MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-214G02
Chromosome	6 (Build37)
Map Location	114,218,588 - 114,383,712
singlet/doublet	doublet
Overlap gene	Slc6a1, Hrh1
Upstream gene	Mtmr14, Cpne9, Brpf1, Ogg1, Camk1, Tada3l, Arpc4, Ttll3, Rpusd3, Cidec, Jagn1, Il17re, Il17rc, Creld1, Prrt3, Tmem111, Fancd2, 4931417G12Rik, 6720456B07Rik, Vhlh, Irak2, Tatdn2, Ghrl, Sec13, Atp2b2, Slc6a11, LOC666491
Downstream gene	Atg7, Vgll4, 1500001M20Rik, LOC100043420, Syn2, Timp4, Pparg
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mtmr14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97287 MGI:1916075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpne9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211232 MGI:2443052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brpf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78783 MGI:1926033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18294 MGI:1097693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52163 MGI:1098535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tada3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101206 MGI:1915724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68089 MGI:1915339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101100 MGI:2141418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpusd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101122 MGI:2141440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 35 ESTs, 4 Proteins

name	Cidec (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14311 MGI:95585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jagn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67767 MGI:1915017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il17re (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57890 MGI:1889371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Il17rc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171095 MGI:2159336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creld1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171508 MGI:2152539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prrt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210673 MGI:2444810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66087 MGI:1913337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fancd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211651 MGI:2448480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931417G12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70979 MGI:1918229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6720456B07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101314 MGI:1915406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vhlh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22346 MGI:103223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irak2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108960 MGI:2429603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tatdn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381801 MGI:3576210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ghrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58991 MGI:1930008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110379 MGI:99832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11941 MGI:105368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc6a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243616 MGI:95630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666491 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	Slc6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232333 MGI:95627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hrh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15465 MGI:107619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74244 MGI:1921494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vgll4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232334 MGI:2652840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500001M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68971 MGI:1916221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Syn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20965 MGI:103020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110595 MGI:109125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pparg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19016 MGI:97747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930426 GeneID:97287 MGI:1916075
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 14 transcript_id : NM_026849.1

name	Cpne9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881815 GeneID:211232 MGI:2443052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine family member IX transcript_id : NM_170673.3

name	Brpf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794209 GeneID:78783 MGI:1926033
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain and PHD finger containing, 1 transcript_id : NM_030178.1

name	Ogg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374385 GeneID:18294 MGI:1097693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 8-oxoguanine DNA-glycosylase 1 transcript_id : NM_010957.3

name	Camk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129899 GeneID:52163 MGI:1098535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase I transcript_id : NM_133926.2

name	Tada3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129897 GeneID:101206 MGI:1915724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional adaptor 3 (NGG1 homolog, yeast)-like transcript_id : NM_133932.2

name	Arpc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365377 GeneID:68089 MGI:1915339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 4 transcript_id : NM_026552.2

name	Ttll3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350803 GeneID:101100 MGI:2141418
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 3 transcript_id : NM_133923.4

name	Rpusd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378026 GeneID:101122 MGI:2141440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 35 ESTs, 4 Proteins product : RNA pseudouridylate synthase domain containing 3, transcript variant 1 transcript_id : XM_132830.8

name	Cidec (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802598 GeneID:14311 MGI:95585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell death-inducing DFFA-like effector c transcript_id : NM_178373.3

name	Jagn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350585 GeneID:67767 MGI:1915017
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jagunal homolog 1 (Drosophila) transcript_id : NM_026365.2

name	Il17re (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801849 GeneID:57890 MGI:1889371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor E transcript_id : NM_145826.3

name	Il17re (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404278 GeneID:57890 MGI:1889371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor E transcript_id : NM_001034031.1

name	Il17re (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404280 GeneID:57890 MGI:1889371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor E transcript_id : NM_001034029.1

name	Il17rc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30841017 GeneID:171095 MGI:2159336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor C transcript_id : NM_134159.2

name	Creld1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527147 GeneID:171508 MGI:2152539
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich with EGF-like domains 1 transcript_id : NM_133930.1

name	Prrt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130011 GeneID:210673 MGI:2444810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich transmembrane protein 3 transcript_id : NM_172487.3

name	Tmem111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383973 GeneID:66087 MGI:1913337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 111 transcript_id : NM_175101.3

name	Fancd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802416 GeneID:211651 MGI:2448480
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fanconi anemia, complementation group D2 transcript_id : NM_001033244.2

name	4931417G12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802852 GeneID:70979 MGI:1918229
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931417G12 gene transcript_id : NM_027633.2

name	6720456B07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527153 GeneID:101314 MGI:1915406
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720456B07 gene transcript_id : NM_133937.1

name	Vhlh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130344 GeneID:22346 MGI:103223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : von Hippel-Lindau syndrome homolog transcript_id : NM_009507.3

name	Irak2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802874 GeneID:108960 MGI:2429603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin-1 receptor-associated kinase 2 transcript_id : NM_172161.3

name	Tatdn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345009 GeneID:381801 MGI:3576210
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TatD DNase domain containing 2 transcript_id : NM_001033463.2

