS detail)
type	STS
link
xref	UniSTS:143504
definition	standard_name : Igk

name	(CDS detail)
type	STS
link
xref	UniSTS:143512
definition	standard_name : Igk-V12/13

name	(CDS detail)
type	STS
link
xref	UniSTS:17430
definition	standard_name : Z72369

name	(CDS detail)
type	STS
link
xref	UniSTS:143518
definition	standard_name : Igk-V23

name	(CDS detail)
type	STS
link
xref	UniSTS:16257
definition	standard_name : Z72370

name	(CDS detail)
type	STS
link
xref	UniSTS:143520
definition	standard_name : Igk-V28

name	(CDS detail)
type	STS
link
xref	UniSTS:130999
definition	standard_name : D6Mit96

name	(CDS detail)
type	STS
link
xref	UniSTS:42890
definition	standard_name : Z72372

name	(CDS detail)
type	STS
link
xref	UniSTS:42890
definition	standard_name : Z72372

name	(CDS detail)
type	STS
link
xref	UniSTS:143513
definition	standard_name : Igk-V19

name	(CDS detail)
type	STS
link
xref	UniSTS:11298
definition	standard_name : Z72373

clone name	MSMg01-421F12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261H20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-099H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-341N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-114I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-474F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-119A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-212M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135O23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166D07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-067K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-116O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-084B19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537M18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088K22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-143P11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424N12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-213H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139O07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084F09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-277I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058A12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-210A16.b	B6Ng01-210A16.g
ACC	GA028488	GA028489
length	910	1,117
definition	B6Ng01-210A16.b	B6Ng01-210A16.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaagacccagaaatgaacccacacacctatggtcacttgatcttc gacaagggagctaaaaccatccagtggaagaaagacagcattttcaacaa ttggtgctggcacaactggttgttaccatgtagaagaatgtgaatcgatc cctactcatctccttgtactaaggtcaaatctaaatggatcaaagaactt cacataaaaccagagacactgaaacttatagaggagaaagtggggaaaag ccttgaagatatgggcacaggggaaaaattcctgaacagaacagcaatgg cttgtgctgtaagatcgagaattgacaaatgggacctaatgaaactctaa agtttctgcaaggcaaaagacaccgtcaataagacaaagagaccaccaac agattgggaaaggatctttacctatcctaaatcagatactggactaatat ccaacatatataaagaactcaagaaggtggacttcagaaaatcaaataac cccattaaaaaatggggctcagaactgaacaaagaattctcacctgagga ataccgaatggcagagaagcacctgaaaatatgttcaacatccttaatca tcagggaaatgcaaatcaaaacaaccctaagattccacctcacaccactc agaatggctaagataaaaaattcaggtgtcagcagatgctggcgaggatg tggagaaacactcctccattgttggtgggattgcaggcttgtacaaccac tctggaaatccgactggcggttcctcagaaaattggacatagtactaccg gaggatccagcaataccttctcctgggcatatatccagaagatgccccaa ctggtaagaaggacacatgctccacctatgtttcatagcaaccttattta taatacccag	gaattcctctggacattcatagaaggatataattttctgttatcttttaa gcaccttatatgagagggagactcaagaaatcctttatccctttattcaa tcttctgtgaagtaaataggaacaaagaccaaaaaatgaaataaaaacct tctgttgttttgagaggtctattctactcaaggcagtctgttggccctct ggggaggcaaaagtattaactgtaagaagtatggaatcccaaagggctac tatgcaaaacaccataagttagaactgaaagtatgtcgttactaagaaga caccttctgtttccactcttcttcactgtattattaaatgtgatgaatag cactttctgtagtgtacatgtcaaaatagtttataataggaaatgaatga aactggctgtcatatgactgaagtacagctcaccattaatactcagagtt aattgtaataatgaatcccaggatcattttagtgaacaaatcttagagac acaaggtcacactaatgaggaacacatttaaggaagtttgaagaacaaaa gtcacaaacagaaaacctgagactttattcttcttttgaataaatgtcat agtctcatttgaacacaaatgaacccttgattaagtattgtaagttgcat agtgtagactggagaagatcctatataatacaaaccctgttaaatattat gtttatccaaatagtttttgcatcaaagatcactcagagccagtaacaaa atgatatatgttgtcaatattccaactcataaggcacaccttccaccatg ctttttactttgagctaaatattaaaatgagttttgtttttaaatctgat tttctaattttggctgttttttgtgcataactatttattgaacatattat ataggcagttttgagtattcctttaactaggttttcataatttagggtta aagaaagaaactaagtccattctgaaagttgtgggctgtatttcaaacaa tccattatacttcaactatattcccccctttggcacatgtatatctaata tatttttgcattgattttttggtgacttcctcttatcatatgagctctag tacagagccaggaatgg
