MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-255O05
Chromosome	6 (Build37)
Map Location	146,731,716 - 146,732,852
singlet/doublet	singlet
Overlap gene	LOC621842
Upstream gene	Rassf8, Bhlhb3, Sspn, Itpr2, 4933424B01Rik, Fgfr1op2, Tm7sf3, Surb7, EG626175, Stk38l
Downstream gene	Arntl2, 1700023A16Rik, Ppfibp1, 1700034J05Rik, 2210417D09Rik, Mrps35, EG545893, Klhdc5, EG665288, LOC100039641, Pthlh, EG622129, Ccdc91, LOC100039712, LOC100039727, LOC100039736
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rassf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71323 MGI:1918573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bhlhb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79362 MGI:1930704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sspn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16651 MGI:1353511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itpr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16439 MGI:99418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933424B01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71177 MGI:1918427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgfr1op2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67529 MGI:1914779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm7sf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67623 MGI:1914873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Surb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108098 MGI:1347064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626175 MGI:3648118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 760 ESTs, 5 Proteins

name	Stk38l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232533 MGI:1922250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 677 ESTs, 8 Proteins pseudo : _no_value

name	Arntl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272322 MGI:2684845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700023A16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69371 MGI:1916621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Ppfibp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67533 MGI:1914783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700034J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73344 MGI:1920594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 2 Proteins

name	2210417D09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66532 MGI:1913782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232536 MGI:2385255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545893 MGI:3645619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhdc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232539 MGI:2444786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665288 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665288 MGI:3649152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs

name	Pthlh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19227 MGI:97800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622129 MGI:3646376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Ccdc91 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67015 MGI:1914265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039712 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100039727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100039736 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rassf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892929 GeneID:71323 MGI:1918573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras association (RalGDS/AF-6) domain family 8 transcript_id : NM_027760.2

name	Bhlhb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13277377 GeneID:79362 MGI:1930704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic helix-loop-helix domain containing, class B3 transcript_id : NM_024469.1

name	Sspn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130092 GeneID:16651 MGI:1353511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sarcospan transcript_id : NM_010656.2

name	Itpr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592757 GeneID:16439 MGI:99418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-triphosphate receptor 2 transcript_id : NM_010586.1

name	Itpr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593031 GeneID:16439 MGI:99418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-triphosphate receptor 2 transcript_id : NM_019923.3

name	4933424B01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922585 GeneID:71177 MGI:1918427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933424B01 gene transcript_id : NM_138757.2

name	Fgfr1op2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601005 GeneID:67529 MGI:1914779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FGFR1 oncogene partner 2 transcript_id : NM_026218.2

name	Tm7sf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964707 GeneID:67623 MGI:1914873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 7 superfamily member 3 transcript_id : NM_026281.2

name	Surb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345819 GeneID:108098 MGI:1347064
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRB7 (suppressor of RNA polymerase B) homolog (S. cerevisiae) transcript_id : NM_025315.2

name	EG626175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256061 GeneID:626175 MGI:3648118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 760 ESTs, 5 Proteins product : predicted gene, EG626175 transcript_id : XM_893655.3

name	Stk38l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982109 GeneID:232533 MGI:1922250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 38 like transcript_id : NM_172734.2

name	Arntl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986632 GeneID:272322 MGI:2684845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor nuclear translocator-like 2 transcript_id : NM_172309.1

name	1700023A16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378337 GeneID:69371 MGI:1916621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : RIKEN cDNA 1700023A16 gene transcript_id : XM_132958.4

name	Ppfibp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274605 GeneID:67533 MGI:1914783
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PTPRF interacting protein, binding protein 1 (liprin beta 1) transcript_id : NM_026221.1

name	1700034J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378339 GeneID:73344 MGI:1920594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 2 Proteins product : RIKEN cDNA 1700034J05 gene transcript_id : XM_886330.2

name	2210417D09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909367 GeneID:66532 MGI:1913782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210417D09 gene transcript_id : NM_025620.2

