MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-248M09
Chromosome	6 (Build37)
Map Location	41,305,506 - 41,306,553
singlet/doublet	singlet
Overlap gene	Try10
Upstream gene	Agk, E330009J07Rik, BC052883, Ssbp1, Tas2r137, Tas2r108, 1700016G05Rik, LOC669661, Olfr461, Olfr460, Clec5a, Tas2r138, Mgam, EG638904, Moxd2, LOC621968, BC048599, 1700074P13Rik, LOC194360, 1810009J06Rik, LOC100040208, 2210010C04Rik, LOC100039790, Tcrb-V8.2, LOC100040359, LOC100040333, Try4, 1810049H19Rik
Downstream gene	Prss3, EG436523, EG386551, LOC100040233, Prss1, Prss2, Tcrb-V13, Ephb6, Trpv6, Trpv5, 1700034O15Rik, Kel, Olfr459, Pip, Sval2, Sval1, Sval3, Sva, Tas2r139, Tas2r144, Gstk1, Tmem139, Casp2, Clcn1, 6330503C03Rik, Zyx
Link	Open Mouse BAC browser

Click to get alignment info.

name	Agk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69923 MGI:1917173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330009J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243780 MGI:2444256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC052883 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381759 MGI:3027899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381760 MGI:1920040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tas2r137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574417 MGI:3606604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57253 MGI:2681210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67690 MGI:1914940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Olfr461 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258380 MGI:3030295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr460 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258381 MGI:3030294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tas2r138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387513 MGI:2681306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232714 MGI:1203495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 6 Proteins

name	EG638904 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638904 MGI:3645497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Moxd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194357 MGI:2388042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	BC048599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232717 MGI:3608323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700074P13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73481 MGI:1920731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC194360 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	1810009J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73626 MGI:1920876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 55 Proteins

name	2210010C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67373 MGI:1914623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039790 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Tcrb-V8.2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21607 MGI:98608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 8 Proteins

name	LOC100040359 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	LOC100040333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Try4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22074 MGI:102757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810049H19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435889 MGI:3045752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Try10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436522 MGI:3687012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22073 MGI:102758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436523 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436523 MGI:3646222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG386551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386551 MGI:3643903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 116 ESTs, 98 Proteins

name	Prss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114228 MGI:98839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22072 MGI:102759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcrb-V13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269846 MGI:98587
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ephb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13848 MGI:1096338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64177 MGI:1927259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194352 MGI:2429764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700034O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76606 MGI:1923856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kel (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23925 MGI:1346053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258569 MGI:3030293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18716 MGI:102696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sval2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84543 MGI:1934254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sval1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71578 MGI:1918828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sval3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387564 MGI:3047714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sva (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20939 MGI:102785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353148 MGI:2681308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r144 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387515 MGI:2681312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76263 MGI:1923513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109218 MGI:1924444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12366 MGI:97295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clcn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12723 MGI:88417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330503C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76156 MGI:1923406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zyx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22793 MGI:103072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537517 GeneID:69923 MGI:1917173
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acylglycerol kinase transcript_id : NM_023538.1

name	E330009J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802116 GeneID:243780 MGI:2444256
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330009J07 gene transcript_id : NM_175528.3

name	BC052883 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235772 GeneID:381759 MGI:3027899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC052883 transcript_id : NM_201370.1

name	Ssbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48374436 GeneID:381760 MGI:1920040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 1 transcript_id : NM_212468.3

name	Ssbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48374437 GeneID:381760 MGI:1920040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 1 transcript_id : NM_028358.2

name	Tas2r137 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480159 GeneID:574417 MGI:3606604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 137 transcript_id : NM_001025385.1

name	Tas2r108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048427 GeneID:57253 MGI:2681210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 108 transcript_id : NM_020502.1

name	1700016G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385811 GeneID:67690 MGI:1914940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700016G05 gene transcript_id : NM_026317.1

name	Olfr461 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129540 GeneID:258380 MGI:3030295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 461 transcript_id : NM_146382.1

name	Olfr460 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129534 GeneID:258381 MGI:3030294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 460 transcript_id : NM_146383.1

name	Clec5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370378 GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 5, member a transcript_id : NM_021364.2

name	Clec5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370375 GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 5, member a transcript_id : NM_001038604.1

name	Tas2r138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47824875 GeneID:387513 MGI:2681306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 138 transcript_id : NM_001001451.1

name	Mgam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255058 GeneID:232714 MGI:1203495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 6 Proteins product : maltase-glucoamylase transcript_id : XM_001481277.1

name	EG638904 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377282 GeneID:638904 MGI:3645497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : predicted gene, EG638904 transcript_id : XM_976192.1

name	Moxd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948566 GeneID:194357 MGI:2388042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monooxygenase, DBH-like 2 transcript_id : NM_139296.2

name	LOC621968 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82900877 GeneID:621968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to T-cell receptor beta chain V region E1 precursor transcript_id : XM_886370.1

name	BC048599 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801831 GeneID:232717 MGI:3608323
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048599 transcript_id : NM_175020.2

name	1700074P13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893180 GeneID:73481 MGI:1920731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700074P13 gene transcript_id : NM_028550.3

