MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-275L10
Chromosome	6 (Build37)
Map Location	86,458,261 - 86,614,750
singlet/doublet	doublet
Overlap gene	Pcbp1, Asprv1, Mxd1
Upstream gene	Egr4, Alms1, LOC100043497, EG665134, LOC100043493, Cml3, LOC623273, Cml5, Cml4, LOC100043504, LOC100043508, Cml2, LOC665177, 1700019G17Rik, Cml1, Tprkb, EG434057, LOC665213, Dusp11, Figla, Add2, Tgfa, LOC665233, LOC100043094, LOC100043527, 2010309E21Rik, Snrpg, Pcyox1, Tia1, C87436, 2310040G24Rik
Downstream gene	2610209M04Rik, Gmcl1, Anxa4, 2610306M01Rik, Aak1, LOC100043555, Nfu1, Gfpt1, D6Ertd527e, Antxr1, Gkn1, Gkn2, 1190003M12Rik, Bmp10, Arhgap25, Prokr1, 2010301N04Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Egr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alms1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236266 MGI:1934606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 11 ESTs, 16 Proteins

name	EG665134 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665134 MGI:3646394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein

name	LOC100043493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein

name	Cml3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93674 MGI:2136449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC623273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins

name	Cml5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69049 MGI:1916299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cml4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68396 MGI:1915646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100043508 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 235 ESTs, 5 Proteins

name	Cml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93673 MGI:2136446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700019G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75541 MGI:1922791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66116 MGI:1913366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tprkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69786 MGI:1917036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434057 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434057 MGI:3644831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 17 Proteins

name	LOC665213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Dusp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72102 MGI:1919352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Figla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26910 MGI:1349421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Add2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11519 MGI:87919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21802 MGI:98724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 17 Proteins pseudo : _no_value

name	LOC100043094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 500 ESTs, 2 Proteins

name	2010309E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66488 MGI:1913738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68011 MGI:1915261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcyox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66881 MGI:1914131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tia1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21841 MGI:107914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232196 MGI:2141787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310040G24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381792 MGI:1916897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs

name	Pcbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23983 MGI:1345635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asprv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67855 MGI:1915105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17119 MGI:96908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610209M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66618 MGI:1913868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23885 MGI:1345156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11746 MGI:88030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610306M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67170 MGI:1914420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 25 ESTs

name	Aak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269774 MGI:1098687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins

name	Nfu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Ertd527e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs

name	Antxr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69538 MGI:1916788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gkn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66283 MGI:1913533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gkn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66284 MGI:1913534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190003M12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68888 MGI:1916138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12154 MGI:1338820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Prokr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58182 MGI:1929676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010301N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72103 MGI:1919353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130510 GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early growth response 4 transcript_id : NM_020596.2

name	Alms1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644592 GeneID:236266 MGI:1934606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Alstrom syndrome 1 homolog (human) transcript_id : NM_145223.1

name	LOC100043497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255302 GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 16 Proteins product : similar to camello-like 3, transcript variant 2 transcript_id : XM_001480038.1

name	LOC100043497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255300 GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 16 Proteins product : similar to camello-like 3, transcript variant 1 transcript_id : XM_001480031.1

name	EG665134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255224 GeneID:665134 MGI:3646394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : predicted gene, EG665134 transcript_id : XM_974788.2

name	LOC100043493 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255296 GeneID:100043493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein product : similar to mKIAA0328 protein transcript_id : XM_001480026.1

name	Cml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365388 GeneID:93674 MGI:2136449
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 3 transcript_id : NM_001037842.2

name	Cml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716390 GeneID:93674 MGI:2136449
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 3 transcript_id : NM_053097.1

name	LOC623273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255225 GeneID:623273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins product : similar to Almstrom syndrome 1 protein transcript_id : XM_887722.3

name	Cml5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956197 GeneID:69049 MGI:1916299
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 5 transcript_id : NM_023493.1

name	Cml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980866 GeneID:68396 MGI:1915646
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 4 transcript_id : NM_023455.2

name	LOC100043504 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255308 GeneID:100043504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100043504 transcript_id : XM_001480063.1

name	LOC100043508 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255312 GeneID:100043508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 235 ESTs, 5 Proteins product : similar to Sid3177p transcript_id : XM_001480069.1