name	Mrps35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704151 GeneID:232536 MGI:2385255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S35 transcript_id : NM_145573.1

name	EG545893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368323 GeneID:545893 MGI:3645619
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545893 transcript_id : NM_001034903.2

name	Klhdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486990 GeneID:232539 MGI:2444786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 5 transcript_id : NM_001081237.1

name	LOC100039641 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256049 GeneID:100039641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs product : hypothetical protein LOC100039641 transcript_id : XM_001473250.1

name	Pthlh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679538 GeneID:19227 MGI:97800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parathyroid hormone-like peptide transcript_id : NM_008970.1

name	Ccdc91 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980527 GeneID:67015 MGI:1914265
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 91 transcript_id : NM_025911.2

name	LOC100039712 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256052 GeneID:100039712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001473371.1

name	LOC100039727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256054 GeneID:100039727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039727 transcript_id : XM_001473389.1

name	LOC100039736 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256056 GeneID:100039736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100039736 transcript_id : XM_001473407.1

name	Rassf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23503231 CCDS:CCDS20696.1 GeneID:71323 MGI:1918573
definition	GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : carcinoma associated protein-like product : Ras association (RalGDS/AF-6) domain family 8 protein_id : NP_082036.1

name	Bhlhb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277378 CCDS:CCDS20697.1 GeneID:79362 MGI:1930704
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0017053 - transcriptional repressor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence TAS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence TAS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : bHLH transcriptional factor Dec2; basic helix-loop-helix domain containing, class B, 2-like; basic helix-loop-helix domain containing, class B, 3 product : basic helix-loop-helix domain containing, class B3 protein_id : NP_077789.1

name	Sspn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754476 CCDS:CCDS20698.1 GeneID:16651 MGI:1353511
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : Kras oncogene-associated product : sarcospan protein_id : NP_034786.1

name	Itpr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60592758 GeneID:16439 MGI:99418
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; inositol 1,4,5-triphosphate receptor 5; inositol trisphosphate receptor type 2 product : inositol 1,4,5-triphosphate receptor 2 isoform 2 protein_id : NP_034716.1

name	Itpr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593032 GeneID:16439 MGI:99418
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; inositol 1,4,5-triphosphate receptor 5; inositol trisphosphate receptor type 2 product : inositol 1,4,5-triphosphate receptor 2 isoform 1 protein_id : NP_064307.2

name	4933424B01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922586 GeneID:71177 MGI:1918427
definition	codon_start : 1 product : hypothetical protein LOC71177 protein_id : NP_620096.2

name	Fgfr1op2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385724 GeneID:67529 MGI:1914779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : FGFR1 oncogene partner 2 protein_id : NP_080494.1

name	Tm7sf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964708 CCDS:CCDS20699.1 GeneID:67623 MGI:1914873
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane 7 superfamily member 3 protein_id : NP_080557.2

name	Surb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384678 CCDS:CCDS20700.1 GeneID:108098 MGI:1347064
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 note : SRB7 product : SRB7 (supressor of RNA polymerase B) homolog protein_id : NP_079591.1

name	EG626175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83030529 GeneID:626175 MGI:3648118
definition	codon_start : 1 product : similar to ribosomal protein S26 protein_id : XP_898748.1

name	Stk38l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370078 GeneID:232533 MGI:1922250
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0051128 - regulation of cell organization and biogenesis [Evidence IDA] codon_start : 1 product : putative serine/threonine kinase NDR54 protein_id : NP_766322.1

name	Arntl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986633 CCDS:CCDS20702.1 GeneID:272322 MGI:2684845
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence ISS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : brain-muscle-ARNT-like protein 2 product : aryl hydrocarbon receptor nuclear translocator-like 2 protein_id : NP_758513.1

name	1700023A16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378338 GeneID:69371 MGI:1916621
definition	codon_start : 1 product : hypothetical protein LOC69371 protein_id : XP_132958.3

name	1700034J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83030504 GeneID:73344 MGI:1920594
definition	codon_start : 1 product : hypothetical protein LOC73344 protein_id : XP_891423.1

