MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-301F11
Chromosome	6 (Build37)
Map Location	30,229,444 - 30,378,135
singlet/doublet	doublet
Overlap gene	Ube2h, Zc3hc1, 2410127E18Rik
Upstream gene	AI507611, BC048651, Calu, Opn1sw, 4921511K06Rik, Flnc, Atp6v1f, EG668210, Crim2, Irf5, Tnpo3, Tspan33, Smo, 4631427C17Rik, D330017J20Rik, 1700023L04Rik, 1700080G18Rik, Nrf1
Downstream gene	2700094F01Rik, 1700025E21Rik, Cpa2, Cpa4, Cpa5, Cpa1, Tsga14, Mest, Copg2, Copg2, Tsga13, Klf14, LOC100038973, AB041803, Mkln1
Link	Open Mouse BAC browser

Click to get alignment info.

name	AI507611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245884 MGI:2141439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 4 Proteins

name	BC048651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330277 MGI:3032524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12321 MGI:1097158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Opn1sw (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12057 MGI:99438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921511K06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232664 MGI:1918128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 1 Protein

name	Flnc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68794 MGI:95557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66144 MGI:1913394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668210 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668210 MGI:3644212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Crim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333088 MGI:2141640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27056 MGI:1350924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnpo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320938 MGI:1196412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232670 MGI:1919012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319757 MGI:108075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4631427C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74340 MGI:1921590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D330017J20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320609 MGI:2444363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700023L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76419 MGI:1923669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	1700080G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73533 MGI:1920783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Nrf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18181 MGI:1332235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22214 MGI:104632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3hc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232679 MGI:1916023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410127E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76788 MGI:1924038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700094F01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72649 MGI:1919899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700025E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75647 MGI:1922897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232680 MGI:3617840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71791 MGI:1919041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpa5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74649 MGI:1921899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109697 MGI:88478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsga14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83922 MGI:1891414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mest (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17294 MGI:96968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54160 MGI:1858683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54160 MGI:1858683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsga13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116732 MGI:1891413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klf14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619665 MGI:3577024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 Proteins

name	LOC100038973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 198 ESTs, 5 Proteins

name	AB041803 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232685 MGI:2673128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Mkln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27418 MGI:1351638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI507611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254893 GeneID:245884 MGI:2141439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 3 Proteins product : expressed sequence AI507611, transcript variant 1 transcript_id : XM_001477461.1

name	AI507611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254895 GeneID:245884 MGI:2141439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : expressed sequence AI507611, transcript variant 2 transcript_id : XM_001477480.1

name	BC048651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85797651 GeneID:330277 MGI:3032524
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048651 transcript_id : NM_207258.2

name	Calu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672916 GeneID:12321 MGI:1097158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calumenin transcript_id : NM_007594.3

name	Calu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672915 GeneID:12321 MGI:1097158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calumenin transcript_id : NM_184053.2

name	Opn1sw (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543369 GeneID:12057 MGI:99438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan) transcript_id : NM_007538.2

name	4921511K06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254887 GeneID:232664 MGI:1918128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 1 Protein product : RIKEN cDNA 4921511K06 gene, transcript variant 1 transcript_id : XM_485735.5

name	Flnc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487138 GeneID:68794 MGI:95557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : filamin C, gamma (actin binding protein 280) transcript_id : NM_001081185.1

name	Atp6v1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369990 GeneID:66144 MGI:1913394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V1 subunit F transcript_id : NM_025381.2

name	EG668210 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377097 GeneID:668210 MGI:3644212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668210 transcript_id : XM_001000046.1

name	Crim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803071 GeneID:333088 MGI:2141640
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine rich BMP regulator 2 (chordin like) transcript_id : NM_001029985.2

name	Irf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347490 GeneID:27056 MGI:1350924
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 5 transcript_id : NM_012057.2

name	Tnpo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130371 GeneID:320938 MGI:1196412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transportin 3 transcript_id : NM_177296.4

name	Tspan33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130219 GeneID:232670 MGI:1919012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 33 transcript_id : NM_146173.2

name	Smo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39812461 GeneID:319757 MGI:108075
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : smoothened homolog (Drosophila) transcript_id : NM_176996.3

name	4631427C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374758 GeneID:74340 MGI:1921590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4631427C17 gene transcript_id : NM_021414.4

name	D330017J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627726 GeneID:320609 MGI:2444363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330017J20 gene transcript_id : NM_177204.3

name	D330017J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627723 GeneID:320609 MGI:2444363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330017J20 gene transcript_id : NM_001037740.1