name	Cml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865962 GeneID:93673 MGI:2136446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 2 transcript_id : NM_053096.3

name	1700019G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254166 GeneID:75541 MGI:1922791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700019G17 gene transcript_id : NM_029331.2

name	Cml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963542 GeneID:66116 MGI:1913366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 1 transcript_id : NM_023160.1

name	Tprkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341154 GeneID:69786 MGI:1917036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tp53rk binding protein transcript_id : NM_176842.2

name	EG434057 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377979 GeneID:434057 MGI:3644831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 17 Proteins product : predicted gene, EG434057 transcript_id : XM_485799.3

name	Dusp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519172 GeneID:72102 MGI:1919352
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) transcript_id : NM_028099.2

name	Figla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753875 GeneID:26910 MGI:1349421
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folliculogenesis specific basic helix-loop-helix transcript_id : NM_012013.1

name	Add2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349159 GeneID:11519 MGI:87919
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adducin 2 (beta) transcript_id : NM_013458.3

name	Tgfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130077 GeneID:21802 MGI:98724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor alpha transcript_id : NM_031199.2

name	LOC100043094 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255227 GeneID:100043094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100043094 transcript_id : XM_001479475.1

name	LOC100043527 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255323 GeneID:100043527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 500 ESTs, 2 Proteins product : similar to ribosomal protein S28 transcript_id : XM_001480106.1

name	2010309E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981258 GeneID:66488 MGI:1913738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010309E21 gene transcript_id : NM_025591.2

name	Snrpg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378958 GeneID:68011 MGI:1915261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide G transcript_id : NM_026506.2

name	Pcyox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981175 GeneID:66881 MGI:1914131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prenylcysteine oxidase 1 transcript_id : NM_025823.3

name	Tia1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750236 GeneID:21841 MGI:107914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytotoxic granule-associated RNA binding protein 1 transcript_id : NM_011585.3

name	C87436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384996 GeneID:232196 MGI:2141787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C87436 transcript_id : NM_146170.3

name	2310040G24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255327 GeneID:381792 MGI:1916897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs product : RIKEN cDNA 2310040G24 gene transcript_id : XM_001480154.1

name	Pcbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271536 GeneID:23983 MGI:1345635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 1 transcript_id : NM_011865.3

name	Asprv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502129 GeneID:67855 MGI:1915105
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartic peptidase, retroviral-like 1 transcript_id : NM_026414.2

name	Mxd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370244 GeneID:17119 MGI:96908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX dimerization protein 1 transcript_id : NM_010751.2

name	2610209M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802219 GeneID:66618 MGI:1913868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610209M04 gene transcript_id : NM_025665.2

name	Gmcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981389 GeneID:23885 MGI:1345156
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-less homolog 1 (Drosophila) transcript_id : NM_011818.2

name	Anxa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304888 GeneID:11746 MGI:88030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A4 transcript_id : NM_013471.1

name	2610306M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255229 GeneID:67170 MGI:1914420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 25 ESTs product : RIKEN cDNA 2610306M01 gene transcript_id : XM_001479511.1

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046263 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_001040106.2

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046243 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_177762.6

name	LOC100043555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255329 GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins product : similar to Aak1 protein transcript_id : XM_001480194.1

name	Nfu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130523 GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) transcript_id : NM_020045.2

name	Gfpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980779 GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine fructose-6-phosphate transaminase 1 transcript_id : NM_013528.2

name	D6Ertd527e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377982 GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs product : DNA segment, Chr 6, ERATO Doi 527, expressed transcript_id : XM_489144.3

name	Antxr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971258 GeneID:69538 MGI:1916788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anthrax toxin receptor 1 transcript_id : NM_054041.2

name	Gkn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384881 GeneID:66283 MGI:1913533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrokine 1 transcript_id : NM_025466.1

name	Gkn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384883 GeneID:66284 MGI:1913534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrokine 2 transcript_id : NM_025467.1

name	1190003M12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326172 GeneID:68888 MGI:1916138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190003M12 gene transcript_id : NM_026860.1

name	Bmp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857762 GeneID:12154 MGI:1338820
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 10 transcript_id : NM_009756.1

name	Arhgap25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582810 GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 25 transcript_id : NM_001037727.1

name	Arhgap25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582812 GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 25 transcript_id : NM_175476.3