name	Ppfibp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49274606 GeneID:67533 MGI:1914783
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008907 - integrase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0015074 - DNA integration [Evidence IEA] codon_start : 1 product : PTPRF interacting protein, binding protein 1 (liprin beta 1) protein_id : NP_080497.1

name	2210417D09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385078 CCDS:CCDS20704.1 GeneID:66532 MGI:1913782
definition	codon_start : 1 product : 2210417D09Rik protein protein_id : NP_079896.1

name	Mrps35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704152 GeneID:232536 MGI:2385255
definition	GO_component : GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mitochondrial ribosomal protein S34 product : mitochondrial ribosomal protein S35 protein_id : NP_663548.1

name	EG545893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702266 CCDS:CCDS20705.1 GeneID:545893 MGI:3645619
definition	codon_start : 1 product : hypothetical protein LOC545893 protein_id : NP_001030075.1

name	Klhdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486991 GeneID:232539 MGI:2444786
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch domain containing 5 protein_id : NP_001074706.1

name	LOC100039641 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256050 GeneID:100039641
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473300.1

name	Pthlh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679539 GeneID:19227 MGI:97800
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005179 - hormone activity [Evidence TAS] GO_process : GO:0048286 - alveolus development [Evidence IMP]; GO:0030282 - bone mineralization [Evidence IMP]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence ISS]; GO:0007595 - lactation [Evidence IEA]; GO:0002076 - osteoblast development [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP]; GO:0043129 - surfactant homeostasis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : PTH-related; parathyroid hormone-related peptide; parathyroid hormone-related protein; PTH-related peptide; parathyroid hormone-like hormone product : parathyroid hormone-like peptide precursor protein_id : NP_032996.1

name	Ccdc91 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532950 CCDS:CCDS20707.1 GeneID:67015 MGI:1914265
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence IPI] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : GGA binding partner protein_id : NP_080187.2

name	LOC100039712 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256053 GeneID:100039712
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473421.1

name	LOC100039727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256055 GeneID:100039727
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473439.1

name	LOC100039736 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256057 GeneID:100039736
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473457.1

name	EG665288 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665288
definition	number : 1 pseudo : _no_value

name	EG665288 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665288
definition	number : 2 pseudo : _no_value

name	EG665288 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665288
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:235575
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179498
definition	standard_name : AW123240

name	(CDS detail)
type	STS
link
xref	UniSTS:261595
definition	standard_name : AI170756

name	(CDS detail)
type	STS
link
xref	UniSTS:130743
definition	standard_name : D6Mit200

name	(CDS detail)
type	STS
link
xref	UniSTS:273470
definition	standard_name : PMC85350P1

name	(CDS detail)
type	STS
link
xref	UniSTS:272428
definition	standard_name : PMC29083P2

name	(CDS detail)
type	STS
link
xref	UniSTS:219612
definition	standard_name : RH137524

name	(CDS detail)
type	STS
link
xref	UniSTS:498280
definition	standard_name : Sspn

name	(CDS detail)
type	STS
link
xref	UniSTS:159588
definition	standard_name : U02487

name	(CDS detail)
type	STS
link
xref	UniSTS:143723
definition	standard_name : Sspn

name	(CDS detail)
type	STS
link
xref	UniSTS:122743
definition	standard_name : 03.MMHAP54FRA9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179496
definition	standard_name : AI649341

name	(CDS detail)
type	STS
link
xref	UniSTS:163405
definition	standard_name : Z71173

name	(CDS detail)
type	STS
link
xref	UniSTS:208052
definition	standard_name : BB062653

name	(CDS detail)
type	STS
link
xref	UniSTS:143724
definition	standard_name : Sspn

name	(CDS detail)
type	STS
link
xref	UniSTS:144805
definition	standard_name : Y83m2c2

name	(CDS detail)
type	STS
link
xref	UniSTS:130926
definition	standard_name : D6Mit371

name	(CDS detail)
type	STS
link
xref	UniSTS:130844
definition	standard_name : D6Mit294