name	1700023L04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254889 GeneID:76419 MGI:1923669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : RIKEN cDNA 1700023L04 gene transcript_id : XM_485737.5

name	1700080G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254890 GeneID:73533 MGI:1920783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA 1700080G18 gene transcript_id : XM_001000195.2

name	Nrf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802408 GeneID:18181 MGI:1332235
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear respiratory factor 1 transcript_id : NM_010938.3

name	Ube2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476282 GeneID:22214 MGI:104632
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2H transcript_id : NM_009459.2

name	Zc3hc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374816 GeneID:232679 MGI:1916023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, C3HC type 1 transcript_id : NM_172735.2

name	2410127E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130658 GeneID:76788 MGI:1924038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410127E18 gene transcript_id : NM_029742.2

name	2700094F01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254355 GeneID:72649 MGI:1919899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700094F01 gene transcript_id : NM_178625.3

name	1700025E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802125 GeneID:75647 MGI:1922897
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700025E21 gene transcript_id : NM_029373.2

name	Cpa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350483 GeneID:232680 MGI:3617840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase A2, pancreatic transcript_id : NM_001024698.2

name	Cpa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802681 GeneID:71791 MGI:1919041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase A4 transcript_id : NM_027926.2

name	Cpa5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384611 GeneID:74649 MGI:1921899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase A5 transcript_id : NM_144537.2

name	Cpa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130352 GeneID:109697 MGI:88478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase A1 transcript_id : NM_025350.3

name	Tsga14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560772 GeneID:83922 MGI:1891414
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific gene A14 transcript_id : NM_031998.2

name	Mest (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678865 GeneID:17294 MGI:96968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesoderm specific transcript transcript_id : NM_008590.1

name	Copg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982716 GeneID:54160 MGI:1858683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit gamma 2 transcript_id : NM_017478.2

name	Copg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982716 GeneID:54160 MGI:1858683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit gamma 2 transcript_id : NM_017478.2

name	Tsga13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803085 GeneID:116732 MGI:1891413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific gene A13 transcript_id : NM_054073.2

name	Klf14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255031 GeneID:619665 MGI:3577024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 Proteins product : Kruppel-like factor 14 transcript_id : XM_884028.3

name	LOC100038973 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255029 GeneID:100038973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 198 ESTs, 5 Proteins product : similar to proteasome alpha7/C8 subunit transcript_id : XM_001472015.1

name	Mkln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637810 GeneID:27418 MGI:1351638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : muskelin 1, intracellular mediator containing kelch motifs transcript_id : NM_013791.2

name	AI507611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254894 GeneID:245884 MGI:2141439
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477511.1

name	AI507611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254896 GeneID:245884 MGI:2141439
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477530.1

name	BC048651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85797652 GeneID:330277 MGI:3032524
definition	codon_start : 1 product : testes development-related NYD-SP18 protein_id : NP_997141.2

name	Calu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680840 CCDS:CCDS19957.1 GeneID:12321 MGI:1097158
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : calumenin isoform 1 protein_id : NP_031620.1

name	Calu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41282022 CCDS:CCDS19958.1 GeneID:12321 MGI:1097158
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : calumenin isoform 2 protein_id : NP_908942.1

name	Opn1sw (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680776 CCDS:CCDS19959.1 GeneID:12057 MGI:99438
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0001750 - photoreceptor outer segment [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007602 - phototransduction [Evidence IEA]; GO:0018298 - protein-chromophore linkage [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : blue cone pigment; S Opsin; SWS opsin; Blue Opsin; Blue/UV Opsin; Blue Cone Opsin; Short Wavelength Sensitive opsin product : opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan) protein_id : NP_031564.1

name	4921511K06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254888 GeneID:232664 MGI:1918128
definition	codon_start : 1 product : hypothetical protein LOC232664 isoform 1 protein_id : XP_485735.5

name	Flnc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487139 GeneID:68794 MGI:95557
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence TAS] [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0030029 - actin filament-based process [Evidence TAS] codon_start : 1 note : actin-binding protein 280; filamin, gamma product : filamin C, gamma protein_id : NP_001074654.1

name	Atp6v1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314824 CCDS:CCDS19960.1 GeneID:66144 MGI:1913394
definition	GO_component : GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, vacuolar, 14 kD product : ATPase, H+ transporting, V1 subunit F protein_id : NP_079657.1

name	EG668210 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377098 GeneID:668210 MGI:3644212
definition	codon_start : 1 product : similar to hCG2042334 protein_id : XP_001000046.1