name	1810009J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130492 GeneID:73626 MGI:1920876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810009J06 gene transcript_id : NM_023707.3

name	LOC100040208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255071 GeneID:100040208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 55 Proteins product : similar to trypsinogen 4 transcript_id : XM_001474567.1

name	2210010C04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043960 GeneID:67373 MGI:1914623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210010C04 gene transcript_id : NM_023333.4

name	LOC100039790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255060 GeneID:100039790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to TCRBV16S1 transcript_id : XM_001473509.1

name	LOC100040359 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255077 GeneID:100040359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : similar to LOC639390 protein transcript_id : XM_001474835.1

name	LOC100040333 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255075 GeneID:100040333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to Expressed sequence AW456874 transcript_id : XM_001474813.1

name	Try4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129293 GeneID:22074 MGI:102757
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trypsin 4 transcript_id : NM_011646.3

name	1810049H19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802041 GeneID:435889 MGI:3045752
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810049H19 gene transcript_id : NM_001003405.2

name	Try10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781770 GeneID:436522 MGI:3687012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trypsin 10 transcript_id : NM_001038996.1

name	Prss3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755890 GeneID:22073 MGI:102758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 3 transcript_id : NM_011645.1

name	EG436523 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781767 GeneID:436523 MGI:3646222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436523 transcript_id : NM_001038997.1

name	EG386551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092302 GeneID:386551 MGI:3643903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG386551 transcript_id : NM_001003664.1

name	LOC100040233 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255073 GeneID:100040233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 116 ESTs, 98 Proteins product : similar to trypsinogen 15 transcript_id : XM_001474605.1

name	Prss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716568 GeneID:114228 MGI:98839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 1 (trypsin 1) transcript_id : NM_053243.1

name	Prss2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678438 GeneID:22072 MGI:102759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 2 transcript_id : NM_009430.1

name	Ephb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354026 GeneID:13848 MGI:1096338
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B6 transcript_id : NM_007680.3

name	Trpv6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374373 GeneID:64177 MGI:1927259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 6 transcript_id : NM_022413.3

name	Trpv5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186473 GeneID:194352 MGI:2429764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 5 transcript_id : NM_001007572.2

name	1700034O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130645 GeneID:76606 MGI:1923856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700034O15 gene transcript_id : NM_029671.2

name	Kel (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896654 GeneID:23925 MGI:1346053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kell blood group transcript_id : NM_032540.2

name	Olfr459 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129496 GeneID:258569 MGI:3030293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 459 transcript_id : NM_146576.1

name	Pip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352912 GeneID:18716 MGI:102696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin induced protein transcript_id : NM_008843.3

name	Sval2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14211543 GeneID:84543 MGI:1934254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen-like 2 transcript_id : NM_032542.1

name	Sval1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377710 GeneID:71578 MGI:1918828
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen-like 1 transcript_id : NM_027832.2

name	Sval3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56710337 GeneID:387564 MGI:3047714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen-like 3 transcript_id : NM_001003952.1

name	Sva (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678186 GeneID:20939 MGI:102785
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle antigen transcript_id : NM_009299.1

name	Tas2r139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044478 GeneID:353148 MGI:2681308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 139 transcript_id : NM_181275.1

name	Tas2r144 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47824892 GeneID:387515 MGI:2681312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 144 transcript_id : NM_001001453.1

name	Gstk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130626 GeneID:76263 MGI:1923513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase kappa 1 transcript_id : NM_029555.2

name	Tmem139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803111 GeneID:109218 MGI:1924444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 139 transcript_id : NM_175408.3

name	Casp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680847 GeneID:12366 MGI:97295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 2 transcript_id : NM_007610.1

name	Clcn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383369 GeneID:12723 MGI:88417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 1 transcript_id : NM_013491.2

name	6330503C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803180 GeneID:76156 MGI:1923406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330503C03 gene transcript_id : NM_029528.3

name	Zyx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487367 GeneID:22793 MGI:103072
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zyxin transcript_id : NM_011777.2

name	Agk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537518 CCDS:CCDS20027.1 GeneID:69923 MGI:1917173
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0001729 - ceramide kinase activity [Evidence IDA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0001727 - lipid kinase activity [Evidence IDA] GO_process : GO:0046834 - lipid phosphorylation [Evidence IDA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : multiple substrate lipid kinase product : multi-substrate lipid kinase protein_id : NP_076027.1

name	E330009J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425298 CCDS:CCDS20028.1 GeneID:243780 MGI:2444256
definition	codon_start : 1 product : hypothetical protein LOC243780 protein_id : NP_780737.1

name	BC052883 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235773 CCDS:CCDS20029.1 GeneID:381759 MGI:3027899
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381759 protein_id : NP_958758.1

name	Ssbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059026 GeneID:381760 MGI:1920040
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : single-stranded DNA binding protein 1 isoform 1 protein_id : NP_997633.1

name	Ssbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47058964 CCDS:CCDS20030.1 GeneID:381760 MGI:1920040
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : single-stranded DNA binding protein 1 isoform 2 protein_id : NP_082634.1