name	(CDS detail)
type	STS
link
xref	UniSTS:130845
definition	standard_name : D6Mit295

name	(CDS detail)
type	STS
link
xref	UniSTS:116332
definition	standard_name : D6Mit15

name	(CDS detail)
type	STS
link
xref	UniSTS:125182
definition	standard_name : MHAa52a5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123115
definition	standard_name : 12.MMHAP34FLD3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123218
definition	standard_name : 14.MMHAP57FLE2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130744
definition	standard_name : D6Mit201

name	(CDS detail)
type	STS
link
xref	UniSTS:130745
definition	standard_name : D6Mit201.2

name	(CDS detail)
type	STS
link
xref	UniSTS:159587
definition	standard_name : D19234

name	(CDS detail)
type	STS
link
xref	UniSTS:167501
definition	standard_name : D6Ertd782e

name	(CDS detail)
type	STS
link
xref	UniSTS:179497
definition	standard_name : AI449604

name	(CDS detail)
type	STS
link
xref	UniSTS:124334
definition	standard_name : 39.MMHAP76FLE6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:144804
definition	standard_name : Y78m6g9

name	(CDS detail)
type	STS
link
xref	UniSTS:186275
definition	standard_name : M-09923

name	(CDS detail)
type	STS
link
xref	UniSTS:179499
definition	standard_name : AW261454

name	(CDS detail)
type	STS
link
xref	UniSTS:179500
definition	standard_name : AW214454

name	(CDS detail)
type	STS
link
xref	UniSTS:224315
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130929
definition	standard_name : D6Mit373

name	(CDS detail)
type	STS
link
xref	UniSTS:212372
definition	standard_name : RH129064

name	(CDS detail)
type	STS
link
xref	UniSTS:235579
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159591
definition	standard_name : AI450355

name	(CDS detail)
type	STS
link
xref	UniSTS:208053
definition	standard_name : BB554217

name	(CDS detail)
type	STS
link
xref	UniSTS:119749
definition	standard_name : RH94501

name	(CDS detail)
type	STS
link
xref	UniSTS:272174
definition	standard_name : PMC229353P1

name	(CDS detail)
type	STS
link
xref	UniSTS:130808
definition	standard_name : D6Mit26

name	(CDS detail)
type	STS
link
xref	UniSTS:144810
definition	standard_name : Y97m1a3

name	(CDS detail)
type	STS
link
xref	UniSTS:130855
definition	standard_name : D6Mit304

name	(CDS detail)
type	STS
link
xref	UniSTS:144806
definition	standard_name : Y88m6a6

name	(CDS detail)
type	STS
link
xref	UniSTS:144807
definition	standard_name : Y91m8f11

name	(CDS detail)
type	STS
link
xref	UniSTS:235578
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179501
definition	standard_name : AW555238

name	(CDS detail)
type	STS
link
xref	UniSTS:159589
definition	standard_name : AU045683

name	(CDS detail)
type	STS
link
xref	UniSTS:159590
definition	standard_name : 32.MMHAP34FLC5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:122916
definition	standard_name : 08.MHAa92a8.seq

name	LOC621842 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256048 GeneID:621842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 677 ESTs, 8 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_031050.1

name	EG622129 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256051 GeneID:622129 MGI:3646376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : predicted gene, EG622129 transcript_id : XR_035211.1