name	Ghrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358944 GeneID:58991 MGI:1930008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ghrelin transcript_id : NM_021488.4

name	Sec13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385772 GeneID:110379 MGI:99832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC13 homolog (S. cerevisiae) transcript_id : NM_024206.4

name	Atp2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861455 GeneID:11941 MGI:105368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 2 transcript_id : NM_009723.2

name	Atp2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861453 GeneID:11941 MGI:105368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 2 transcript_id : NM_001036684.1

name	Slc6a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367467 GeneID:243616 MGI:95630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, GABA), member 11 transcript_id : NM_172890.2

name	Slc6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366248 GeneID:232333 MGI:95627
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, GABA), member 1 transcript_id : NM_178703.3

name	Hrh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345432 GeneID:15465 MGI:107619
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine receptor H 1 transcript_id : NM_008285.3

name	Atg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803043 GeneID:74244 MGI:1921494
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 7 (yeast) transcript_id : NM_028835.2

name	Vgll4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343305 GeneID:232334 MGI:2652840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vestigial like 4 (Drosophila) transcript_id : NM_177683.2

name	1500001M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76559943 GeneID:68971 MGI:1916221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500001M20 gene transcript_id : NM_026894.1

name	Syn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567409 GeneID:20965 MGI:103020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synapsin II transcript_id : NM_013681.1

name	Timp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625887 GeneID:110595 MGI:109125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue inhibitor of metalloproteinase 4 transcript_id : NM_080639.3

name	Pparg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367023 GeneID:19016 MGI:97747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor gamma transcript_id : NM_011146.2

name	Mtmr14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930427 CCDS:CCDS20412.1 GeneID:97287 MGI:1916075
definition	codon_start : 1 product : myotubularin related protein 14 protein_id : NP_081125.1

name	Cpne9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28416905 CCDS:CCDS20413.1 GeneID:211232 MGI:2443052
definition	codon_start : 1 product : copine-like protein protein_id : NP_733773.2

name	Brpf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794210 GeneID:78783 MGI:1926033
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : bromodomain containing 1 protein_id : NP_084454.1

name	Ogg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18921208 CCDS:CCDS20414.1 GeneID:18294 MGI:1097693
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IMP]; GO:0005634 - nucleus [Evidence IMP] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0019104 - DNA N-glycosylase activity [Evidence TAS]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0000702 - oxidized base lesion DNA N-glycosylase activity [Evidence TAS]; GO:0008534 - oxidized purine base lesion DNA N-glycosylase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0006284 - base-excision repair [Evidence IMP] [Evidence IDA]; GO:0006281 - DNA repair [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : 8-oxoguanine DNA-glycosylase 1 protein_id : NP_035087.2

name	Camk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527140 CCDS:CCDS20415.1 GeneID:52163 MGI:1098535
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 product : calcium/calmodulin-dependent protein kinase I protein_id : NP_598687.1

name	Tada3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149314 CCDS:CCDS20416.1 GeneID:101206 MGI:1915724
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcriptional adaptor 3-like protein_id : NP_598693.1

name	Arpc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386054 CCDS:CCDS20417.1 GeneID:68089 MGI:1915339
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030041 - actin filament polymerization [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : actin related protein 2/3 complex, subunit 4 (20 kDa) product : actin related protein 2/3 complex, subunit 4 protein_id : NP_080828.1

name	Ttll3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793427 GeneID:101100 MGI:2141418
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : tubulin tyrosine ligase-like family, member 3 protein_id : NP_598684.3

name	Rpusd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63548662 GeneID:101122 MGI:2141440
definition	codon_start : 1 product : RNA pseudouridylate synthase domain containing 3 isoform 1 protein_id : XP_132830.4

name	Cidec (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410022 CCDS:CCDS20418.1 GeneID:14311 MGI:95585
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 note : CIDE-3alpha; fat specific gene 27 product : cell death-inducing DFFA-like effector c protein_id : NP_848460.1

name	Jagn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385862 CCDS:CCDS20419.1 GeneID:67767 MGI:1915017
definition	codon_start : 1 product : jagunal homolog 1 protein_id : NP_080641.1

name	Il17re (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559935 CCDS:CCDS20420.1 GeneID:57890 MGI:1889371
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : interleukin 17 receptor E isoform 1 protein_id : NP_665825.2

name	Il17re (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404281 CCDS:CCDS20421.1 GeneID:57890 MGI:1889371
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : interleukin 17 receptor E isoform 2 protein_id : NP_001029201.1

name	Il17re (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404279 CCDS:CCDS20421.1 GeneID:57890 MGI:1889371
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : interleukin 17 receptor E isoform 3 protein_id : NP_001029203.1

name	Il17rc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841018 CCDS:CCDS20422.1 GeneID:171095 MGI:2159336
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : interleukin 17 receptor-like product : interleukin 17 receptor C protein_id : NP_598920.2

name	Creld1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527148 CCDS:CCDS20423.1 GeneID:171508 MGI:2152539
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cysteine-rich with EGF-like domains 1 protein_id : NP_598691.1