name	Crim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725381 GeneID:333088 MGI:2141640
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030513 - positive regulation of BMP signaling pathway [Evidence IDA] codon_start : 1 exception : mismatches in translation product : cysteine rich BMP regulator 2 (chordin like) protein_id : NP_001025156.1

name	Irf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754368 CCDS:CCDS19962.1 GeneID:27056 MGI:1350924
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : interferon regulatory factor 5 protein_id : NP_036187.1

name	Tnpo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54312056 CCDS:CCDS19963.1 GeneID:320938 MGI:1196412
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : transportin-SR product : transportin 3 protein_id : NP_796270.2

name	Tspan33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122703 CCDS:CCDS19964.1 GeneID:232670 MGI:1919012
definition	codon_start : 1 note : penumbra product : tetraspanin 33 protein_id : NP_666285.1

name	Smo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39812462 CCDS:CCDS19965.1 GeneID:319757 MGI:108075
definition	GO_component : GO:0005929 - cilium [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004926 - non-G-protein coupled 7TM receptor activity [Evidence IEA] GO_process : GO:0007417 - central nervous system development [Evidence IGI]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0043392 - negative regulation of DNA binding [Evidence IGI]; GO:0001649 - osteoblast differentiation [Evidence IMP]; GO:0007389 - pattern specification [Evidence IMP]; GO:0007224 - smoothened signaling pathway [Evidence IMP]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : bent body product : smoothened homolog protein_id : NP_795970.2

name	4631427C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592084 CCDS:CCDS19966.1 GeneID:74340 MGI:1921590
definition	GO_function : GO:0004013 - adenosylhomocysteinase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : clone MNCb-5555; AdoHcyase 3 product : adenosylhomocysteinase 3 protein_id : NP_067389.3

name	D330017J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627727 CCDS:CCDS19967.1 GeneID:320609 MGI:2444363
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; family with sequence similarity 40, member B product : hypothetical protein LOC320609 isoform a protein_id : NP_796178.2

name	D330017J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627724 GeneID:320609 MGI:2444363
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2; family with sequence similarity 40, member B product : hypothetical protein LOC320609 isoform b protein_id : NP_001032829.1

name	1700023L04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377100 GeneID:76419 MGI:1923669
definition	codon_start : 1 product : hypothetical protein LOC76419 protein_id : XP_485737.4

name	1700080G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254891 GeneID:73533 MGI:1920783
definition	codon_start : 1 product : hypothetical protein LOC73533 protein_id : XP_001000195.2

name	Nrf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543343 CCDS:CCDS19968.1 GeneID:18181 MGI:1332235
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0007005 - mitochondrion organization and biogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nuclear respiratory factor 1 protein_id : NP_035068.2

name	Ube2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678487 CCDS:CCDS19969.1 GeneID:22214 MGI:104632
definition	GO_function : GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2H protein_id : NP_033485.1

name	Zc3hc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370072 CCDS:CCDS19970.1 GeneID:232679 MGI:1916023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : nuclear interacting partner of anaplastic lymphoma kinase (Alk) product : nuclear interacting partner of ALK protein_id : NP_766323.1

name	2410127E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037463 CCDS:CCDS19971.1 GeneID:76788 MGI:1924038
definition	codon_start : 1 product : hypothetical protein LOC76788 protein_id : NP_084018.1

name	2700094F01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254356 CCDS:CCDS19972.1 GeneID:72649 MGI:1919899
definition	codon_start : 1 product : hypothetical protein LOC72649 protein_id : NP_848740.3

name	1700025E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312998 CCDS:CCDS19973.1 GeneID:75647 MGI:1922897
definition	codon_start : 1 product : hypothetical protein LOC75647 protein_id : NP_083649.1

name	Cpa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67010039 CCDS:CCDS19974.1 GeneID:232680 MGI:3617840
definition	GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : carboxypeptidase A2, pancreatic protein_id : NP_001019869.1

name	Cpa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789211 CCDS:CCDS19975.1 GeneID:71791 MGI:1919041
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : carboxypeptidase A4 protein_id : NP_082202.1

name	Cpa5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362335 CCDS:CCDS19976.1 GeneID:74649 MGI:1921899
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IDA]; GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : carboxypeptidase A5 protein_id : NP_653120.1

name	Cpa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54312076 CCDS:CCDS19977.1 GeneID:109697 MGI:88478
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : carboxypeptidase A1 protein_id : NP_079626.2