clone name	MSMg01-412N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346D17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-335E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076I14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-059N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326E18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-255O05.b	B6Ng01-255O05.g
ACC	GA061986	GA061987
length	1,232	1,126
definition	B6Ng01-255O05.b	B6Ng01-255O05.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaggcccatacctaaacatgataaaagcaatctacagcaaacca gtagccaacatcaaagtaaatggagagaagctggaagcaatcccactaaa atcagggactagacaaggctgcccactttctccctacctttttaacatag tacttgaagtattagccagagcaattcgacaacaaaaggagatcaagggg atacaaattggaaaggaggaagtcaaaatatcactttttgcagatgatat gatagtatatataagtgaccctaaaaattccaccagagaactcctaaacc tgataaacagcttcggtgaagtagctggatataaaattaactcaaacaag tcaatggcctttctctacacaaagaataaacaggctgagaaagaaattag ggaaacaacacccttctcaatagtcacaaataatataaaatatctccgcg tgactctaactaaggaagtgaaagatctgtatgataaaaacttcaagtct ctgaagaaagaaattaaagaagatctcagaagatggaaagatctcccatg ctcatggattggcaggatcaacattgtaaaaatggctatcttgccaaaag caatctacagattcaatgcaatccccatcaaaattccaactcaattcttc aacgaattagaaggagcaatttgcaaattcatctggaataacaaaaaacc taggatagcaaaaactcttctcaaggataaaagaacctctggtggaatca ccatgcctgaactaaagctttactacagagcaattgtggtaaaaactgca tggtactggtatagagacagacaagtagaccaatggaatagaattgaaga cccagaaatgaacccacacacctatggtcacttgatcttcgacaagggag ctaaaaccatccagtggaagaaagacagcattttcaacaattggtgctgg cacaactgggttgttatcatgtagaagatgcgaatcgatccatacttatc tccttgtactaagtcaaatctaaatggatcaaagaacttcacataaaacc agagacactgaaactttatgaaggagaaagtgggaaagccttgagatttg ggcacagggaaaatcctgacgaacagcattgctgtggtctgtagatcaga atgacaatgggaacctaatgaattccaagtctgcaagcagcaaccgtcat agccaggactcccacggatttggaaaggatct	gaattcactgatcatcttgtgaaaacccacaccagagtctctgttcaggg gacccaggctccagctgtggctaccacataagggtttttatacaagaaaa ataaacgaattaagtctgctaaaaaaaaaaaagggaatataatggtaatt gcttaaatgttcttaaatatacatggcataaagaatactttgaggctttt gatcttaaattgtaagtcagaagtcgaaggtaagtagaatacacttagac aagtaatagaaacttatgttaattcaagtttgtagcctcccccagccttg aagcaggctgattcagaccttgctgccactgagaatgagaccacctgggg tggagccttcgacctagatggcacctgccactgctcttctccaagacagt tgctaccgctgagaggctgaacctgtcttcctgggatattcctgagatag ctgacaacctgtggacttggcgacctaatgctaacagctctgacagacta gtgctaacaacttagcaacaaagcatcaagaagcctggtgtggcagggga tgggctttataagcacagactcttagtaaacattgggccttgatcagaaa tctgtcttggtctcttctctcggggttctctcccatacagctctggcctc ccactcaggaacccagttagtgtggccacaggcagctacacaagttacat aaagagaatggggcacttgtacctatagagatagtaatctctagtaatta ctagagatagtaatggtggcacatgcctttaatcccagcacttgggaggc agaggcagacagatttctgagttcgaggccagcctggtctacagagtgag ttccaggacagccagggctacacagagaaactctgtctcaaaaaaaaaaa aaaaaaaagagagatagtaatctctgtagaagggaggatttaagtatact tacataaataaatgtttgagacttttgatcttaaattagacgtgaaaagc agtgatagggacttatctatcttcagaacagtagaaatttaggctggatc tcactataaaatcattggtgtaaggacaaaacagggaatagtgcaagacc ttattccacagataattgttagattg