name	Tas2r137 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480160 CCDS:CCDS20031.1 GeneID:574417 MGI:3606604
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : candidate taste receptor mt2r41; taste receptor T2R37 product : taste receptor, type 2, member 137 protein_id : NP_001020556.1

name	Tas2r108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048428 CCDS:CCDS20032.1 GeneID:57253 MGI:2681210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : taste receptor T2R8; candidate taste receptor T2R8 product : taste receptor, type 2, member 108 protein_id : NP_065248.1

name	1700016G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385812 CCDS:CCDS20033.1 GeneID:67690 MGI:1914940
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67690 protein_id : NP_080593.1

name	Olfr461 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129541 CCDS:CCDS20034.1 GeneID:258380 MGI:3030295
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-6973252-6974193; olfactory receptor MOR120-3 product : olfactory receptor 461 protein_id : NP_666494.1

name	Olfr460 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129535 CCDS:CCDS20035.1 GeneID:258381 MGI:3030294
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-6947292-6946348; olfactory receptor MOR120-2 product : olfactory receptor 460 protein_id : NP_666495.1

name	Clec5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946692 CCDS:CCDS20037.1 GeneID:23845 MGI:1345151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; type II transmembrane protein MDL-1; myeloid DAP12-associating lectin-1; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 product : C-type lectin domain family 5, member a isoform 2 protein_id : NP_067339.1

name	Clec5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370376 CCDS:CCDS20036.1 GeneID:23845 MGI:1345151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; type II transmembrane protein MDL-1; myeloid DAP12-associating lectin-1; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 product : C-type lectin domain family 5, member a isoform 1 protein_id : NP_001033693.1

name	Tas2r138 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824876 CCDS:CCDS20038.1 GeneID:387513 MGI:2681306
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence ISS] [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 138 protein_id : NP_001001451.1

name	Mgam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255059 GeneID:232714 MGI:1203495
definition	codon_start : 1 note : overriding stop codons product : similar to maltase-glucoamylase protein_id : XP_001481327.1 transl_except : (pos:40630375..40630377,aa:OTHER) transl_except : (pos:40714274..40714276,aa:OTHER)

name	EG638904 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377283 GeneID:638904 MGI:3645497
definition	codon_start : 1 product : similar to hCG2001479 protein_id : XP_981286.1

name	Moxd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948567 CCDS:CCDS20039.1 GeneID:194357 MGI:2388042
definition	GO_process : GO:0006548 - histidine catabolism [Evidence IEA] codon_start : 1 note : dopamine beta-hydroxylase-like 1 product : monooxygenase, DBH-like 2 protein_id : NP_647457.2

name	LOC621968 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82900878 GeneID:621968
definition	codon_start : 1 product : similar to T-cell receptor beta V(E1)-D(1)-J(2.5) protein_id : XP_891463.1

name	BC048599 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239437 CCDS:CCDS20040.1 GeneID:232717 MGI:3608323
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232717 protein_id : NP_778185.1

name	1700074P13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312106 CCDS:CCDS20041.1 GeneID:73481 MGI:1920731
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73481 protein_id : NP_082826.1

name	1810009J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963793 CCDS:CCDS20042.1 GeneID:73626 MGI:1920876
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : trypsinogen; trypsinogen 5 product : RIKEN cDNA 1810009J06 protein_id : NP_076196.1

name	LOC100040208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255072 GeneID:100040208
definition	codon_start : 1 product : similar to trypsinogen 4 protein_id : XP_001474617.1

name	2210010C04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043961 CCDS:CCDS20043.1 GeneID:67373 MGI:1914623
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : trypsinogen 7 protein_id : NP_075822.3

name	LOC100039790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255061 GeneID:100039790
definition	codon_start : 1 product : similar to TCRBV16S1 protein_id : XP_001473559.1

name	Tcrb-V8.2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:21607 MGI:98608
definition	codon_start : 1 exception : rearrangement required for product

name	Tcrb-V8.2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:21607 MGI:98608
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100040359 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255078 GeneID:100040359
definition	codon_start : 1 product : similar to LOC639390 protein protein_id : XP_001474885.1

name	LOC100040333 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255076 GeneID:100040333
definition	codon_start : 1 product : similar to Expressed sequence AW456874 protein_id : XP_001474863.1

name	Try4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755893 CCDS:CCDS20044.1 GeneID:22074 MGI:102757
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : trypsin 4 protein_id : NP_035776.1

name	1810049H19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51010909 CCDS:CCDS20045.1 GeneID:435889 MGI:3045752
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : Tesp4 protein protein_id : NP_001003405.1

name	Try10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781771 CCDS:CCDS20046.1 GeneID:436522 MGI:3687012
definition	codon_start : 1 product : trypsinogen 10 protein_id : NP_001034085.1

name	Prss3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755891 CCDS:CCDS20047.1 GeneID:22073 MGI:102758
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mesotrypsin; trypsin 3; trypsinogen; trypsinogen 15 product : protease, serine, 3 protein_id : NP_035775.1

name	EG436523 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781768 CCDS:CCDS20048.1 GeneID:436523 MGI:3646222
definition	codon_start : 1 product : trypsinogen 12 protein_id : NP_001034086.1