name	Tsga14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14030773 CCDS:CCDS19978.1 GeneID:83922 MGI:1891414
definition	GO_function : GO:0004792 - thiosulfate sulfurtransferase activity [Evidence IEA] GO_process : GO:0008272 - sulfate transport [Evidence IEA] codon_start : 1 product : testis specific gene A14 protein_id : NP_114387.1

name	Mest (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678866 CCDS:CCDS19979.1 GeneID:17294 MGI:96968
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] codon_start : 1 note : mesoderm-specific transcript product : mesoderm specific transcript protein_id : NP_032616.1

name	Copg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567340 GeneID:54160 MGI:1858683
definition	GO_component : GO:0030126 - COPI vesicle coat [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008705 - methionine synthase activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0009086 - methionine biosynthesis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : coatomer protein complex, subunit gamma 2 protein_id : NP_059506.1

name	Copg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567340 GeneID:54160 MGI:1858683
definition	GO_component : GO:0030126 - COPI vesicle coat [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008705 - methionine synthase activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0009086 - methionine biosynthesis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : coatomer protein complex, subunit gamma 2 protein_id : NP_059506.1

name	Tsga13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19387858 CCDS:CCDS19980.1 GeneID:116732 MGI:1891413
definition	codon_start : 1 note : variegated monoallelic expression 1 product : testis specific gene A13 protein_id : NP_473414.1

name	Klf14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255032 GeneID:619665 MGI:3577024
definition	codon_start : 1 product : similar to Kruppel-like factor 14 protein_id : XP_889121.3

name	LOC100038973 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255030 GeneID:100038973
definition	codon_start : 1 product : similar to proteasome alpha7/C8 subunit protein_id : XP_001472065.1

name	Mkln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305271 CCDS:CCDS19982.1 GeneID:27418 MGI:1351638
definition	codon_start : 1 product : muskelin 1, intracellular mediator containing kelch motifs protein_id : NP_038819.1

name	(CDS detail)
type	STS
link
xref	UniSTS:261866
definition	standard_name : AI555223

name	(CDS detail)
type	STS
link
xref	UniSTS:164315
definition	standard_name : AI507611

name	(CDS detail)
type	STS
link
xref	UniSTS:130816
definition	standard_name : D6Mit267

name	(CDS detail)
type	STS
link
xref	UniSTS:464721
definition	standard_name : Calu

name	(CDS detail)
type	STS
link
xref	UniSTS:464722
definition	standard_name : Calu

name	(CDS detail)
type	STS
link
xref	UniSTS:267216
definition	standard_name : MARC_11525-11526:1001518036:1

name	(CDS detail)
type	STS
link
xref	UniSTS:235394
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159489
definition	standard_name : AW541262

name	(CDS detail)
type	STS
link
xref	UniSTS:179352
definition	standard_name : AW551857

name	(CDS detail)
type	STS
link
xref	UniSTS:141171
definition	standard_name : Opn1sw

name	(CDS detail)
type	STS
link
xref	UniSTS:477293
definition	standard_name : Flnc

name	(CDS detail)
type	STS
link
xref	UniSTS:142631
definition	standard_name : D6Rck39

name	(CDS detail)
type	STS
link
xref	UniSTS:179351
definition	standard_name : AW060220

name	(CDS detail)
type	STS
link
xref	UniSTS:179353
definition	standard_name : AW491843

name	(CDS detail)
type	STS
link
xref	UniSTS:167476
definition	standard_name : D6Ertd313e

name	(CDS detail)
type	STS
link
xref	UniSTS:209775
definition	standard_name : RH127018

name	(CDS detail)
type	STS
link
xref	UniSTS:223216
definition	standard_name : RH141220

name	(CDS detail)
type	STS
link
xref	UniSTS:209984
definition	standard_name : RH135988

name	(CDS detail)
type	STS
link
xref	UniSTS:145610
definition	standard_name : AU049162

name	(CDS detail)
type	STS
link
xref	UniSTS:160120
definition	standard_name : AI035228

name	(CDS detail)
type	STS
link
xref	UniSTS:116597
definition	standard_name : D6Mit159

name	(CDS detail)
type	STS
link
xref	UniSTS:144443
definition	standard_name : Smoh

name	(CDS detail)
type	STS
link
xref	UniSTS:237068
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:465497
definition	standard_name : Smo

name	(CDS detail)
type	STS
link
xref	UniSTS:160324
definition	standard_name : AU041277

name	(CDS detail)
type	STS
link
xref	UniSTS:231646
definition	standard_name : RH142399

name	(CDS detail)
type	STS
link
xref	UniSTS:162393
definition	standard_name : RH125579