name	Prrt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793406 CCDS:CCDS20424.1 GeneID:210673 MGI:2444810
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : proline-rich transmembrane protein 3 protein_id : NP_766075.2

name	Tmem111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28827824 CCDS:CCDS20425.1 GeneID:66087 MGI:1913337
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66087 protein_id : NP_780310.1

name	Fancd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776592 CCDS:CCDS20426.1 GeneID:211651 MGI:2448480
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Fanconi anemia, complementation group D2 protein_id : NP_001028416.1

name	4931417G12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037227 CCDS:CCDS20427.1 GeneID:70979 MGI:1918229
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70979 protein_id : NP_081909.1

name	6720456B07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527154 GeneID:101314 MGI:1915406
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC101314 protein_id : NP_598698.1

name	Vhlh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678567 CCDS:CCDS20429.1 GeneID:22346 MGI:103223
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0043534 - blood vessel endothelial cell migration [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : von Hippel-Lindau syndrome protein homolog protein_id : NP_033533.1

name	Irak2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543003 CCDS:CCDS20430.1 GeneID:108960 MGI:2429603
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051092 - activation of NF-kappaB transcription factor [Evidence IDA]; GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence IDA]; GO:0031663 - lipopolysaccharide-mediated signaling pathway [Evidence IDA]; GO:0043433 - negative regulation of transcription factor activity [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : interleukin-1 receptor-associated kinase 2c product : interleukin-1 receptor-associated kinase 2 protein_id : NP_751893.2

name	Tatdn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677456 CCDS:CCDS20431.1 GeneID:381801 MGI:3576210
definition	codon_start : 1 exception : mismatches in translation product : TatD DNase domain containing 2 protein_id : NP_001028635.1

name	Ghrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19224664 CCDS:CCDS20432.1 GeneID:58991 MGI:1930008
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0031768 - ghrelin receptor binding [Evidence ISS]; GO:0016608 - growth hormone-releasing hormone activity [Evidence ISS]; GO:0005179 - hormone activity [Evidence TAS] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0030252 - growth hormone secretion [Evidence ISS]; GO:0009755 - hormone-mediated signaling [Evidence ISS]; GO:0040018 - positive regulation of body size [Evidence ISS]; GO:0050791 - regulation of physiological process [Evidence IEA] codon_start : 1 note : motilin-related peptide; proghrelin product : ghrelin protein_id : NP_067463.2

name	Sec13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29150272 GeneID:110379 MGI:99832
definition	GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS] codon_start : 1 note : SEC13 related product : SEC13-like 1 protein_id : NP_077168.2

name	Atp2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753140 CCDS:CCDS20433.1 GeneID:11941 MGI:105368
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005929 - cilium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015085 - calcium ion transporter activity [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP] [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0000902 - cell morphogenesis [Evidence IMP]; GO:0021707 - cerebellar granule cell differentiation [Evidence IMP]; GO:0021702 - cerebellar Purkinje cell differentiation [Evidence IMP]; GO:0046068 - cGMP metabolism [Evidence IMP]; GO:0050910 - detection of mechanical stimulus during sensory perception of sound [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007595 - lactation [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0045299 - otolith mineralization [Evidence IMP]; GO:0050885 - regulation of balance [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] [Evidence IGI]; GO:0042428 - serotonin metabolism [Evidence IMP]; GO:0050808 - synapse organization and biogenesis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; wriggle; deaf waddler product : plasma membrane calcium ATPase 2 isoform 1 protein_id : NP_033853.1

name	Atp2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861454 CCDS:CCDS20433.1 GeneID:11941 MGI:105368
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005929 - cilium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015085 - calcium ion transporter activity [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP] [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0000902 - cell morphogenesis [Evidence IMP]; GO:0021707 - cerebellar granule cell differentiation [Evidence IMP]; GO:0021702 - cerebellar Purkinje cell differentiation [Evidence IMP]; GO:0046068 - cGMP metabolism [Evidence IMP]; GO:0050910 - detection of mechanical stimulus during sensory perception of sound [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007595 - lactation [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0045299 - otolith mineralization [Evidence IMP]; GO:0050885 - regulation of balance [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] [Evidence IGI]; GO:0042428 - serotonin metabolism [Evidence IMP]; GO:0050808 - synapse organization and biogenesis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; wriggle; deaf waddler product : plasma membrane calcium ATPase 2 isoform 2 protein_id : NP_001031761.1

name	Slc6a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370360 GeneID:243616 MGI:95630
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005332 - gamma-aminobutyric acid:sodium symporter activity [Evidence IEA]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : gamma-aminobutyric acid (GABA-A) transporter 4 protein_id : NP_766478.1

name	Slc6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520131 CCDS:CCDS20434.1 GeneID:232333 MGI:95627
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gamma-aminobutyric acid (GABA-A) transporter 1 product : solute carrier family 6 (neurotransmitter transporter, GABA), member 1 protein_id : NP_848818.1

name	Hrh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542963 CCDS:CCDS20435.1 GeneID:15465 MGI:107619
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Bordetella pertussis induced histamine sensitization; Histamine H1 receptor product : histamine receptor H 1 protein_id : NP_032311.2