name	Prokr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254342 GeneID:58182 MGI:1929676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prokineticin receptor 1 transcript_id : NM_021381.3

name	2010301N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361671 GeneID:72103 MGI:1919353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010301N04 gene transcript_id : NM_024251.3

name	Egr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181102 CCDS:CCDS20297.1 GeneID:13656 MGI:99252
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : early growth response 4 protein_id : NP_065621.1

name	Alms1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644593 CCDS:CCDS20298.1 GeneID:236266 MGI:1934606
definition	GO_component : GO:0005813 - centrosome [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001678 - cell glucose homeostasis [Evidence ISS]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IMP]; GO:0045598 - regulation of fat cell differentiation [Evidence IMP]; GO:0046548 - retinal rod cell development [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 exception : mismatches in translation product : Alstrom syndrome 1 protein_id : NP_660258.1

name	LOC100043497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255301 GeneID:100043497
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480081.1

name	LOC100043497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255303 GeneID:100043497
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480088.1

name	EG665134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377971 GeneID:665134 MGI:3646394
definition	codon_start : 1 product : similar to Almstrom syndrome 1 protein protein_id : XP_979882.1

name	LOC100043493 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255297 GeneID:100043493
definition	codon_start : 1 product : similar to mKIAA0328 protein protein_id : XP_001480076.1

name	Cml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745106 CCDS:CCDS20299.1 GeneID:93674 MGI:2136449
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : camello-like 3 isoform 1 protein_id : NP_001032931.1

name	Cml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716391 GeneID:93674 MGI:2136449
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : isoform 2 is encoded by transcript variant 2 product : camello-like 3 isoform 2 protein_id : NP_444327.1

name	LOC623273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255226 GeneID:623273
definition	codon_start : 1 product : similar to Almstrom syndrome 1 protein protein_id : XP_892815.2

name	Cml5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956198 CCDS:CCDS20300.1 GeneID:69049 MGI:1916299
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 exception : mismatches in translation product : camello-like 5 protein_id : NP_075982.1

name	Cml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963681 CCDS:CCDS20301.1 GeneID:68396 MGI:1915646
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005715 - late recombination nodule [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : putative N-acetyltransferase Camello 4 protein_id : NP_075944.1

name	LOC100043504 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255309 GeneID:100043504
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480113.1

name	LOC100043508 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255313 GeneID:100043508
definition	codon_start : 1 product : similar to Sid3177p protein_id : XP_001480119.1

name	Cml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542409 CCDS:CCDS20302.1 GeneID:93673 MGI:2136446
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : camello-like 2 protein_id : NP_444326.2

name	1700019G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254167 GeneID:75541 MGI:1922791
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75541 protein_id : NP_083607.2

name	Cml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963543 CCDS:CCDS20304.1 GeneID:66116 MGI:1913366
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : putative N-acetyltransferase Camello 1 protein_id : NP_075649.1

name	Tprkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849893 CCDS:CCDS20305.1 GeneID:69786 MGI:1917036
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Prpk (p53-related protein kinase)-binding protein protein_id : NP_789812.1

name	EG434057 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029409 GeneID:434057 MGI:3644831
definition	codon_start : 1 product : similar to Camello-like 1 protein_id : XP_485799.3

name	Dusp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519173 CCDS:CCDS20306.1 GeneID:72102 MGI:1919352
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) protein_id : NP_082375.2

name	Figla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753876 CCDS:CCDS20307.1 GeneID:26910 MGI:1349421
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : involved in coordinate expression of the zona pellucida genes note : FIG alpha product : factor in the germline alpha protein_id : NP_036143.1

name	Add2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560504 CCDS:CCDS20308.1 GeneID:11519 MGI:87919
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IDA] GO_process : GO:0030097 - hemopoiesis [Evidence IMP] codon_start : 1 note : snoRNA MBII-396 product : adducin 2 (beta) protein_id : NP_038486.2

name	Tgfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654266 GeneID:21802 MGI:98724
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001948 - glycoprotein binding [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : waved 1; transforming growth factor-alpha product : transforming growth factor alpha protein_id : NP_112476.1

name	LOC100043094 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255228 GeneID:100043094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479525.1

name	LOC100043527 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255324 GeneID:100043527
definition	codon_start : 1 product : similar to ribosomal protein S28 protein_id : XP_001480156.1