name	(CDS detail)
type	STS
link
xref	UniSTS:116598
definition	standard_name : D6Mit205

name	(CDS detail)
type	STS
link
xref	UniSTS:207930
definition	standard_name : BB258509

name	(CDS detail)
type	STS
link
xref	UniSTS:207931
definition	standard_name : BB283425

name	(CDS detail)
type	STS
link
xref	UniSTS:167487
definition	standard_name : RH127210

name	(CDS detail)
type	STS
link
xref	UniSTS:179355
definition	standard_name : C87038

name	(CDS detail)
type	STS
link
xref	UniSTS:207932
definition	standard_name : BB283400

name	(CDS detail)
type	STS
link
xref	UniSTS:144723
definition	standard_name : Ube2h

name	(CDS detail)
type	STS
link
xref	UniSTS:161886
definition	standard_name : RH125064

name	(CDS detail)
type	STS
link
xref	UniSTS:71993
definition	standard_name : D7S2072E

name	(CDS detail)
type	STS
link
xref	UniSTS:180303
definition	standard_name : AW227540

name	(CDS detail)
type	STS
link
xref	UniSTS:159491
definition	standard_name : AI326965

name	(CDS detail)
type	STS
link
xref	UniSTS:165454
definition	standard_name : AI462483

name	(CDS detail)
type	STS
link
xref	UniSTS:122659
definition	standard_name : 01.MMHAP57FRA7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207933
definition	standard_name : RH126895

name	(CDS detail)
type	STS
link
xref	UniSTS:210207
definition	standard_name : RH136212

name	(CDS detail)
type	STS
link
xref	UniSTS:235395
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165456
definition	standard_name : AI593221

name	(CDS detail)
type	STS
link
xref	UniSTS:235397
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165455
definition	standard_name : AI428435

name	(CDS detail)
type	STS
link
xref	UniSTS:162681
definition	standard_name : RH125969

name	(CDS detail)
type	STS
link
xref	UniSTS:235399
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164319
definition	standard_name : AV009555

name	(CDS detail)
type	STS
link
xref	UniSTS:212421
definition	standard_name : RH129113

name	(CDS detail)
type	STS
link
xref	UniSTS:130682
definition	standard_name : D6Mit140

name	(CDS detail)
type	STS
link
xref	UniSTS:466534
definition	standard_name : TSGA14__5148

name	(CDS detail)
type	STS
link
xref	UniSTS:164316
definition	standard_name : AI503610

name	(CDS detail)
type	STS
link
xref	UniSTS:235396
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164318
definition	standard_name : AI449046

name	(CDS detail)
type	STS
link
xref	UniSTS:130859
definition	standard_name : D6Mit308

name	(CDS detail)
type	STS
link
xref	UniSTS:235400
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:273482
definition	standard_name : PMC85624P2

name	(CDS detail)
type	STS
link
xref	UniSTS:210083
definition	standard_name : RH136088

name	(CDS detail)
type	STS
link
xref	UniSTS:161607
definition	standard_name : RH124785

name	(CDS detail)
type	STS
link
xref	UniSTS:164902
definition	standard_name : Copg2as1

name	(CDS detail)
type	STS
link
xref	UniSTS:179354
definition	standard_name : AW227625

name	(CDS detail)
type	STS
link
xref	UniSTS:164901
definition	standard_name : Copg2

name	(CDS detail)
type	STS
link
xref	UniSTS:164911
definition	standard_name : Copg2as2

name	(CDS detail)
type	STS
link
xref	UniSTS:164317
definition	standard_name : AW049845

name	(CDS detail)
type	STS
link
xref	UniSTS:122906
definition	standard_name : 07.MMHAP86FRC7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:162160
definition	standard_name : RH125338

name	(CDS detail)
type	STS
link
xref	UniSTS:232020
definition	standard_name : RH142773

name	(CDS detail)
type	STS
link
xref	UniSTS:235398
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:227771
definition	standard_name : D4Rat225

name	(CDS detail)
type	STS
link
xref	UniSTS:123233
definition	standard_name : 14.MMHAP82FLE2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130715
definition	standard_name : MT1717

name	(CDS detail)
type	STS
link
xref	UniSTS:130716
definition	standard_name : D6Mit172.2

name	(CDS detail)
type	STS
link
xref	UniSTS:110736
definition	standard_name : AU047206

name	AB041803 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255033 GeneID:232685 MGI:2673128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : cDNA sequence AB041803 transcript_id : XR_035177.1