name	Atg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22550098 GeneID:74244 MGI:1921494
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004839 - ubiquitin activating enzyme activity [Evidence IDA] GO_process : GO:0006914 - autophagy [Evidence TAS]; GO:0031401 - positive regulation of protein modification [Evidence IDA] [Evidence ISS]; GO:0006497 - protein amino acid lipidation [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : autophagy 7-like; autophagy-related 7-like product : AGP7 protein_id : NP_083111.1

name	Vgll4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244116 CCDS:CCDS20436.1 GeneID:232334 MGI:2652840
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : vestigial like 4 protein_id : NP_808351.1

name	1500001M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76559944 CCDS:CCDS20437.1 GeneID:68971 MGI:1916221
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : MMP37-like protein, mitochondrial protein_id : NP_081170.1

name	Syn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567410 GeneID:20965 MGI:103020
definition	GO_component : GO:0045202 - synapse [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence IEA]; GO:0030672 - synaptic vesicle membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence TAS] GO_process : GO:0007269 - neurotransmitter secretion [Evidence IMP] [Evidence IGI] codon_start : 1 note : synapsin 2; Synapsin IIa; Synapsin IIb product : synapsin II protein_id : NP_038709.1

name	Timp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625888 CCDS:CCDS20438.1 GeneID:110595 MGI:109125
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008191 - metalloendopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007269 - neurotransmitter secretion [Evidence IEA] codon_start : 1 product : tissue inhibitor of metalloproteinase 4 protein_id : NP_542370.3

name	Pparg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755138 CCDS:CCDS20439.1 GeneID:19016 MGI:97747
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0017053 - transcriptional repressor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence IPI]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IMP] [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IGI]; GO:0030855 - epithelial cell differentiation [Evidence IGI]; GO:0045444 - fat cell differentiation [Evidence IGI] [Evidence IDA]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045598 - regulation of fat cell differentiation [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : peroxisome proliferator activated receptor gamma 2 product : peroxisome proliferator activated receptor gamma protein_id : NP_035276.1

name	LOC100043420 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043420
definition	number : 1 pseudo : _no_value

name	LOC100043420 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043420
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:159557
definition	standard_name : AW553738

name	(CDS detail)
type	STS
link
xref	UniSTS:208011
definition	standard_name : BB407082

name	(CDS detail)
type	STS
link
xref	UniSTS:144081
definition	standard_name : Ogg1

name	(CDS detail)
type	STS
link
xref	UniSTS:167474
definition	standard_name : D6Ertd263e

name	(CDS detail)
type	STS
link
xref	UniSTS:159558
definition	standard_name : AI505105

name	(CDS detail)
type	STS
link
xref	UniSTS:130643
definition	standard_name : D6Mit10

name	(CDS detail)
type	STS
link
xref	UniSTS:208013
definition	standard_name : BB284401

name	(CDS detail)
type	STS
link
xref	UniSTS:164336
definition	standard_name : AI987856

name	(CDS detail)
type	STS
link
xref	UniSTS:270317
definition	standard_name : PMC117179P1

name	(CDS detail)
type	STS
link
xref	UniSTS:268964
definition	standard_name : MARC_26162-26163:1030455175:1

name	(CDS detail)
type	STS
link
xref	UniSTS:238061
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179434
definition	standard_name : AI327076

name	(CDS detail)
type	STS
link
xref	UniSTS:179435
definition	standard_name : AI450050

name	(CDS detail)
type	STS
link
xref	UniSTS:124430
definition	standard_name : 41.MMHAP80FLF5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:164337
definition	standard_name : AI527266

name	(CDS detail)
type	STS
link
xref	UniSTS:143143
definition	standard_name : Fsp27

name	(CDS detail)
type	STS
link
xref	UniSTS:165481
definition	standard_name : AW146438

name	(CDS detail)
type	STS
link
xref	UniSTS:212888
definition	standard_name : RH129589

name	(CDS detail)
type	STS
link
xref	UniSTS:161809
definition	standard_name : RH124987

name	(CDS detail)
type	STS
link
xref	UniSTS:164335
definition	standard_name : AI843811

name	(CDS detail)
type	STS
link
xref	UniSTS:248834
definition	standard_name : BF415092

name	(CDS detail)
type	STS
link
xref	UniSTS:179436
definition	standard_name : AW260416

name	(CDS detail)
type	STS
link
xref	UniSTS:209995
definition	standard_name : RH135999

name	(CDS detail)
type	STS
link
xref	UniSTS:271784
definition	standard_name : PMC194856P1

name	(CDS detail)
type	STS
link
xref	UniSTS:130653
definition	standard_name : D6Mit11

name	(CDS detail)
type	STS
link
xref	UniSTS:271804
definition	standard_name : PMC196256P1

name	(CDS detail)
type	STS
link
xref	UniSTS:208012
definition	standard_name : AU015151

name	(CDS detail)
type	STS
link
xref	UniSTS:185678
definition	standard_name : BB137857