quality values	Open. Hide. 58 31 22 38 62 31 18 33 62 62 62 62 47 23 62 62 62 62 62 62 62 62 47 33 62 62 59 62 62 62 62 62 44 51 34 28 32 50 51 43 51 59 62 59 62 62 62 62 59 59 62 54 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 59 62 62 59 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 54 62 56 62 62 59 62 62 62 62 56 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 52 54 39 58 58 58 58 58 58 54 54 58 58 58 58 54 54 58 58 58 58 58 54 58 58 58 42 41 58 58 58 58 58 54 58 42 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 49 58 52 58 54 58 58 58 42 41 47 58 58 58 53 58 51 58 58 58 58 51 58 49 58 45 38 58 53 39 58 58 58 54 52 51 58 58 58 38 58 51 58 51 50 58 58 37 48 58 50 37 20 58 58 58 52 50 50 54 58 48 50 50 47 39 58 53 50 58 49 47 58 43 32 58 52 32 58 50 21 42 28 32 50 58 58 44 48 37 58 51 51 51 47 39 51 51 51 58 49 49 50 53 40 49 50 32 58 58 54 58 41 29 58 50 53 32 58 35 23 50 50 52 30 58 58 58 41 41 53 53 52 51 39 52 45 31 39 40 54 35 37 27 54 54 54 39 54 26 21 33 41 39 37 42 54 39 51 34 49 32 40 37 31 44 42 30 37 42 53 42 40 44 47 40 45 33 32 54 44 31 38 40 54 42 24 33 37 38 47 38 32 53 24 33 27 32 31 54 47 29 46 46 23 31 53 53 53 32 32 34 45 32 29 36 37 51 29 31 32 30 41 39 32 37 45 35 34 45 33 30 26 31 43 42 31 31 51 36 36 31 23 30 23 42 31 38 25 46 31 46 38 42 36 31 51 31 35 38 30 30 43 23 31 12 37 36 31 32 46 48 32 38 30 28 33 32 46 33 18 42 32 42 31 35 32 32 25 31 30 42 30 32 24 31 28 31 31 21 36 32 31 33 34 25 37 28 33 19 33 46 15 24 15 31 38 31 33 29 31 25 24 23 32 27 31 21 25 30 27 28 14 27 6 31 48 31 14 29 21 24 31 27 23 31 47 47 22 31 24 21 18 26 16 29 20 22 24 14 31 25 32 26 38 28 24 31 11 24 26 26 18 47 13 25 12 31 14 14 16 30 20 15 27 32 22 32 24 32 32 19 33 11 30 19 13 28 19 32 31 28 28 34 15 26 19 29 19 17 29 27 17 15 15 31 20 15 20 7 15 22 21 32 31 16 7 4 5 15 19 34 9 13 13 24 21 40 14 20 21 20 14 27 9 11 29 20 20 18 19 14 21 21 10 10 20 6 10 9 28 19 17 5 8 8 10 28 7 11 11 6 23 24 20 10 38 14 10 16 32 8 5 4 3 5 8 17 16 16 6 11 40 15 10 6 8 11 5 2 3 14 8 6 14 10 16 10 13 6 8 5 10 18 9 28 11 11 6 6 3 4 26 6 8 29 30 11 3 3 7 6 8 22 6 4 12 25 5 6 8 5 11 7 8 12 5 6 4 5 5 6 6 13 7 6 12 19 7 22 10 6 4 4 3 3 2 6 6 4 3 3 5 8 12 17 6 7 16 11 16 16 8 5 6 8 17 5 4 2 2 3 7 3 3 