clone name	MSMg01-277N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-301F11.b	B6Ng01-301F11.g
ACC	GA095676	GA095677
length	1,205	1,060
definition	B6Ng01-301F11.b	B6Ng01-301F11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(30,376,943 - 30,378,135)	(30,229,444 - 30,230,505)
sequence	gaattcttagcctatcatatcatcacttggttcttccttagaatcacatc ctacacttgaaggttttttgatgtggttatggtggtctgccactgatact agtgaggtaatctactctactatctaagatacattaagagaatctaactt ccccaaaacttatcattataatcccaacagtggtcaatataaaacataaa tttaaaactaaggcctagactttttgcttcaattttggctgttaagacaa cttaaagagaacagttttgaatttagaaaatccattcaaaattcccttca acccacaggaagcacagacctcttgcctgttatcacccacctctcaagaa cctgttagggatccttatgatgggacaggactgaatgaagcgcctcctaa ctgggtcccaccgtattttcttcttacctgtcaccacaattatcagcagt aagtcagacacatacaacacatggcaagtaatacatagttactgtattat aaagacagaaaaacaggaaacaaaacaatacttgaatacagaaggaaagt gatataaagtctcgtttaactctggaagttaaaatgacataatacataag cagtggtcagagttttcaactcttatccccaacaacacaattatgtgcac ctttgtaaagctgttcaacagcctcaaatcatcaccaatgccgtctgcgg caaacatttaccaggaattttagaagcgattagacagaacagccttttaa agccaataaagccaaaaggagctccacccaaaagcatcaggcacagcaca ggctcctctgctcaagggttttgttttgtttttactagttacaaagcaat ggatacggaccctttaataagaaatctgctggggctagcaagatgcctca gcagttgagagcactgactactcttccagaggtcctgagttcaaatccca gccaaccacatggtggctcacaaccacccacaatgagatctggtgccctc ttctgtttgcatctgaagtcagctacagtgtacttacgtttaataataaa taaattcttttgacccgagcacacccaggcccagccaagtgggccgactt ggaagcgagcacagtccctaaaattcagttccaacaacccacatggaatg cctccaacaatcttggtccgttacagtgtactggacctaccataaaatat aataa	gaattccagattacaaacacttggtctataatgagccaaattaaagttaa aagatctataatacatacagtatttggtcctggagagatggctcaatggt tacgagcctggctgttctaccagaagactcggattcccagtgacagggct ggtcacaactgaaccctggatcctacttaacctatagatcccaagtgcta caactacaggtatgcaccaccacaccaaattaatgcctgttgttctttaa aaacaaaacaaaaaaacaagactacagaacaaagacaaaagagaaattta ctgcttgtatttatatattatttgaaaaaatcttggccaggtctttgtct catctactgaatcatccatcctgctttttcagatggccctgaaaaacaaa actgaaacaaggtaaggaccacaagtttcccactcctaacatatacagta acagatttgcctgctgcccaggacacagggaaaagatgttttagccttgc ctgcatcccatcagacaagggcgactactgtcctgccttaatcttacacc tgtaatactagtcctacagtggacaaaagcttgccttaaacaggaaactg tggaaatgcttgggtaagcaggtgatgcactgactcaggctagcattgca ggaacagcccttcacaacactttagctaattccaggatccatttctagaa acgaaagggacacagcatctcatcactggcttaatctttccagtggtaca gtgcttgcctgtcatgtccaaagccttaggtttattccttaagtggaagg atgccccctgacaacccatggtgaagtttcaaacctccatagatacttat ttttttccaagggtcctcctttcgttgactggtgggagacaccagagaag tatgaagtgaattctatagattccagagtagtagtcccagatcagcagat cagcctgtctaccaacagaaaacccacagttgatcagacgcacttgcact caagtacgtacagactatatccatccaccaccactttccatgccttcctg ttgactcttt
quality values	Open. Hide. 39 12 22 24 58 58 58 54 58 58 58 58 58 54 58 34 33 62 62 62 39 42 62 47 56 62 62 62 62 62 62 33 42 31 21 32 27 36 28 62 56 62 49 43 54 53 62 54 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 54 54 62 54 54 56 62 62 62 62 62 62 62 59 62 59 59 59 59 62 62 62 59 59 62 59 62 59 54 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 52 54 58 49 58 58 54 58 58 58 58 58 58 58 58 58 58 52 58 54 58 58 54 37 58 58 58 58 58 58 58 46 41 53 54 58 58 58 58 58 54 53 58 58 54 58 41 40 54 51 58 58 58 58 58 58 58 52 58 53 52 58 58 58 49 58 51 40 52 54 52 50 58 50 54 42 51 50 58 53 58 44 49 52 58 58 51 52 51 50 58 46 58 58 58 52 53 37 46 50 58 53 58 47 53 53 50 58 58 41 31 44 39 40 58 49 50 51 58 49 51 53 53 41 51 51 58 47 28 40 58 49 58 47 54 53 38 58 51 41 49 51 53 32 58 41 40 50 50 39 40 44 54 51 45 49 54 54 53 53 31 51 42 45 51 44 49 51 45 54 41 52 50 41 51 41 50 39 22 54 35 53 54 42 29 27 32 