name	(CDS detail)
type	STS
link
xref	UniSTS:165482
definition	standard_name : AW011779

name	(CDS detail)
type	STS
link
xref	UniSTS:217900
definition	standard_name : RH134621

name	(CDS detail)
type	STS
link
xref	UniSTS:272192
definition	standard_name : PMC23053P2

name	(CDS detail)
type	STS
link
xref	UniSTS:272191
definition	standard_name : PMC23053P1

name	(CDS detail)
type	STS
link
xref	UniSTS:163396
definition	standard_name : U12570

name	(CDS detail)
type	STS
link
xref	UniSTS:144755
definition	standard_name : Vhlh

name	(CDS detail)
type	STS
link
xref	UniSTS:235523
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179439
definition	standard_name : AI649099

name	(CDS detail)
type	STS
link
xref	UniSTS:125454
definition	standard_name : MHAa97b9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179438
definition	standard_name : AI646012

name	(CDS detail)
type	STS
link
xref	UniSTS:272300
definition	standard_name : PMC262394P1

name	(CDS detail)
type	STS
link
xref	UniSTS:272302
definition	standard_name : PMC262394P3

name	(CDS detail)
type	STS
link
xref	UniSTS:272301
definition	standard_name : PMC262394P2

name	(CDS detail)
type	STS
link
xref	UniSTS:234686
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:95075
definition	standard_name : G43664

name	(CDS detail)
type	STS
link
xref	UniSTS:150914
definition	standard_name : D3S2930E

name	(CDS detail)
type	STS
link
xref	UniSTS:43011
definition	standard_name : D3S3990

name	(CDS detail)
type	STS
link
xref	UniSTS:223409
definition	standard_name : RH141415

name	(CDS detail)
type	STS
link
xref	UniSTS:124504
definition	standard_name : 43.MMHAP59FLG4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:124115
definition	standard_name : 34.MMHAP88FRD10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:142586
definition	standard_name : D6Mit30

name	(CDS detail)
type	STS
link
xref	UniSTS:130935
definition	standard_name : D6Mit383

name	(CDS detail)
type	STS
link
xref	UniSTS:130883
definition	standard_name : D6Mit329

name	(CDS detail)
type	STS
link
xref	UniSTS:143159
definition	standard_name : Gabt4

name	(CDS detail)
type	STS
link
xref	UniSTS:143158
definition	standard_name : Gabt4

name	(CDS detail)
type	STS
link
xref	UniSTS:130957
definition	standard_name : D6Mit55

name	(CDS detail)
type	STS
link
xref	UniSTS:143155
definition	standard_name : Gabt1

name	(CDS detail)
type	STS
link
xref	UniSTS:130965
definition	standard_name : D6Mit63

name	(CDS detail)
type	STS
link
xref	UniSTS:123239
definition	standard_name : 15.MHAa10f3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123901
definition	standard_name : 30.MMHAP30FLB6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:167492
definition	standard_name : D6Ertd47e

name	(CDS detail)
type	STS
link
xref	UniSTS:163124
definition	standard_name : RH126416

name	(CDS detail)
type	STS
link
xref	UniSTS:221502
definition	standard_name : RH139416

name	(CDS detail)
type	STS
link
xref	UniSTS:159559
definition	standard_name : AI449595

name	(CDS detail)
type	STS
link
xref	UniSTS:144530
definition	standard_name : Syn2

name	(CDS detail)
type	STS
link
xref	UniSTS:123986
definition	standard_name : 32.MMHAP4FRC11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:235524
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:125626
definition	standard_name : Results_H8_11_95_11.55_AM42.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130920
definition	standard_name : D6Mit366

name	(CDS detail)
type	STS
link
xref	UniSTS:123833
definition	standard_name : RH118303

name	(CDS detail)
type	STS
link
xref	UniSTS:147599
definition	standard_name : D3S732

name	(CDS detail)
type	STS
link
xref	UniSTS:163397
definition	standard_name : AF096867

name	(CDS detail)
type	STS
link
xref	UniSTS:246722
definition	standard_name : BI295795

name	(CDS detail)
type	STS
link
xref	UniSTS:164338
definition	standard_name : AI836018

name	(CDS detail)
type	STS
link
xref	UniSTS:179441
definition	standard_name : AI841723

name	(CDS detail)
type	STS
link
xref	UniSTS:144528
definition	standard_name : Syn2

name	(CDS detail)
type	STS
link
xref	UniSTS:186027
definition	standard_name : BB157820

name	LOC666491 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255399 GeneID:666491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to Ac2-008 pseudo : _no_value transcript_id : XR_034873.1