quality values	Open. Hide. 62 41 27 25 62 37 29 47 62 47 47 62 47 32 62 47 62 44 32 62 62 62 62 62 62 51 62 62 62 62 62 56 46 46 48 33 33 36 35 56 33 43 43 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 59 62 62 59 59 56 54 62 59 59 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 56 54 54 50 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 59 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 59 44 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 44 44 62 62 62 56 42 62 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 51 51 62 54 54 62 62 62 56 62 62 62 62 56 62 43 37 62 56 62 54 56 43 62 62 62 54 42 62 62 62 62 62 47 62 56 62 62 62 62 62 56 56 39 62 50 62 56 47 56 39 43 56 56 56 62 62 62 43 43 47 42 54 42 62 52 62 62 62 38 62 62 52 62 54 62 62 47 54 46 52 52 52 42 62 62 62 62 43 38 47 43 62 62 62 49 46 42 62 58 34 40 32 52 54 38 42 42 40 46 31 41 42 40 38 40 33 28 47 50 52 47 40 46 42 45 34 52 54 52 42 42 58 52 52 54 39 39 52 46 54 29 54 28 36 47 47 52 52 45 39 52 52 42 26 38 32 46 27 33 33 24 42 42 15 42 19 45 41 52 52 52 52 35 52 40 52 42 19 52 30 50 50 58 31 49 29 24 34 27 27 25 27 33 22 20 30 18 25 20 30 21 35 35 35 32 43 27 23 34 37 22 50 27 18 9 33 14 18 26 35 19 7 23 25 19 16 19 18 37 28 27 29 32 30 37 24 35 42 29 24 14 7 13 23 26 31 7 40 16 19 28 25 22 26 32 19 15 42 30 19 16 24 9 11 6 25 19 17 17 9 13 11 23 21 18 18 14 21 18 22 41 10 37 15 27 8 19 15 21 13 9 12 15 25 33 41 18 11 27 32 31 28 7 6 11 6 19 23 30 18 14 18 24 32 37 28 18 44 29 9 44 10 28 18 30 23 27 17 9 21 28 22 15 25 24 16 21 20 13 19 30 36 23 30 31 16 37 33 37 28 16 27 15 26 14 32 30 26 17 12 13 15 14 17 24 24 21 30 21 18 29 21 33 19 13 14 26 29 9 22 27 13 36 9 6 11 12 6 8	Open. Hide. 62 38 43 47 62 62 62 62 62 62 50 28 15 34 18 26 28 19 24 36 27 36 56 51 43 62 54 46 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 56 51 51 50 45 56 56 62 56 62 62 49 49 54 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 52 54 48 54 52 54 54 54 58 58 58 58 58 54 58 54 54 52 54 52 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 52 58 48 54 52 52 58 58 54 54 54 54 58 54 54 58 54 54 52 58 58 52 44 41 52 52 54 58 42 58 50 49 51 52 51 54 58 53 58 58 58 53 58 58 58 54 48 58 49 47 58 48 58 58 50 49 53 58 58 54 53 54 58 53 54 58 58 58 51 51 51 54 50 51 40 50 53 53 58 54 50 44 41 43 50 49 58 36 39 51 50 58 46 53 45 39 58 58 46 49 58 49 58 58 51 50 50 52 52 53 53 58 40 54 41 51 39 51 58 44 58 32 49 58 40 50 35 37 51 53 53 52 52 53 52 51 52 47 50 27 38 44 42 34 42 50 54 40 25 35 54 51 53 52 53 53 53 52 54 32 54 42 45 45 42 39 23 51 40 49 50 40 31 54 54 49 47 34 37 30 42 42 32 54 54 38 41 38 39 29 45 54 42 37 30 33 14 21 35 27 37 41 53 41 40 30 47 49 34 34 53 39 28 34 34 32 32 51 41 33 53 32 34 42 51 45 40 21 18 33 27 32 31 32 46 32 31 53 53 39 17 46 25 30 40 29 25 19 28 30 30 22 12 19 19 28 29 32 29 31 51 51 51 31 30 30 37 47 46 34 42 22 31 37 31 51 31 34 33 31 31 31 46 46 37 31 43 42 27 37 48 46 36 46 21 46 46 46 31 37 46 30 34 37 31 31 33 20 48 48 31 33 31 34 33 31 46 46 30 36 28 31 34 28 18 46 46 46 46 33 37 32 34 35 33 31 24 21 31 32 34 32 48 38 31 19 26 37 21 27 27 25 35 26 32 32 31 31 29 29 25 33 38 14 13 13 26 48 48 32 31 37 27 30 20 31 33 35 35 32 48 37 25 31 31 34 19 20 20 14 43 24 13 31 23 29 27 31 19 37 15 17 4 13 23 27 23 20 43 33 30 43 11 9 9 4 6 9 14 20 17 29 29 20 21 26 13 32 32 25 19 21 31 47 29 14 25 15 22 22 5 34 9 16 28 15 6 17 21 38 28 27 20 34 15 14 9 15 28 11 10 15 25 20 26 7 21 10 17 21 28 23 27 15 18 18 4 11 17 24 13 16 17 16 6 9 5 28 10 21 21 5 5 4 10 4 13 13 7 11 12 21 10 18 6 8 6 6 11 5 2 22 29 26 12 3 1 5 3 9 8 22 16 28 25 28 28 18 20 20 11 18 18 10 11 19 5 9 21 7 5 18 10 9 10 12 6 7 13 8 11 9 2 4 4 8 6 5 5 6 11 11 4 6 4 7 10 12 15 15 10 8 7 26 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_69612384_69613512
seq2: B6Ng01-210A16.g_66_1182