27 25 39 32 32 49 34 49 49 35 39 54 54 40 37 37 54 54 37 53 32 39 25 41 41 24 40 30 37 37 54 44 34 42 27 38 41 41 54 54 52 45 54 46 37 37 44 21 42 40 32 47 32 29 18 35 30 47 49 42 21 34 53 25 33 35 29 47 31 31 47 36 19 47 51 46 29 32 31 43 34 21 6 18 31 24 32 32 32 31 31 30 10 8 46 31 31 31 42 31 34 42 45 37 42 29 17 38 25 51 33 26 51 51 37 51 30 46 46 32 43 29 51 51 51 48 32 43 34 31 25 29 15 29 43 31 46 42 29 31 41 37 32 31 35 32 29 26 31 6 31 12 6 46 20 12 47 21 31 31 31 32 37 32 41 46 9 14 31 30 28 30 31 19 37 46 13 24 28 31 18 31 25 22 31 32 28 30 16 29 30 31 31 16 27 31 24 41 22 23 36 18 37 16 25 21 25 28 31 31 26 22 31 31 33 31 24 8 5 31 21 16 36 14 22 17 25 24 30 32 31 20 30 22 20 27 44 23 11 11 44 32 22 21 19 16 38 19 21 21 7 10 9 24 24 24 5 19 25 18 26 32 24 25 18 33 26 30 17 31 34 24 19 20 12 26 8 20 33 22 26 24 14 19 26 9 22 33 22 37 20 21 19 30 28 32 18 22 14 39 7 8 22 18 29 24 31 28 25 17 20 17 14 7 20 28 14 15 20 13 16 12 27 10 26 22 26 21 7 16 20 28 47 21 24 9 16 12 16 9 19 40 15 24 7 38 29 9 5 7 8 38 47 19 6 6 8 16 6 11 3 5 18 6 5 4 5 22 17 20 11 14 7 17 4 7 5 10 6 9 9 14 9 17 17 8 2 2 7 22 9 9 9 23 14 8 13 5 11 5 15 9 14 4 4 4 5 3 7 17 11 18 20 29 28 22 4 11 6 23 5 24 12 20 9 7 14 8 5 20 4 20 4 8 8 9 14 5 5 14 2 1 3 6 7 13 5 8 3 2 3 1 5 13 6 5 7 12 4 2 1 1 2 2 2 5 9 4 6 4 8 7 5 11 5 7 4 5 5 6 5 7 21 24 11 17 14 17 25 4 3 3 4 11 7 3 2 7	Open. Hide. 62 38 40 41 62 62 41 33 62 47 54 33 38 42 21 19 26 18 26 24 26 46 62 62 62 62 54 62 62 62 62 62 62 62 62 62 47 51 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 59 46 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 58 51 58 54 58 58 58 54 54 58 45 58 58 58 58 58 58 58 58 58 58 58 58 45 54 54 58 49 50 54 58 58 54 58 58 58 58 58 58 54 58 39 54 46 58 58 58 54 52 58 58 58 58 54 58 58 58 58 58 54 58 54 58 52 54 58 54 54 52 58 52 54 58 54 58 41 58 58 49 47 54 51 58 54 58 58 58 58 54 58 51 58 58 53 54 58 58 58 58 58 41 50 49 51 58 51 58 48 58 58 50 58 51 58 51 58 52 52 58 50 51 50 52 49 52 58 58 49 40 58 49 58 58 50 49 58 49 58 54 58 48 51 50 58 49 52 52 37 48 58 58 58 50 51 58 53 36 41 54 58 43 46 49 35 58 50 58 58 58 40 58 49 38 51 54 53 58 39 58 39 33 51 50 52 53 52 54 39 41 54 49 40 21 58 37 50 43 40 50 38 43 44 54 49 39 16 58 58 50 44 30 42 51 58 51 53 41 39 39 42 39 49 46 40 50 54 54 51 50 32 44 38 15 35 52 53 33 34 31 39 49 32 32 41 40 32 54 54 54 49 30 47 42 53 54 52 37 32 53 54 30 28 54 45 41 31 45 35 29 28 53 29 44 45 52 40 39 45 40 29 47 38 51 44 35 54 54 35 41 40 53 42 54 35 37 40 34 41 32 53 53 32 37 40 31 40 31 51 32 42 29 30 21 33 31 47 32 31 28 32 52 32 21 46 31 52 45 27 34 39 45 32 34 16 21 28 47 33 34 29 9 12 33 31 51 27 31 31 30 32 30 31 33 28 32 30 23 31 30 46 41 46 46 33 42 30 21 31 18 18 46 43 31 26 30 44 21 31 36 43 21 34 46 30 11 7 47 27 22 27 31 27 31 23 31 31 18 43 34 27 34 30 33 32 31 47 47 46 47 47 30 20 18 11 24 12 46 39 17 29 32 19 24 30 27 48 37 34 21 20 41 29 31 24 34 32 44 14 29 46 33 36 17 26 13 23 25 31 23 25 34 9 41 38 18 19 33 27 31 22 25 20 18 12 21 19 20 25 23 30 23 20 31 18 27 16 21 11 25 24 18 25 9 17 21 17 25 36 17 10 13 44 24 8 10 19 27 32 34 27 31 23 9 32 27 32 33 14 15 16 20 32 31 21 17 27 18 19 12 6 9 9 16 20 43 21 10 20 36 10 5 6 19 15 18 21 31 32 27 21 17 14 33 13 7 6 4 13 5 14 15 9 15 16 19 14 11 10 19 13 14 28 24 28 9 13 16 19 28 13 11 3 3 5 11 8 11 10 25 14 11 7 6 3 3 3 23 16 27 21 40 11 10 15 19 10 19 10 7 31 38 7 5 21 11 4 4 2 7 7 15 6 5 3 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_30376943_30378135
seq2: B6Ng01-301F11.b_47_1251 (reverse)