name	2010309E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385042 CCDS:CCDS20309.1 GeneID:66488 MGI:1913738
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : hypothetical protein LOC66488 protein_id : NP_079867.1

name	Snrpg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385994 GeneID:68011 MGI:1915261
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0030532 - small nuclear ribonucleoprotein complex [Evidence ISS]; GO:0005681 - spliceosome complex [Evidence ISS] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0008380 - RNA splicing [Evidence ISS]; GO:0000245 - spliceosome assembly [Evidence ISS] codon_start : 1 product : small nuclear ribonucleoprotein polypeptide G protein_id : NP_080782.1

name	Pcyox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385294 CCDS:CCDS20311.1 GeneID:66881 MGI:1914131
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0001735 - prenylcysteine oxidase activity [Evidence IMP] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0030328 - prenylcysteine catabolism [Evidence IMP] codon_start : 1 note : prenylcysteine lyase product : prenylcysteine oxidase 1 protein_id : NP_080099.1

name	Tia1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755783 CCDS:CCDS20312.1 GeneID:21841 MGI:107914
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0017091 - AU-specific RNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042036 - negative regulation of cytokine biosynthesis [Evidence IMP]; GO:0016478 - negative regulation of translation [Evidence IMP] codon_start : 1 note : cytotoxic granule-associated RNA-binding protein 1 product : cytotoxic granule-associated RNA binding protein 1 protein_id : NP_035715.1

name	C87436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30911109 CCDS:CCDS20313.1 GeneID:232196 MGI:2141787
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC232196 protein_id : NP_666282.2

name	2310040G24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255328 GeneID:381792 MGI:1916897
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480204.1

name	Pcbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754994 CCDS:CCDS20314.1 GeneID:23983 MGI:1345635
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence TAS]; GO:0008494 - translation activator activity [Evidence TAS] GO_process : GO:0006397 - mRNA processing [Evidence TAS] codon_start : 1 note : poly(rC)-binding protein 1; hnRNP E1 product : poly(rC) binding protein 1 protein_id : NP_035995.1

name	Asprv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130502130 GeneID:67855 MGI:1915105
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : TPA-induced aspartic proteinase-like; skin-specific retroviral-like aspartic protease product : skin aspartic protease protein_id : NP_080690.2

name	Mxd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754604 GeneID:17119 MGI:96908
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Max dimerization protein protein_id : NP_034881.1

name	2610209M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228990 CCDS:CCDS20315.1 GeneID:66618 MGI:1913868
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : putative nucleic acid binding protein RY-1 protein_id : NP_079941.1

name	Gmcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981390 CCDS:CCDS20316.1 GeneID:23885 MGI:1345156
definition	GO_component : GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence TAS] codon_start : 1 exception : mismatches in translation product : germ cell-less protein_id : NP_035948.2

name	Anxa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304889 GeneID:11746 MGI:88030
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA] GO_process : GO:0001822 - kidney development [Evidence ISS] codon_start : 1 exception : mismatches in translation note : annexin IV product : annexin A4 protein_id : NP_038499.1

name	2610306M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255230 GeneID:67170 MGI:1914420
definition	codon_start : 1 product : hypothetical protein LOC67170 protein_id : XP_001479561.1

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91992157 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : AP2 associated kinase 1 isoform 1 protein_id : NP_001035195.1

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73695877 CCDS:CCDS20317.1 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : AP2 associated kinase 1 isoform 2 protein_id : NP_808430.2

name	LOC100043555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255330 GeneID:100043555
definition	codon_start : 1 product : similar to Aak1 protein protein_id : XP_001480244.1

name	Nfu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910264 GeneID:56748 MGI:1913290
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : HIRA-interacting protein 5 product : histone cell cycle regulation defective interacting protein 5 protein_id : NP_064429.1

name	Gfpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305085 GeneID:14583 MGI:95698
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004360 - glutamine-fructose-6-phosphate transaminase (isomerizing) activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutamine:fructose-6-phosphate amidotransferase 1 product : glutamine fructose-6-phosphate transaminase 1 protein_id : NP_038556.1

name	D6Ertd527e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029415 GeneID:52372 MGI:1261919
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489144.2