name	EG386551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092303 GeneID:386551 MGI:3643903
definition	codon_start : 1 function : serine protease product : Try10-like trypsinogen protein_id : NP_001003664.1

name	LOC100040233 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255074 GeneID:100040233
definition	codon_start : 1 product : similar to trypsinogen 15 protein_id : XP_001474655.1

name	Prss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716569 CCDS:CCDS20049.1 GeneID:114228 MGI:98839
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004295 - trypsin activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : trypsinogen 16; trypsin 1 product : protease, serine, 1 protein_id : NP_444473.1

name	Prss2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678439 CCDS:CCDS20050.1 GeneID:22072 MGI:102759
definition	GO_component : GO:0031012 - extracellular matrix [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004295 - trypsin activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence ISS]; GO:0007586 - digestion [Evidence IEA]; GO:0045785 - positive regulation of cell adhesion [Evidence ISS]; GO:0030307 - positive regulation of cell growth [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : trypsin 2; trypsinogen 20 product : protease, serine, 2 protein_id : NP_033456.1

name	Tcrb-V13 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:269846 MGI:98587
definition	codon_start : 1 exception : rearrangement required for product

name	Ephb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982461 CCDS:CCDS20051.1 GeneID:13848 MGI:1096338
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chicken eph/elk receptor-like protein product : Eph receptor B6 protein_id : NP_031706.2

name	Trpv6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28376639 CCDS:CCDS20052.1 GeneID:64177 MGI:1927259
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : osmosensitive transient receptor potential channel 3; epithelial calcium channel 2 product : transient receptor potential cation channel, subfamily V, member 6 protein_id : NP_071858.2

name	Trpv5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090239 CCDS:CCDS20053.1 GeneID:194352 MGI:2429764
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IDA] [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence NAS]; GO:0006816 - calcium ion transport [Evidence IDA] [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0051262 - protein tetramerization [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : epithelial calcium channel 1 product : transient receptor potential cation channel, subfamily V, member 5 protein_id : NP_001007573.1

name	1700034O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037451 CCDS:CCDS20054.1 GeneID:76606 MGI:1923856
definition	codon_start : 1 product : hypothetical protein LOC76606 protein_id : NP_083947.1

name	Kel (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71896655 CCDS:CCDS20055.1 GeneID:23925 MGI:1346053
definition	GO_function : GO:0004175 - endopeptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Kell protein; Kel blood group protein product : Kell blood group protein_id : NP_115929.2

name	Olfr459 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129497 CCDS:CCDS20056.1 GeneID:258569 MGI:3030293
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-5780974-5781915; olfactory receptor MOR120-1 product : olfactory receptor 459 protein_id : NP_666787.1

name	Pip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601068 GeneID:18716 MGI:102696
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : gross cystic disease fluid protein 15 product : prolactin induced protein protein_id : NP_032869.2

name	Sval2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14211544 CCDS:CCDS20057.1 GeneID:84543 MGI:1934254
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : SLP in the mammary gland; SVA-like protein in the mammary gland product : seminal vesicle antigen-like 2 protein_id : NP_115931.1

name	Sval1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14269570 CCDS:CCDS20058.1 GeneID:71578 MGI:1918828
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : SVA-like protein in the colon product : seminal vesicle antigen-like 1 protein_id : NP_082108.1

name	Sval3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56710338 CCDS:CCDS20059.1 GeneID:387564 MGI:3047714
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : seminal vesicle autoantigen like protein 3 product : seminal vesicle antigen-like 3 protein_id : NP_001003952.1

name	Sva (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678187 CCDS:CCDS20060.1 GeneID:20939 MGI:102785
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence TAS] codon_start : 1 exception : mismatches in translation product : seminal vesicle antigen protein_id : NP_033325.1

name	Tas2r139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044479 CCDS:CCDS20061.1 GeneID:353148 MGI:2681308
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : candidate taste receptor mt2r34 product : taste receptor, type 2, member 139 protein_id : NP_851792.1

name	Tas2r144 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824893 CCDS:CCDS20062.1 GeneID:387515 MGI:2681312
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 144 protein_id : NP_001001453.1

name	Gstk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313138 CCDS:CCDS20063.1 GeneID:76263 MGI:1923513
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030288 - periplasmic space (sensu Proteobacteria) [Evidence IEA] GO_function : GO:0004602 - glutathione peroxidase activity [Evidence IDA]; GO:0004364 - glutathione transferase activity [Evidence IDA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA] codon_start : 1 product : glutathione S-transferase class kappa protein_id : NP_083831.1

name	Tmem139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425120 GeneID:109218 MGI:1924444
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC109218 protein_id : NP_780617.1

name	Casp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680848 CCDS:CCDS20064.1 GeneID:12366 MGI:97295
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence ISS] [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 function : cysteine protease product : caspase 2 protein_id : NP_031636.1

name	Clcn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789048 GeneID:12723 MGI:88417
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : arrested development of righting response; chloride channel protein product : chloride channel 1 protein_id : NP_038519.1

name	6330503C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625815 GeneID:76156 MGI:1923406
definition	codon_start : 1 product : hypothetical protein LOC76156 protein_id : NP_083804.2

name	Zyx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756085 CCDS:CCDS20066.1 GeneID:22793 MGI:103072
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : zyxin protein_id : NP_035907.1