seq1  GAATTCCTCTGGACATTCATAGAAGGATATAATTTTCTGTTATCTTTTAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTCTGGACATTCATAGAAGGATATAATTTTCTGTTATCTTTTAA  50

seq1  GCACCTTATATGAGAGGGAGACTCAAGAAATCCTTTATCCCTTTATTCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCTTATATGAGAGGGAGACTCAAGAAATCCTTTATCCCTTTATTCAA  100

seq1  TCTTCTGTGAAGTAAATAGGAACAAAGACCAAAAAATGAAATAAAAACCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCTGTGAAGTAAATAGGAACAAAGACCAAAAAATGAAATAAAAACCT  150

seq1  TCTGTTGTTTTGAGAGGTCTATTCTACTCAAGGCAGTCTGTTGGCCCTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTTGTTTTGAGAGGTCTATTCTACTCAAGGCAGTCTGTTGGCCCTCT  200

seq1  GGGGAGGCAAAAGTATTAACTGTAAGAAGTATGGAATCCCAAAGGGCTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAGGCAAAAGTATTAACTGTAAGAAGTATGGAATCCCAAAGGGCTAC  250

seq1  TATGCAAAACACCATAAGTTAGAACTGAAAGTATGTCGTTACTAAGAAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCAAAACACCATAAGTTAGAACTGAAAGTATGTCGTTACTAAGAAGA  300

seq1  CACCTTCTGTTTCCACTCTTCTTCACTGTATTATTAAATGTGATGAATAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTTCTGTTTCCACTCTTCTTCACTGTATTATTAAATGTGATGAATAG  350