name	Antxr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189436 CCDS:CCDS20318.1 GeneID:69538 MGI:1916788
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : tumor endothelial marker 8 product : anthrax toxin receptor 1 protein_id : NP_473382.1

name	Gkn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384882 CCDS:CCDS20319.1 GeneID:66283 MGI:1913533
definition	GO_component : GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : foveolin product : gastrokine 1 protein_id : NP_079742.1

name	Gkn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384884 GeneID:66284 MGI:1913534
definition	codon_start : 1 product : blottin protein_id : NP_079743.1

name	1190003M12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326173 CCDS:CCDS20320.1 GeneID:68888 MGI:1916138
definition	codon_start : 1 product : hypothetical protein LOC68888 protein_id : NP_081136.1

name	Bmp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857763 GeneID:12154 MGI:1338820
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] [Evidence IC] GO_function : GO:0005125 - cytokine activity [Evidence IC] [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IC] [Evidence IEA] GO_process : GO:0010002 - cardioblast differentiation [Evidence IC]; GO:0007267 - cell-cell signaling [Evidence IC]; GO:0009790 - embryonic development [Evidence NAS]; GO:0035050 - embryonic heart tube development [Evidence NAS]; GO:0040007 - growth [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IC] codon_start : 1 exception : mismatches in translation product : bone morphogenetic protein 10 preproprotein protein_id : NP_033886.1

name	Arhgap25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582811 CCDS:CCDS20321.1 GeneID:232201 MGI:2443687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : Rho GTPase activating protein 25 isoform a protein_id : NP_001032816.1

name	Arhgap25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582813 CCDS:CCDS20322.1 GeneID:232201 MGI:2443687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : Rho GTPase activating protein 25 isoform b protein_id : NP_780685.2

name	Prokr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254343 CCDS:CCDS20323.1 GeneID:58182 MGI:1929676
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 73 protein_id : NP_067356.2

name	2010301N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541860 CCDS:CCDS20324.1 GeneID:72103 MGI:1919353
definition	codon_start : 1 product : hypothetical protein LOC72103 protein_id : NP_077213.2

name	LOC665177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665177
definition	number : 1 pseudo : _no_value

name	LOC665177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665177
definition	number : 2 pseudo : _no_value

name	LOC665213 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665213
definition	number : 1 pseudo : _no_value

name	LOC665213 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665213
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:119814
definition	standard_name : RH94566

name	(CDS detail)
type	STS
link
xref	UniSTS:235483
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:211133
definition	standard_name : RH127823

name	(CDS detail)
type	STS
link
xref	UniSTS:207987
definition	standard_name : AI173933

name	(CDS detail)
type	STS
link
xref	UniSTS:159527
definition	standard_name : AI266962

name	(CDS detail)
type	STS
link
xref	UniSTS:217253
definition	standard_name : RH133971

name	(CDS detail)
type	STS
link
xref	UniSTS:159528
definition	standard_name : AI481497

name	(CDS detail)
type	STS
link
xref	UniSTS:235481
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:225860
definition	standard_name : G65193

name	(CDS detail)
type	STS
link
xref	UniSTS:460101
definition	standard_name : stSG633446

name	(CDS detail)
type	STS
link
xref	UniSTS:144608
definition	standard_name : Tgfa

name	(CDS detail)
type	STS
link
xref	UniSTS:159533
definition	standard_name : AI448340

name	(CDS detail)
type	STS
link
xref	UniSTS:210059
definition	standard_name : RH136064

name	(CDS detail)
type	STS
link
xref	UniSTS:221980
definition	standard_name : RH139896

name	(CDS detail)
type	STS
link
xref	UniSTS:159535
definition	standard_name : C87436

name	(CDS detail)
type	STS
link
xref	UniSTS:162100
definition	standard_name : RH125278

name	(CDS detail)
type	STS
link
xref	UniSTS:266025
definition	standard_name : PCBP1

name	(CDS detail)
type	STS
link
xref	UniSTS:22959
definition	standard_name : A006T05

name	(CDS detail)
type	STS
link
xref	UniSTS:491475
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165474
definition	standard_name : AA986851

name	(CDS detail)
type	STS
link
xref	UniSTS:165476
definition	standard_name : AW122478

name	(CDS detail)
type	STS
link
xref	UniSTS:125870
definition	standard_name : X83106