clone name	MSMg01-165P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-214G02.b	B6Ng01-214G02.g
ACC	GA031643	GA031644
length	1,064	460
definition	B6Ng01-214G02.b	B6Ng01-214G02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(114,218,588 - 114,219,614)	(114,383,247 - 114,383,712)
sequence	gaattcagtgaaacgcatacagggctggttagaggatttggagtgggcat ttagttgggctttgaaggataattaggagtttgctctgaccaagaagaga gtcctgagcattcctggaaagggaaggagtggctgggctaaatcccagga gaggagatgtcacagtgtgtctgggaggcgctgggagactgggacaggag aaacagagaggatgtgcctaaatctctgtccctcccctccccctgtggtc tcagcctgccctgccactgggtcagcagcactgacccagtgctgacctca gctcttgagcactaattccccactggtaaacttcacctcaggctcttcct caaaaccagcgtgagttgtctgaacttcattaccctcctccattggagca gagtacagggagagggcagccatcattccagcagtagaatgttctgacag gggaagctggacaagggaaatggggatcaggggatcatctggatcccaga aaagggagagcaggctgggccgctgagcaagcaaatgggacattcaggtg cattgggtggacctaggcccaatgacaaggcaacggctcccccaggaaag caaagccagtgttgagagtcgtcaggaggggctgatcccttgtcactagg gtgggtcactctggatcagtgcccagttcacgcttcacactgaagggcag caactgctaccacagaatctcatccctcaggatgatgcagaatggccatg cccattttcacagatgagttaaaccaaggccctagccaggttaaatctag tattcctggatgcccaccactagaaaaggaagcagttaaagactatgacc tcagcaatagataaatcccatttcaaaaagactacatgcacccataggga tccttcttccaactctctttgaaggtgaaccagtttggctctttggtatc ccctgttgatcccacagaccctctctttgtcctggggtctttggaaggaa ggcacctgtgtggatggtttctttgtcacccaactttcctgacaaatgac tttttcaagctggg	ttcagataaggtggtttcttacagctcagagagccctgggggattcttca gtaccctgaactgtgttgacataatacaacagttccagaaaggcaacctg caggcacaaggtcagaacctctagacccctggatggatgtgacccatcac catggcagtcacttggttctgataagccagggcaggggggtgctaggttg ctgtctttgccttgggtgggctggggtagaatttctagcctgaacagggt cggcaagtaagcagggtggctgggagaacgcatggtaggcaggcctatct gtggcctgctttggttgtctaatttcctacatagggctcttgatgctcaa gtcatatggaagggtgggtcttggatctgatcttcaagcagctcgggcaa atgagactctttccagaaagaaaacccattccaaagagatggttcggggg gtgggggtgg
quality values	Open. Hide. 39 38 26 35 54 31 19 21 25 34 52 52 46 47 45 49 42 54 56 54 39 56 38 41 47 49 62 49 62 62 54 56 62 56 62 59 36 62 62 62 59 62 62 59 62 62 59 62 62 54 62 54 54 48 59 59 62 62 59 62 62 62 62 62 62 62 59 62 59 49 62 62 59 62 59 59 62 62 59 62 62 54 54 59 62 62 62 62 59 62 59 59 62 51 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 59 46 54 46 62 59 62 62 62 62 59 59 59 62 59 62 59 62 62 62 62 59 59 59 59 59 62 56 48 54 59 56 51 62 46 43 54 48 56 56 46 45 54 46 54 56 62 59 59 62 59 56 56 59 59 56 59 48 56 59 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 49 54 54 62 59 56 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 59 59 59 59 59 62 62 62 59 62 62 59 62 62 59 62 62 62 59 59 62 62 59 62 59 59 62 62 59 62 59 62 62 62 62 59 59 62 62 51 59 59 46 59 59 59 59 59 59 59 59 59 59 62 62 62 54 54 59 62 62 62 59 59 49 49 51 56 48 59 59 51 62 59 62 62 59 62 59 59 59 59 51 50 43 48 56 59 54 38 45 45 46 59 62 56 56 62 62 62 62 62 62 62 59 56 62 56 59 62 62 62 59 62 62 62 59 62 56 59 59 59 51 59 62 62 59 59 51 59 56 43 62 62 62 62 62 62 62 59 59 59 62 62 59 62 56 56 48 46 59 59 62 62 62 62 62 62 62 62 59 59 62 59 59 51 51 49 62 62 59 62 62 62 62 59 59 59 59 50 46 59 59 56 62 62 62 62 62 62 62 59 59 56 59 46 62 59 62 62 62 59 62 59 56 56 59 59 51 62 51 59 59 59 59 46 51 34 45 40 43 59 59 59 59 62 62 62 59 45 62 59 59 62 56 62 59 62 59 62 59 59 44 43 62 56 59 62 62 59 59 62 59 62 59 51 44 24 50 51 56 56 56 47 56 51 51 56 50 39 56 42 56 32 44 51 42 42 62 54 62 56 51 56 56 56 39 44 38 62 50 44 37 51 42 44 32 43 38 56 39 39 50 51 56 39 39 42 31 39 51 33 34 38 37 26 43 36 50 56 56 56 56 56 47 31 38 47 51 47 42 56 51 56 56 42 39 56 50 56 39 62 56 47 56 56 27 56 39 39 43 38 38 56 46 42 54 62 25 62 62 62 39 56 35 40 30 27 33 27 42 33 54 56 27 26 23 26 24 16 47 38 17 35 24 24 22 23 22 27 26 33 38 38 40 22 41 30 27 21 28 42 31 31 38 31 24 30 19 42 42 50 42 43 52 42 46 33 27 27 35 31 25 29 35 23 62 47 38 43 31 28 17 12 23 20 25 17 23 35 36 35 29 52 47 24 52 54 49 52 58 35 35 42 24 32 28 32 39 23 13 46 49 42 46 54 39 39 25 33 9 46 42 40 42 42 42 52 30 25 34 35 30 39 25 12 49 58 36 28 50 46 34 42 54 18 41 42 14 13 12 10 19 20 15 32 23 21 25 19 7 25 13 18 13 7 12 18 19 17 13 15 14 18 19 16 19 14 10 13 37 41 24 18 21 20 16 18 37 36 37 27 40 35 27 10 14 35 38 13 33 42 22 9 19 34 42 26 25 40 26 22 13 16 25 15 20 25 30 24 20 16 16 18 24 15 18 19 15 19 28 12 30 15 23 39 19 25 16 15 11 7 7 13 19 19 7 22 32 17 18 39 23 16 11 10 18 19 25 15 10 22 14 22 37 33 40 28 20 25 17 18 21 6 19 32 21 10 21 11 6 15 28 40 9 28 22 9 12 14 25 14 15 21 21 16 6 41 16 24 21 30 23 11 25 19 13 16 16 11 15 9 10 10 12 17 21 9 11 44 7 13 9 40 12 19 23 8 22 16 29 32 22 6 9 12 6 11 12 32 23 24 21 17 12 23 23 15 18 6 25 18 8 7 36 15 13 44 11 11 11 14 13 18 11 14 7 18 14 7 18 6 15 37 33 21 11 14 15 17 9 9 11 6 14 8 8 22 7 8 8 15 13 19 6 6 16 9 19 35 19 13 7 6 6 13 13 10 12 14 30 21 6 9 9 6 15 12 20 6 16 23 10 17 9 12 11 6 9 30 12 9 11 45 39 21 25 18 17 9 18 25 10 30 24	Open. Hide. 62 62 59 49 62 59 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 39 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 37 46 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 56 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 62 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 32 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_114218588_114219614
seq2: B6Ng01-214G02.b_35_1098