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 5 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 4 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 3 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 2 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 1 pseudo : _no_value

name	Tcrb-V8.2 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:21607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 4 Proteins standard_name : Tcrb-V8.2

name	Tcrb-V8.2 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:21607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 6 Proteins standard_name : Tcrb-V8.2

name	Tcrb-V13 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:269846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins standard_name : Tcrb-V13

name	(CDS detail)
type	STS
link
xref	UniSTS:235423
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159493
definition	standard_name : AI465370

name	(CDS detail)
type	STS
link
xref	UniSTS:220154
definition	standard_name : RH138067

name	(CDS detail)
type	STS
link
xref	UniSTS:164322
definition	standard_name : AI841796

name	(CDS detail)
type	STS
link
xref	UniSTS:235428
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207942
definition	standard_name : AU023319

name	(CDS detail)
type	STS
link
xref	UniSTS:494930
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485084
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492662
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492557
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142594
definition	standard_name : D6Mit382

name	(CDS detail)
type	STS
link
xref	UniSTS:207939
definition	standard_name : RH126673

name	(CDS detail)
type	STS
link
xref	UniSTS:141212
definition	standard_name : Cacnb3

name	(CDS detail)
type	STS
link
xref	UniSTS:224349
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165461
definition	standard_name : AV047902

name	(CDS detail)
type	STS
link
xref	UniSTS:165460
definition	standard_name : AV072249

name	(CDS detail)
type	STS
link
xref	UniSTS:144579
definition	standard_name : Tcrb

name	(CDS detail)
type	STS
link
xref	UniSTS:124905
definition	standard_name : L37871

name	(CDS detail)
type	STS
link
xref	UniSTS:130724
definition	standard_name : ND

name	(CDS detail)
type	STS
link
xref	UniSTS:130725
definition	standard_name : D6Mit182.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130863
definition	standard_name : D6Mit311

name	(CDS detail)
type	STS
link
xref	UniSTS:124936
definition	standard_name : M22605

name	(CDS detail)
type	STS
link
xref	UniSTS:144580
definition	standard_name : Tcrb-C

name	(CDS detail)
type	STS
link
xref	UniSTS:144578
definition	standard_name : Tcrb

name	(CDS detail)
type	STS
link
xref	UniSTS:116606
definition	standard_name : D6Mit117

name	(CDS detail)
type	STS
link
xref	UniSTS:495891
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:502658
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:266995
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:159494
definition	standard_name : L77867

name	(CDS detail)
type	STS
link
xref	UniSTS:207941
definition	standard_name : BB111090

name	(CDS detail)
type	STS
link
xref	UniSTS:125978
definition	standard_name : mHAa31g5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:226138
definition	standard_name : Kel

name	(CDS detail)
type	STS
link
xref	UniSTS:491665
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:123745
definition	standard_name : 26.MMHAP59FRA11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207940
definition	standard_name : BE630354

name	(CDS detail)
type	STS
link
xref	UniSTS:207938
definition	standard_name : BE627963

name	(CDS detail)
type	STS
link
xref	UniSTS:179365
definition	standard_name : AU046084

name	(CDS detail)
type	STS
link
xref	UniSTS:495716
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488647
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495460
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488670
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130818
definition	standard_name : D6Mit271

name	(CDS detail)
type	STS
link
xref	UniSTS:178669
definition	standard_name : AW260476

name	(CDS detail)
type	STS
link
xref	UniSTS:493102
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159495
definition	standard_name : Y13085

name	(CDS detail)
type	STS
link
xref	UniSTS:141230
definition	standard_name : Casp2

name	(CDS detail)
type	STS
link
xref	UniSTS:210786
definition	standard_name : RH127476

name	(CDS detail)
type	STS
link
xref	UniSTS:164323
definition	standard_name : AV277466

name	(CDS detail)
type	STS
link
xref	UniSTS:224737
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161999
definition	standard_name : RH125177

name	(CDS detail)
type	STS
link
xref	UniSTS:115356
definition	standard_name : D4Got51

name	LOC669661 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255057 GeneID:669661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_031169.1