name	(CDS detail)
type	STS
link
xref	UniSTS:207989
definition	standard_name : AU022368

name	(CDS detail)
type	STS
link
xref	UniSTS:159529
definition	standard_name : AI449063

name	(CDS detail)
type	STS
link
xref	UniSTS:212122
definition	standard_name : RH128814

name	(CDS detail)
type	STS
link
xref	UniSTS:164687
definition	standard_name : Gcl

name	(CDS detail)
type	STS
link
xref	UniSTS:235484
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207990
definition	standard_name : BB540852

name	(CDS detail)
type	STS
link
xref	UniSTS:159539
definition	standard_name : AI265406

name	(CDS detail)
type	STS
link
xref	UniSTS:179409
definition	standard_name : AW106930

name	(CDS detail)
type	STS
link
xref	UniSTS:130837
definition	standard_name : D6Mit29

name	(CDS detail)
type	STS
link
xref	UniSTS:130877
definition	standard_name : D6Mit323

name	(CDS detail)
type	STS
link
xref	UniSTS:215646
definition	standard_name : RH132363

name	(CDS detail)
type	STS
link
xref	UniSTS:179408
definition	standard_name : AU067724

name	(CDS detail)
type	STS
link
xref	UniSTS:164330
definition	standard_name : AU067726

name	(CDS detail)
type	STS
link
xref	UniSTS:207988
definition	standard_name : RH126710

name	(CDS detail)
type	STS
link
xref	UniSTS:167472
definition	standard_name : RH126656

name	(CDS detail)
type	STS
link
xref	UniSTS:162071
definition	standard_name : RH125249

name	(CDS detail)
type	STS
link
xref	UniSTS:165475
definition	standard_name : AI324119

name	(CDS detail)
type	STS
link
xref	UniSTS:159538
definition	standard_name : AI449986

name	(CDS detail)
type	STS
link
xref	UniSTS:167494
definition	standard_name : D6Ertd527e

name	(CDS detail)
type	STS
link
xref	UniSTS:159534
definition	standard_name : AU043841

name	(CDS detail)
type	STS
link
xref	UniSTS:235487
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235488
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130991
definition	standard_name : D6Mit9

name	(CDS detail)
type	STS
link
xref	UniSTS:496636
definition	standard_name : Bmp10

name	(CDS detail)
type	STS
link
xref	UniSTS:266025
definition	standard_name : PCBP1

name	(CDS detail)
type	STS
link
xref	UniSTS:22959
definition	standard_name : A006T05

name	(CDS detail)
type	STS
link
xref	UniSTS:130758
definition	standard_name : D6Mit213

name	(CDS detail)
type	STS
link
xref	UniSTS:179410
definition	standard_name : AI452191

name	LOC665233 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255319 GeneID:665233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 17 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034541.1