1 3 10 6 4 6 12 3 3 1 4 22 6 12 4 5 6 9 11 16 14 4 4 4 3 2 4 10 17 6 18 18 4 9 7 4 4 16 5 7 8 9 19 11 21 13 9 13 5 1 1 2	Open. Hide. 62 59 56 59 62 59 34 59 62 62 21 39 36 17 25 27 27 43 49 48 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 49 62 62 59 56 43 45 35 48 40 22 48 56 54 59 59 59 62 62 59 62 62 62 62 62 59 54 54 56 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 51 56 62 56 59 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 50 54 54 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 46 46 62 59 59 62 56 62 59 59 62 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 49 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 47 54 56 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 58 58 54 58 54 54 58 54 58 58 58 58 58 58 58 54 58 58 58 58 54 58 47 58 58 58 54 58 58 58 54 49 54 54 58 39 49 49 41 58 58 58 58 58 58 58 54 53 46 58 54 58 54 54 58 50 58 54 58 54 58 49 58 49 54 54 58 58 50 50 51 51 51 49 58 50 58 58 41 46 42 58 51 54 42 58 58 51 52 54 58 58 52 51 58 51 45 42 49 53 51 54 58 49 51 50 51 51 58 58 58 58 58 46 51 50 53 47 33 41 58 58 39 54 43 58 52 58 54 58 49 58 41 32 32 46 50 53 44 51 39 41 47 52 41 32 58 51 30 39 39 43 50 41 51 39 39 52 53 58 41 54 50 40 35 21 51 32 39 58 52 52 39 51 51 39 53 25 51 32 51 51 54 31 32 52 32 51 53 54 49 41 51 45 53 34 33 54 36 28 42 31 38 35 33 32 52 33 27 38 44 45 42 54 40 53 54 52 41 45 52 51 37 51 33 37 45 37 47 38 42 40 37 41 32 52 53 33 52 32 32 51 52 53 53 31 34 53 33 40 32 31 53 53 31 46 33 29 27 45 33 32 36 32 45 34 49 34 32 29 39 34 51 40 31 36 32 31 37 42 29 30 46 30 32 17 36 21 36 27 46 6 33 25 29 29 41 31 30 23 32 25 51 38 34 31 31 46 18 46 20 31 18 37 30 42 18 25 17 32 31 43 31 46 29 34 43 32 27 29 14 14 26 18 29 34 36 32 43 38 21 31 17 25 27 38 21 28 31 31 29 9 10 46 37 26 30 26 27 13 30 22 30 44 19 32 31 13 6 5 32 22 30 32 21 14 23 27 44 44 43 43 44 44 44 48 44 44 47 44 48 48 44 44 44 33 11 32 13 30 19 34 19 21 22 25 25 19 33 32 24 30 24 22 7 6 10 28 18 15 47 18 32 28 34 34 12 31 23 8 14 29 19 15 24 28 22 13 17 21 20 9 22 11 47 20 22 23 43 18 19 37 16 48 24 16 23 14 23 10 18 34 34 21 19 19 10 10 9 26 14 34 16 17 23 18 12 26 20 13 34 10 11 47 40 21 21 28 6 12 7 25 16 16 24 22 34 8 6 3 4 7 25 6 9 10 13 16 20 11 8 12 16 13 21 18 7 8 11 19 19 13 27 38 17 5 25 13 6 2 2 3 2 5 12 18 8 6 10 13 10 11 11 6 3 3 16 29 7 3 1 3 2 2 6 6 7 10 10 13 15 9 6 17 5 2 18 9 4 5 4 17 10 4 5 6 7 7 4 5 3 1 3 10 5 22 5 5 18 7 4 4 4 24 7 15 6 5 12 11 7 11 5 4 6 4 3 3 2 3 11 6 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_146731716_146732852
seq2: B6Ng01-255O05.g_69_1194