clone name	MSMg01-456F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547N15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516E18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-236P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273L05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-280M07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397M16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-543I08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-433H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-545A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130F05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-217B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092N16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-157L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-070D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-545D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D10
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-248M09.b	B6Ng01-248M09.g
ACC	GA056766	GA056767
length	1,067	1,157
definition	B6Ng01-248M09.b	B6Ng01-248M09.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctgttccctaccaggtgtccctgaactctggctaccacttctgtg gaggttccctcatcaatgaccagtgggtggtgtctgcagctcactgctac aagtcgtaagtggtggtccctaatggtacagaattcaaatttggcctttc tgcagacacagtataagatcaggcaagaactaaggttgtaaagtaaacag cagtagtcagaagggaaagattaccaactaaaacatttttatgagtttgg gaagagtaagtatacagaataagaagccgttcacattcctaaacaatcaa aaataaattaatgatatacatattgaaggcaaggaaaattgactttagga taaaaagaaccaaattcgaagtcacaaaaagactatctcaaagactaata ctgtgttctaaactcagagttttcagtgaatgtcaacagtctgtaagcgt actaaaacattatcttttgactaatttcaccatatagagagaagtcagag ttagtttctataccagatagtatcagacctgaatacacatcagtttcagc cagtttattgagaaagtctaggaaaagaacctagaaagtaaattcatagc aaattggaagtagcaaagctacatggatcaagactatcttatcccaaatt tgactagacccatcagaataatagttcttaagaggaaaggatttaaggtg gtttacattttgcaaagagacaggacaaatgaagaaacaagaaagtatgt gtatgcaaaggggggagatgtagttttgaggagattcccacagcagtctt tcatgccaatcatatttttgctcccccccccccccccaccttttgaagca gagagtaatttgggtttcacaattgtagttgccacatcacaacttcttac tttctgttatattaggcaagtcctcttcccccattccagaatatatttca gcaaaaaagaagttcgatgacttcggagcttacttgggggttatgggagg agaagatcctcataacacttctcttcccaacagtccgccatccagtggag acttgggagagccaaca	gaattctataagactttcaaagaacgctaataccaatactttttgaacta ttccacaaaatagaaagagataaggccacagtcaccctcaaatataaatc acaaaagactcaacaaaacttcagtatgtttttttcttataaatattgat gcaaacatacttaataaattactcacaaactgaatcccaaacacatcaaa gacatcatctaccatgatcaactaagtttcatatcagggatgtaaggaag gttcaatttatgaaaattcaccaatgtggatcagtgggatccaggcatga aggaaccccacgcgaccagtggcactggttccttccagtctgggccagtg ccctaagcagaccttggatgcacactctgcagccagttccacaacaccca gaggaaactccactccaaagtgctctaacatgcccaggatcacagatcca gaagtgaggaggacacaacatctgtcctaacacatggagtaactgggacc aatgggatccagagatgcaagaaccctgcctgacctgtggcacaggttac ttccggtctggacaagtgccctgagcaaaccttgggcacgaactccgaag ccagttccacaataaccagaggaagctccactccactcccaggcgctcta acatgctcaggatcacaagagcttggccacaccaggatctcagggtccca gaggcagcttgactactaggagctctaacacacccaggatatcaggatca caggatcacagaataacagggtcacagagacagctggattctgaggagtt ctgaacacgataaggatcacaggaaagataggctccagtcagatatactg aaggacaggtagcactaaagataaccagatggcagaaggcaagcataaga acataagcaacagaaaccaagggttatttggtatcatcagaaccctattt cttccagcataggcaagtctggaatacaccaatcacatcagaaaaaacaa gatctggatctaaaatcacttctaatgatgaatgataacggatttagagg aattaaaataacctccctaaacaattacaggaaaacccaatgaacaggtg taggaatgaccaaacatcagatctaatcagtgaaaagcatcagaattcac caaatgg