clone name	MSMg01-541N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495C16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-207D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063P07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-474B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447A22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-218C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-485N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182L16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-275L10.b	B6Ng01-275L10.g
ACC	GA076677	GA076678
length	725	290
definition	B6Ng01-275L10.b	B6Ng01-275L10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(86,614,030 - 86,614,750)	(86,458,261 - 86,458,548)
sequence	gaattcccaaccagagccagttagagcccttttccaaaactgggcttcct cacccacgcctcgtcatgaagaagctgctttcagatgtagaaggaatcag gttgacttccatggttatagagaactgtttgtgaagtccaaggcaaggcc tggtcctcaggggcagccatgagcactaatggttgatttccaacccagca tgcctttcatctgggccttgccagtcacctttatagctgttccctcattg atccattcttcttttctagattattggcaattatttgtattcccattttt aacagaggggttagcccagggcgaggtagtacaattatttcatctacagt accagagaggacaaagctggcctttttttttatcatctcaactcctgctc ttgccagcctgctgctgccttcctgttggatttgtaaggccctgctttcc tcgctgcgctgaggcagcggcctctttgtggaggttgtgcatgaggcatt tcactcagggagctggggtaggggaggggttttttaccagttaaaatagg aggttgtaaccaaacagcatcatgtgtttagtgtatgctgcccctaggac gtaggatgggggtatggtgccacccacatgactttacagataacctaaag gttgtttttgaaactcctgtgcacatcacactgtaccattgtgttttgta atttaaccctcttcctctttacaaa	ctcctgcctcagcttccatagttctgggattacagggaccacgcccagtc agagaaacccgtttactgggaactcacttctaaacatagtttcttttgtt ttgtttttctctatgtagcctggctgtcctggaactcactctgcagacca ggctggccttgaactcataaatatgcctgcctctgcctcccaaatctgtg attaaaggcgtgcaccaccaccacccggtctttttttttttaaagaatta ttttattttatgtatgtgagcacactgaatctgtcttcat
quality values	Open. Hide. 10 9 10 18 58 52 54 23 16 46 54 41 18 44 58 52 62 38 31 62 62 62 47 62 62 62 62 62 62 62 56 56 46 56 31 17 30 32 46 56 56 62 62 62 62 62 62 62 62 62 59 59 62 62 49 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 50 62 62 62 62 59 59 62 62 62 62 62 62 59 62 59 62 54 49 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 54 62 54 51 56 62 46 49 56 62 62 62 62 62 62 62 62 47 62 62 62 47 49 46 46 49 51 62 62 62 62 62 56 47 62 54 25 56 43 56 56 56 56 56 56 24 47 56 46 62 56 56 56 42 56 56 56 39 39 62 26 24 27 13 24 30 41 43 35 38 56 43 41 10 41 17 36 26 31 62 33 52 43 52 52 50 50 41 38 47 52 52 45 16 35 52 23 22 33 46 20 45 62 47 43 28 19 17 19 9 21 22 40 40 28 40 30 21 13 19 17 11 15 17 18 20 22 37 27 42 50 25 9 19 20 13 26 32 14 22 14 22 12 19 23 25 28 29 8 13 17 10 21 14 8 13 9 19 28 19 29 32 16 26 8 13 10 17 9 10 13 17 31 15 13 14 11 18 21 33 22 25 18 22 19 12 12 28 10 14 10 10 9 17 27 23 17 25 8 10 7 6 13 9 17 19 16 15 14 21 28 21 22 19 16 23 19 19 12 13 13 16	Open. Hide. 62 62 59 59 56 49 54 56 54 54 33 28 54 54 62 62 49 49 59 59 62 62 62 62 62 54 62 62 59 46 59 62 62 59 62 62 59 59 59 59 62 62 62 62 62 62 62 59 59 62 59 54 42 54 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 59 62 62 62 59 62 62 62 59 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 54 23 36 59 59 62 51 59 59 43 49 35 35 36 49 49 43 51 36 34 18 51 34 41 43 21 38 34 40 43 46 23 39 27 34 29 38 27 24 18 22 21 10 29 28 25 18 23 16 18 22 27 26 34 28 26 18 23 29 43 18 22 23 12 18 18 18 18 27 34 34 23 28 18 18 26 18 23 11 11 13 13 38 19 24 24 34 23 18 34 35 27 29 34 18 27 23 30 27 27 23 13 27 13 31 49 24 34 34 43 28 25 27 33 23 23 27 34 34 19 29 23 13 23 19 23 20 16 30 27 43 39 33 34 43 27 36 23 34 14 13 14 13 28 18 26 23 24 17 21 30 30 9 23 10 10 13 23 13 13 12 24 30 21 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_86614030_86614750
seq2: B6Ng01-275L10.b_46_770 (reverse)

seq1  TTTGTAAAGAGGAAGAGGG-TCACTTACAAAACACACTGGTACAGTGTGA  49
      ||||||||||||||||||| | | |||||||||||| |||||||||||||
seq2  TTTGTAAAGAGGAAGAGGGTTAAATTACAAAACACAATGGTACAGTGTGA  50

seq1  TGTGCACTGGAGTTTCATAA--CACCTTTAGGTTATCTGTAAAGTCATGT  97
      ||||||| ||||||||| ||   |||||||||||||||||||||||||||
seq2  TGTGCACAGGAGTTTCAAAAACAACCTTTAGGTTATCTGTAAAGTCATGT  100

seq1  GGGTGGCACCATACCCCCATCCTACGTCCTAGGGGCAGCATACACT-AAC  146
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  GGGTGGCACCATACCCCCATCCTACGTCCTAGGGGCAGCATACACTAAAC  150