seq1  GAATTCACTGATCATCTTGTGAAAACCCACACCAGAGTCTCTGTTCAGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTGATCATCTTGTGAAAACCCACACCAGAGTCTCTGTTCAGGG  50

seq1  GACCCAGGCTCCAGCTGTGGCTACCACATAAGGGTTTTTATACAAGAAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCAGGCTCCAGCTGTGGCTACCACATAAGGGTTTTTATACAAGAAAA  100

seq1  ATAAACGAATTAAGTCTGCTAAAAAAAAAAAAGGGAATATAATGGTAATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAACGAATTAAGTCTGCTAAAAAAAAAAAAGGGAATATAATGGTAATT  150

seq1  GCTTAAATGTTCTTAAATATACATGGCATAAAGAATACTTTGAGGCTTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTAAATGTTCTTAAATATACATGGCATAAAGAATACTTTGAGGCTTTT  200

seq1  GATCTTAAATTGTAAGTCAGAAGTCGAAGGTAAGTAGAATACACTTAGAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTTAAATTGTAAGTCAGAAGTCGAAGGTAAGTAGAATACACTTAGAC  250

seq1  AAGTAATAGAAACTTATGTTAATTCAAGTTTGTAGCCTCCCCCAGCCTTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAATAGAAACTTATGTTAATTCAAGTTTGTAGCCTCCCCCAGCCTTG  300

seq1  AAGCAGGCTGATTCAGACCTTGCTGCCACTGAGAATGAGACCACCTGGGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGGCTGATTCAGACCTTGCTGCCACTGAGAATGAGACCACCTGGGG  350

seq1  TGGAGCCTTCGACCTAGATGGCACCTGCCACTGCTCTTCTCCAAGACAGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGCCTTCGACCTAGATGGCACCTGCCACTGCTCTTCTCCAAGACAGT  400

seq1  TGCTACCGCTGAGAGGCTGAACCTGTCTTCCTGGGATATTCCTGAGATAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTACCGCTGAGAGGCTGAACCTGTCTTCCTGGGATATTCCTGAGATAG  450

seq1  CTGACAACCTGTGGACTTGGCGACCTAATGCTAACAGCTCTGACAGACTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACAACCTGTGGACTTGGCGACCTAATGCTAACAGCTCTGACAGACTA  500

seq1  GTGCTAACAACTTAGCAACAAAGCATCAAGAAGCCTGGTGTGGCAGGGGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTAACAACTTAGCAACAAAGCATCAAGAAGCCTGGTGTGGCAGGGGA  550

seq1  TGGGCTTTATAAGCACAGACTCTTAGTAAACATTGGGCCTTGATCAGAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTTTATAAGCACAGACTCTTAGTAAACATTGGGCCTTGATCAGAAA  600

seq1  TCTGTCTTGGTCTCTTCTCTCGGGGTTCTCTCCCATACAGCTCTGGCCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCTTGGTCTCTTCTCTCGGGGTTCTCTCCCATACAGCTCTGGCCTC  650

seq1  CCACTCAGGAACCCAGTTAGTGTGGCCACAGGCAGCTACACAAGTTACAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTCAGGAACCCAGTTAGTGTGGCCACAGGCAGCTACACAAGTTACAT  700

seq1  AAAGAGAATGGGGCACTTGTACCTATAGAGATAGTAATCTCTAGTAATTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAGAATGGGGCACTTGTACCTATAGAGATAGTAATCTCTAGTAATTA  750

seq1  CTAGAGATAGTAATGGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGAGATAGTAATGGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGC  800

seq1  AGAGGCAGACAGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCAGACAGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAG  850

seq1  TTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAAAAAAA  900
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TTCCAGGACAGCCAGGGCTACACAGAGAAACTCTGTCTCAAAAAAAAAAA  900

seq1  AAAAAAAAGAGAGATAGTAATCTCTGTAGAAGGGAGGATTTAAGTATACT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAGAGAGATAGTAATCTCTGTAGAAGGGAGGATTTAAGTATACT  950

seq1  TACATAAATAAATGTTTGAGACTTTTGATCTTAAATTAGACGTTGAAAAG  1000
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  TACATAAATAAATGTTTGAGACTTTTGATCTTAAATTAGACG-TGAAAAG  999

seq1  CAGGTGATAGGGAACCTAATCTATC-TCAG-ACAGTAGAAATTTAGGCCT  1048
      || ||||||||||  || ||||||| |||| |||||||||||||||| ||
seq2  CA-GTGATAGGGA--CTTATCTATCTTCAGAACAGTAGAAATTTAGG-CT  1045

seq1  TGATCTCACTATTAAAAATTAATTGTGTAAGAACAAAACAGGAGATAGTG  1098
       |||||||||||  ||||| | | ||||||| ||||||||||  ||||||
seq2  GGATCTCACTAT--AAAATCATTGGTGTAAGGACAAAACAGGGAATAGTG  1093

seq1  GAAGAACATTATCCCAACAGATAATATTTGTTTAGATTG  1137
       ||| || |||| || ||||||||   ||| ||||||||
seq2  CAAG-ACCTTATTCC-ACAGATAA---TTG-TTAGATTG  1126

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information