quality values	Open. Hide. 58 26 24 26 58 54 42 42 47 58 58 58 49 54 52 62 31 26 62 62 54 62 62 62 62 54 62 49 41 62 47 62 62 56 37 37 46 54 56 54 47 44 59 62 62 62 62 62 62 49 62 59 59 62 62 62 62 62 37 38 62 62 62 62 62 62 62 62 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 49 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 52 58 54 58 58 43 54 58 54 58 58 58 54 58 58 58 54 58 58 58 58 58 58 52 52 54 54 52 58 58 58 58 58 54 58 58 58 54 53 52 54 45 30 52 58 58 58 54 42 58 58 58 52 58 58 58 52 54 52 58 58 42 58 58 38 38 58 49 58 53 41 58 58 51 52 58 58 58 49 51 50 58 43 45 58 53 46 58 54 43 45 40 54 51 37 58 51 46 58 58 42 52 50 49 58 52 58 58 52 58 58 46 58 50 49 58 58 32 51 53 39 58 51 39 39 51 49 53 53 53 50 50 42 52 58 49 27 58 53 51 36 38 46 41 39 47 50 36 39 40 58 50 38 58 52 52 41 58 50 43 51 38 50 50 37 50 52 53 52 51 34 33 37 36 14 50 26 58 39 39 58 28 14 58 50 37 37 49 54 31 49 32 18 54 30 25 27 32 53 54 54 47 40 53 40 54 46 53 53 34 31 31 32 49 54 32 32 32 54 42 53 40 44 43 32 54 33 24 40 37 47 45 51 54 42 33 45 32 44 54 53 53 42 33 37 40 31 25 44 35 40 49 49 54 54 40 49 24 31 20 52 37 42 24 23 49 52 42 33 42 15 33 32 17 31 31 31 23 52 47 27 34 29 33 40 31 24 21 32 37 53 31 35 27 33 32 32 12 6 20 30 21 23 37 25 8 51 51 46 30 32 30 31 32 40 33 40 42 51 32 40 24 26 27 43 51 46 18 17 31 31 31 51 46 31 16 10 40 11 8 11 11 20 6 27 29 23 31 22 9 40 6 9 46 31 27 46 26 15 11 18 11 9 7 5 21 18 29 27 25 24 14 12 6 6 16 16 31 21 23 28 20 18 9 8 11 25 11 18 11 22 9 46 16 17 21 21 23 6 10 10 25 26 15 23 23 17 9 21 30 11 21 32 30 30 37 17 10 6 20 25 32 31 18 25 13 13 32 22 5 38 22 19 18 31 22 15 44 13 31 24 12 9 6 28 33 44 16 22 6 7 32 10 21 16 20 18 28 20 29 33 18 8 5 5 7 8 11 5 8 11 8 11 32 22 30 21 48 39 48 30 12 7 6 4 20 36 8 15 5 5 7 8 4 9 17 33 27 33 32 23 18 5 5 6 8 6 12 13 21 8 14 11 10 6 14 12 27 20 10 3 4 4 5 4 17 11 5 7 4 5 10 23 8 30 10 4 4 8 23 7 25 6 4 8 20 15 3 4 6 27 6 6 15 11 7 3 5	Open. Hide. 62 47 56 47 62 62 62 56 62 62 62 62 47 51 59 46 38 20 28 34 50 62 62 43 59 62 59 59 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 49 62 62 62 62 62 62 62 56 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 49 62 34 62 62 62 62 62 62 62 62 54 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 62 62 54 62 62 62 62 62 62 49 54 52 62 62 62 62 62 62 62 62 62 42 58 45 49 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 54 58 58 58 58 58 45 54 58 58 58 54 58 58 58 58 45 39 54 52 58 58 58 58 58 34 39 58 58 51 52 54 33 36 40 58 58 58 58 58 58 39 39 58 58 58 58 49 58 58 58 46 41 58 49 58 53 45 58 50 52 51 47 32 58 58 51 49 40 58 58 51 58 45 58 49 48 52 58 58 37 40 50 49 50 50 58 42 58 58 58 58 46 39 50 46 41 37 33 49 50 41 53 58 58 52 50 50 39 58 51 52 58 53 54 46 58 51 30 54 41 34 50 52 52 53 51 39 52 49 43 44 50 50 51 36 29 53 53 24 58 49 42 33 43 51 52 39 23 50 53 50 41 35 50 53 54 39 44 28 42 54 53 45 52 45 39 39 25 44 50 23 34 54 50 54 52 42 37 54 41 37 45 35 53 37 51 31 53 28 50 54 45 53 42 37 53 31 52 37 51 40 42 28 54 28 33 45 53 37 28 6 54 54 32 40 52 32 33 33 33 8 54 34 32 40 40 34 33 39 29 32 45 35 39 32 52 21 42 32 14 32 40 43 39 23 52 34 26 33 18 18 40 38 32 32 28 11 24 40 52 42 11 12 14 30 26 31 32 45 33 23 46 31 32 31 31 42 31 31 33 24 35 35 32 41 21 28 51 26 7 18 29 31 31 33 42 21 33 31 26 30 32 32 20 43 31 26 19 31 29 22 35 14 31 33 16 37 22 21 15 28 31 8 8 16 31 23 33 24 14 18 13 15 26 27 31 28 31 22 18 16 35 46 38 26 32 25 14 24 20 31 42 19 32 29 31 33 32 23 9 37 27 27 37 26 31 35 23 14 26 33 26 27 20 23 18 46 31 31 27 31 31 38 32 13 48 29 19 22 11 11 19 20 36 29 34 42 28 36 42 29 27 10 33 30 25 38 8 17 23 29 33 24 33 18 20 8 36 14 26 15 34 11 25 11 31 11 22 21 24 31 37 43 31 17 19 7 25 10 48 12 37 11 17 28 48 21 16 19 28 31 28 31 27 32 12 8 14 18 25 4 11 13 11 25 14 40 13 20 17 31 9 16 9 7 9 14 11 6 6 6 17 18 13 27 17 23 5 11 21 6 5 5 6 13 7 14 29 9 10 21 17 8 20 20 20 20 10 12 12 16 40 38 40 9 11 15 17 7 7 15 24 10 9 6 27 7 15 19 8 32 21 12 14 21 10 14 17 15 9 10 5 8 10 18 23 20 21 12 12 16 17 12 10 4 5 2 3 9 21 14 28 13 3 3 3 3 3 10 8 3 5 6 28 13 5 6 12 21 9 4 4 11 20 16 24 5 26 8 5 5 6 5 10 7 7 4 18 17 10 25 25 8 7 11 6 7 13 11 5 15 3 6 4 14 6 4 2 1 3 5 12 5 3 5 13 5 4 4 14 17 14 5 2 8 22 5 11 2 5 12 3 5 3 1 1 3 2 14 6 15 28 28 23 5 18 9 3 3 3 5 7 3 4 4 7 4 5 7 9 28 20 6 24 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_41305506_41306553
seq2: B6Ng01-248M09.b_49_1115