seq1  CACTTTCTGTAGTGTACATGTCAAAATAGTTTATAATAGGAAATGAATGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTTCTGTAGTGTACATGTCAAAATAGTTTATAATAGGAAATGAATGA  400

seq1  AACTGGCTGTCATATGACTGAAGTACAGCTCACCATTAATACTCAGAGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGGCTGTCATATGACTGAAGTACAGCTCACCATTAATACTCAGAGTT  450

seq1  AATTGTAATAATGAATCCCAGGATCATTTTAGTGAACAAATCTTAGAGAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGTAATAATGAATCCCAGGATCATTTTAGTGAACAAATCTTAGAGAC  500

seq1  ACAAGGTCACACTAATGAGGAACACATTTAAGGAAGTTTGAAGAACAAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGGTCACACTAATGAGGAACACATTTAAGGAAGTTTGAAGAACAAAA  550

seq1  GTCACAAACAGAAAACCTGAGACTTTATTCTTCTTTTGAATAAATGTCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCACAAACAGAAAACCTGAGACTTTATTCTTCTTTTGAATAAATGTCAT  600

seq1  AGTCTCATTTGAACACAAATGAACCCTTGATTAAGTATTGTAAGTTGCAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTCATTTGAACACAAATGAACCCTTGATTAAGTATTGTAAGTTGCAT  650

seq1  AGTGTAGACTGGAGAAGATCCTATATAATACAAACCCTGTTAAATATTAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTAGACTGGAGAAGATCCTATATAATACAAACCCTGTTAAATATTAT  700

seq1  GTTTATCCAAATAGTTTTTGCATCAAAGATCACTCAGAGCCAGTAACAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTATCCAAATAGTTTTTGCATCAAAGATCACTCAGAGCCAGTAACAAA  750

seq1  ATGATATATGTTGTCAATATTCCAACTCATAAGGCACACCTTCCACCATG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATATATGTTGTCAATATTCCAACTCATAAGGCACACCTTCCACCATG  800

seq1  CTTTTTACTTTGAGCTAAATATTAAAATGAGTTTTGTTTTTAAATCTGAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTACTTTGAGCTAAATATTAAAATGAGTTTTGTTTTTAAATCTGAT  850

seq1  TTTCTAATTTTGGCTGTTTTTTGTGCATAACTATTTATTGAACATATTAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTAATTTTGGCTGTTTTTTGTGCATAACTATTTATTGAACATATTAT  900

seq1  ATAGGCAAGTTTTGAGTATTCCTTTAACTAGG-TTTCATAATTTAAGGTT  949
      |||||| ||||||||||||||||||||||||| |||||||||||| ||||
seq2  ATAGGC-AGTTTTGAGTATTCCTTTAACTAGGTTTTCATAATTTAGGGTT  949

seq1  AAAGAAAAGAAACTAAGTCCATTCTGAAAAGTTGTTGGCTGTATTTCAAA  999
      |||| ||||||||||||||||||||| |||||||| ||||||||||||||
seq2  AAAG-AAAGAAACTAAGTCCATTCTG-AAAGTTGTGGGCTGTATTTCAAA  997

seq1  CAATCCATTATAACTTCAAACTAATATTCCCCCC-TTGGCACAATGTATA  1048
      ||||||||||| ||||| |||| ||||||||||| ||||||| |||||||
seq2  CAATCCATTAT-ACTTC-AACT-ATATTCCCCCCTTTGGCAC-ATGTATA  1043

seq1  TCTTAATATTAATTTTTGGAATTGAATTTTTTGGTGACTTCTTCTTATTC  1098
      || ||||||  |||||| | |||| |||||||||||||||| ||||| ||
seq2  TC-TAATAT--ATTTTT-GCATTG-ATTTTTTGGTGACTTCCTCTTA-TC  1087

seq1  ATATGAGGCTCTAGTACAAGAG-CAGGAATGG  1129
      |||||| |||||||||| |||| |||||||||
seq2  ATATGA-GCTCTAGTAC-AGAGCCAGGAATGG  1117

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information