seq1  GAATTCAGTGAAACGCATACAGGGCTGGTTAGAGGATTTGGAGTGGGCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTGAAACGCATACAGGGCTGGTTAGAGGATTTGGAGTGGGCAT  50

seq1  TTAGTTGGGCTTTGAAGGATAATTAGGAGTTTGCTCTGACCAAGAAGAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTTGGGCTTTGAAGGATAATTAGGAGTTTGCTCTGACCAAGAAGAGA  100

seq1  GTCCTGAGCATTCCTGGAAAGGGAAGGAGTGGCTGGGCTAAATCCCAGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTGAGCATTCCTGGAAAGGGAAGGAGTGGCTGGGCTAAATCCCAGGA  150

seq1  GAGGAGATGTCACAGTGTGTCTGGGAGGCGCTGGGAGACTGGGACAGGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAGATGTCACAGTGTGTCTGGGAGGCGCTGGGAGACTGGGACAGGAG  200

seq1  AAACAGAGAGGATGTGCCTAAATCTCTGTCCCTCCCCTCCCCCTGTGGTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAGAGAGGATGTGCCTAAATCTCTGTCCCTCCCCTCCCCCTGTGGTC  250

seq1  TCAGCCTGCCCTGCCACTGGGTCAGCAGCACTGACCCAGTGCTGACCTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCCTGCCCTGCCACTGGGTCAGCAGCACTGACCCAGTGCTGACCTCA  300

seq1  GCTCTTGAGCACTAATTCCCCACTGGTAAACTTCACCTCAGGCTCTTCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTTGAGCACTAATTCCCCACTGGTAAACTTCACCTCAGGCTCTTCCT  350

seq1  CAAAACCAGCGTGAGTTGTCTGAACTTCATTACCCTCCTCCATTGGAGCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACCAGCGTGAGTTGTCTGAACTTCATTACCCTCCTCCATTGGAGCA  400

seq1  GAGTACAGGGAGAGGGCAGCCATCATTCCAGCAGTAGAATGTTCTGACAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTACAGGGAGAGGGCAGCCATCATTCCAGCAGTAGAATGTTCTGACAG  450

seq1  GGGAAGCTGGACAAGGGAAATGGGGATCAGGGGATCATCTGGATCCCAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAGCTGGACAAGGGAAATGGGGATCAGGGGATCATCTGGATCCCAGA  500

seq1  AAAGGGAGAGCAGGCTGGGCCGCTGAGCAAGCAAATGGGACATTCAGGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGGAGAGCAGGCTGGGCCGCTGAGCAAGCAAATGGGACATTCAGGTG  550

seq1  CATTGGGTGGACCTAGGCCCAATGACAAGGCAACGGCTCCCCCAGGAAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGGGTGGACCTAGGCCCAATGACAAGGCAACGGCTCCCCCAGGAAAG  600

seq1  CAAAGCCAGTGTTGAGAGTCGTCAGGAGGGGCTGATCCCTTGTCACTAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGCCAGTGTTGAGAGTCGTCAGGAGGGGCTGATCCCTTGTCACTAGG  650