seq1  GAATTCTGTTCCCTACCAGGTGTCCCTGAACTCTGGCTACCACTTCTGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTTCCCTACCAGGTGTCCCTGAACTCTGGCTACCACTTCTGTG  50

seq1  GAGGTTCCCTCATCAATGACCAGTGGGTGGTGTCTGCAGCTCACTGCTAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTTCCCTCATCAATGACCAGTGGGTGGTGTCTGCAGCTCACTGCTAC  100

seq1  AAGTCGTAAGTGGTGGTCCCTAATGGTACAGAATTCAAATTTGGCCTTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCGTAAGTGGTGGTCCCTAATGGTACAGAATTCAAATTTGGCCTTTC  150

seq1  TGCAGACACAGTATAAGATCAGGCAAGAACTAAGGTTGTAAAGTAAACAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGACACAGTATAAGATCAGGCAAGAACTAAGGTTGTAAAGTAAACAG  200

seq1  CAGTAGTCAGAAGGGAAAGATTACCAACTAAAACATTTTTATGAGTTTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAGTCAGAAGGGAAAGATTACCAACTAAAACATTTTTATGAGTTTGG  250

seq1  GAAGAGTAAGTATACAGAATAAGAAGCCGTTCACATTCCTAAACAATCAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGTAAGTATACAGAATAAGAAGCCGTTCACATTCCTAAACAATCAA  300

seq1  AAATAAATTAATGATATACATATTGAAGGCAAGGAAAATTGACTTTAGGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAATTAATGATATACATATTGAAGGCAAGGAAAATTGACTTTAGGA  350

seq1  TAAAAAGAACCAAATTCGAAGTCACAAAAAGACTATCTCAAAGACTAATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAAGAACCAAATTCGAAGTCACAAAAAGACTATCTCAAAGACTAATA  400

seq1  CTGTGTTCTAAACTCAGAGTTTTCAGTGAATGTCAACAGTCTGTAAGCGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGTTCTAAACTCAGAGTTTTCAGTGAATGTCAACAGTCTGTAAGCGT  450

seq1  ACTAAAACATTATCTTTTGACTAATTTCACCATATAGAGAGAAGTCAGAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAAAACATTATCTTTTGACTAATTTCACCATATAGAGAGAAGTCAGAG  500

seq1  TTAGTTTCTATACCAGATAGTATCAGACCTGAATACACATCAGTTTCAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTTTCTATACCAGATAGTATCAGACCTGAATACACATCAGTTTCAGC  550

seq1  CAGTTTATTGAGAAAGTCTAGGAAAAGAACCTAGAAAGTAAATTCATAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTTATTGAGAAAGTCTAGGAAAAGAACCTAGAAAGTAAATTCATAGC  600

seq1  AAATTGGAAGTAGCAAAGCTACATGGATCAAGACTATCTTATCCCAAATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTGGAAGTAGCAAAGCTACATGGATCAAGACTATCTTATCCCAAATT  650

seq1  TGACTAGACCCATCAGAATAATAGTTCTTAAGAGGAAAGGATTTAAGGTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTAGACCCATCAGAATAATAGTTCTTAAGAGGAAAGGATTTAAGGTG  700

seq1  GTTTACATTTTGCAAAGAGACAGGACAAATGAAGAAACAAGAAAGTATGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTACATTTTGCAAAGAGACAGGACAAATGAAGAAACAAGAAAGTATGT  750

seq1  GTATGCAAAGGGGGGAGATGTAGTTTTGAGGAGATTCCCACAGCAGTCTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGCAAAGGGGGGAGATGTAGTTTTGAGGAGATTCCCACAGCAGTCTT  800

seq1  TCATGCCAATCATA-TTTTGCT--CCCCCCCCCCCCCACCTTTTGAAGCA  847
      |||||||||||||| |||||||  ||||||||||||||||||||||||||
seq2  TCATGCCAATCATATTTTTGCTCCCCCCCCCCCCCCCACCTTTTGAAGCA  850

seq1  GAGAGTAA-TTGGGTTTCACAATTGTAGTTG-CACATCACAACT--CTAC  893
      |||||||| |||||||||||||||||||||| ||||||||||||   |||
seq2  GAGAGTAATTTGGGTTTCACAATTGTAGTTGCCACATCACAACTTCTTAC  900

seq1  -TTCTGTTATATTAGGCAAGTCCTCTT-CCCCATTCCAG-ATATA-TTCA  939
       |||||||||||||||||||||||||| ||||||||||| ||||| ||||
seq2  TTTCTGTTATATTAGGCAAGTCCTCTTCCCCCATTCCAGAATATATTTCA  950

seq1  GCAAAAA--GAGTTCGATGAC-TCGGAGC-TACTT-GGGGTTAATGGAGA  984
      |||||||   ||||||||||| ||||||| ||||| |||||||  |||| 
seq2  GCAAAAAAGAAGTTCGATGACTTCGGAGCTTACTTGGGGGTTATGGGAGG  1000

seq1  GGAAGATCCTCAT-ACACTTCTCTTCCCAACAG-CCG-CATCCAAGTGAG  1031
       |||||||||||| ||||||||||||||||||| ||| ||||||   |||
seq2  AGAAGATCCTCATAACACTTCTCTTCCCAACAGTCCGCCATCCAGTGGAG  1050

seq1  AC-TGGGAGAGCACAACA  1048
      || ||||||||| |||||
seq2  ACTTGGGAGAGC-CAACA  1067

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information