seq1  ACATGATGCTGTTTGGTTACAACCTCCTATTTTAACTGGTAAAAAACCCC  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGATGCTGTTTGGTTACAACCTCCTATTTTAACTGGTAAAAAACCCC  200

seq1  TCCCCTACCCCAGCTCCCTGAGTGAAATGCCTCATGCACAACCTCCACAA  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCTACCCCAGCTCCCTGAGTGAAATGCCTCATGCACAACCTCCACAA  250

seq1  AGAGGCCGCTGCCTCAGCGCAGCGAGGAAAGCAGGGCCTTACAAATCCAA  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCCGCTGCCTCAGCGCAGCGAGGAAAGCAGGGCCTTACAAATCCAA  300

seq1  CAGGAAGGCAGCAGCAGGCTGGCAAGAGCAGGAGTTGAGATGATAAAAAA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAGGCAGCAGCAGGCTGGCAAGAGCAGGAGTTGAGATGATAAAAAA  350

seq1  AAAGGCCAGCTTTGTCCTCTCTGGTACTGTAGATGAAATAATTGTACTAC  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCCAGCTTTGTCCTCTCTGGTACTGTAGATGAAATAATTGTACTAC  400

seq1  CTCGCCCTGGGCTAACCCCTCTGTTAAAAATGGGAATACAAATAATTGCC  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGCCCTGGGCTAACCCCTCTGTTAAAAATGGGAATACAAATAATTGCC  450

seq1  AATAATCTAGAAAAGAAGAATGGATCAATGAGGGAACAGCTATAAAGGTG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATCTAGAAAAGAAGAATGGATCAATGAGGGAACAGCTATAAAGGTG  500

seq1  ACTGGCAAGGCCCAGATGAAAGGCATGCTGGGTTGGAAATCAACCATTAG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGCAAGGCCCAGATGAAAGGCATGCTGGGTTGGAAATCAACCATTAG  550

seq1  TGCTCATGGCTGCCCCTGAGGACCAGGCCTTGCCTTGGACTTCACAAACA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCATGGCTGCCCCTGAGGACCAGGCCTTGCCTTGGACTTCACAAACA  600

seq1  GTTCTCTATAACCATGGAAGTCAACCTGATTCCTTCTACATCTGAAAGCA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTCTATAACCATGGAAGTCAACCTGATTCCTTCTACATCTGAAAGCA  650

seq1  GCTTCTTCATGACGAGGCGTGGGTGAGGAAGCCCAGTTTTGGAAAAGGGC  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCTTCATGACGAGGCGTGGGTGAGGAAGCCCAGTTTTGGAAAAGGGC  700

seq1  TCTAACTGGCTCTGGTTGGGAATTC  721
      |||||||||||||||||||||||||
seq2  TCTAACTGGCTCTGGTTGGGAATTC  725

seq1: chr6_86458261_86458548
seq2: B6Ng01-275L10.g_72_360

seq1  CTCCTGCCTCAGCTTCCATAGTTCTGGGATTACAGGGACCACGCCCAGTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGCCTCAGCTTCCATAGTTCTGGGATTACAGGGACCACGCCCAGTC  50

seq1  AGAGAAACCCGTTTACTGGGAACTCACTTCTAAACATAGTTTCTTTTGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAACCCGTTTACTGGGAACTCACTTCTAAACATAGTTTCTTTTGTT  100

seq1  TTGTTTTTCTCTATGTAGCCTGGCTGTCCTGGAACTCACTCTGCAGACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTTCTCTATGTAGCCTGGCTGTCCTGGAACTCACTCTGCAGACCA  150

seq1  GGCTGGCCTTGAACTCAGAAATATGCCTGCCTCTGCCTCCCAAATCTGTG  200
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  GGCTGGCCTTGAACTCATAAATATGCCTGCCTCTGCCTCCCAAATCTGTG  200

seq1  ATTAAAGGCGTGCACCACCACCACCCGGCCTTTTTTTTTTTAAAGAATTA  250
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  ATTAAAGGCGTGCACCACCACCACCCGGTCTTTTTTTTTTTAAAGAATTA  250

seq1  -TTTATTTTATGTATGTGAGCACACTGTAGCTGTCTTCA  288
       |||||||||||||||||||||||||| | |||||||||
seq2  TTTTATTTTATGTATGTGAGCACACTGAATCTGTCTTCA  289

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information