seq1  GTGGGTCACTCTGGATCAGTGCCCAG-TCACGCTTCACACTGAAGGGCAG  699
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  GTGGGTCACTCTGGATCAGTGCCCAGTTCACGCTTCACACTGAAGGGCAG  700

seq1  CAACTGCTACCACAGAATCTCAT-CCTCAGGATGATGCAGAATGGCCATG  748
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  CAACTGCTACCACAGAATCTCATCCCTCAGGATGATGCAGAATGGCCATG  750

seq1  CCCA-TTTCACAGATGAG-TAAACCAAGG-CCTAGCCAGGTTAAATCTAG  795
      |||| ||||||||||||| |||||||||| ||||||||||||||||||||
seq2  CCCATTTTCACAGATGAGTTAAACCAAGGCCCTAGCCAGGTTAAATCTAG  800

seq1  TA-TCCTGGATG-CCACCACTAGAAAAGGAAGCAGTTAAAGACTATGACC  843
      || ||||||||| |||||||||||||||||||||||||||||||||||||
seq2  TATTCCTGGATGCCCACCACTAGAAAAGGAAGCAGTTAAAGACTATGACC  850

seq1  TCAGCAATAGATAAA-CCCATTTC-AAAAGACTACATGCA-CCATAGGGA  890
      ||||||||||||||| |||||||| ||||||||||||||| |||||||||
seq2  TCAGCAATAGATAAATCCCATTTCAAAAAGACTACATGCACCCATAGGGA  900

seq1  TCCTTC-TCCAACTCCCTT--GAGGTG-ACCAGTT--GC-CCTTGGCAT-  932
      |||||| |||||||| |||   ||||| |||||||  || | |||| || 
seq2  TCCTTCTTCCAACTCTCTTTGAAGGTGAACCAGTTTGGCTCTTTGGTATC  950

seq1  CCCTG-TGATCCCACAGACCC-CTC-TTGTCCTGGGTTC--TGGA--GGA  975
      ||||| ||||||||||||||| ||| |||||||||| ||  ||||  | |
seq2  CCCTGTTGATCCCACAGACCCTCTCTTTGTCCTGGGGTCTTTGGAAGGAA  1000

seq1  GGCAC---TGTGG--TGTTTCCT--GCACCCA--CATCCTG-CATA-GAC  1014
      |||||   |||||   ||||| |   ||||||    ||||| || | |||
seq2  GGCACCTGTGTGGATGGTTTCTTTGTCACCCAACTTTCCTGACAAATGAC  1050

seq1  -TTTTCAAGCTGGG  1027
       |||||||||||||
seq2  TTTTTCAAGCTGGG  1064

seq1: chr6_114383247_114383712
seq2: B6Ng01-214G02.g_65_530 (reverse)

seq1  CCACCCCCACCCCCCGAACCATCTCTTTGGAATGGGTTTTCTTTCTGGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCCCCACCCCCCGAACCATCTCTTTGGAATGGGTTTTCTTTCTGGAA  50

seq1  AGAGTCTCATTTGCCCGAGCTGCTTGAAGATCAGATCCAAGACCCACCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTCTCATTTGCCCGAGCTGCTTGAAGATCAGATCCAAGACCCACCCT  100

seq1  TCCATATGACTTGAGCATCAAGAGCCCTATGTAGGAAATTAGACAACCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATATGACTTGAGCATCAAGAGCCCTATGTAGGAAATTAGACAACCAA  150

seq1  AGCAGGCCACAGATAGGCCTGCCTACCATGCGTTCTCCCAGCCACCCTGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGCCACAGATAGGCCTGCCTACCATGCGTTCTCCCAGCCACCCTGC  200

seq1  TTACTTGCCGACCCTGTTCAGGCTAGAAATTCTACCCCAGCCCACCCAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTTGCCGACCCTGTTCAGGCTAGAAATTCTACCCCAGCCCACCCAAG  250

seq1  GCAAAGACAGCAACCTAGCACCCCCCTGCCCTGGCTTATCAGAACCAAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAGACAGCAACCTAGCACCCCCCTGCCCTGGCTTATCAGAACCAAGT  300

seq1  GACTGCCATGGTGATGGGTCACATCCATCCAGGGGTCTAGAGGTTCTGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGCCATGGTGATGGGTCACATCCATCCAGGGGTCTAGAGGTTCTGAC  350

seq1  CTTGTGCCTGCAGGTTGCCTTTCTGGAACTGTTGTATTATGTCAACACAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTGCCTGCAGGTTGCCTTTCTGGAACTGTTGTATTATGTCAACACAG  400

seq1  TTCAGGGTACTGAAGAATCCCCCAGGGCTCTCTGAGCTGTAAGAAACCAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGGGTACTGAAGAATCCCCCAGGGCTCTCTGAGCTGTAAGAAACCAC  450

seq1  CTTATCTGAAGAATTC  466
      ||||||||||||||||
seq2  CTTATCTGAAGAATTC  466

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information