seq1  TTATT-TATTTTAT-GTATGT-CAGTACACTGTAACTGTAC-AGATGGTT  46
      ||||| |||||||| ||| || |||||||||||||| |  | |||| |||
seq2  TTATTATATTTTATGGTAGGTCCAGTACACTGTAACGGACCAAGATTGTT  50

seq1  GTGAGCCTT-CATGT-GGTTGTTGGGAATTGATTTTTAGGACCTGTGCTC  94
      |   || || ||||| ||||||| |||| ||| |||||||  ||||||||
seq2  GGAGGCATTCCATGTGGGTTGTT-GGAACTGAATTTTAGGGACTGTGCTC  99

seq1  GCT--CCAGTCGGCCCCACTTGGCTTGGCCT-GGTGTGCTCCGGTCAAAA  141
      |||  | |||||| ||||||||||| ||||| ||||||||| ||||||||
seq2  GCTTCCAAGTCGG-CCCACTTGGCTGGGCCTGGGTGTGCTCGGGTCAAAA  148

seq1  G-ATTTATTTATTATTAAACGTAAGTACACTGTAGCTGACTTCAGATGC-  189
      | ||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  GAATTTATTTATTATTAAACGTAAGTACACTGTAGCTGACTTCAGATGCA  198

seq1  AACAGAAGAGGGCACCAGATCTCATTGTGGGTGGTTGTGAGCCACCATGT  239
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGAAGAGGGCACCAGATCTCATTGTGGGTGGTTGTGAGCCACCATGT  248

seq1  GGTT-GCTGGGATTTGAACTCAGGACCTCTGGAAGAGTAGTCAGTGCTCT  288
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGGCTGGGATTTGAACTCAGGACCTCTGGAAGAGTAGTCAGTGCTCT  298

seq1  CAACTGCTGAGGCATCTTGCTAG-CCCAGCAGATTTCTTATTAAA-GGTC  336
      ||||||||||||||||||||||| ||||||||||||||||||||| ||||
seq2  CAACTGCTGAGGCATCTTGCTAGCCCCAGCAGATTTCTTATTAAAGGGTC  348

seq1  CGTATCCATTGCTTTGTAACTAGTAAAAACAAAACAAAACCCTTGAGCAG  386
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTATCCATTGCTTTGTAACTAGTAAAAACAAAACAAAACCCTTGAGCAG  398

seq1  AGGAGCCTGTGCTGTGCCTGATGCTTTTGGGTGGAGCTCCTTTTGGCTTT  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGCCTGTGCTGTGCCTGATGCTTTTGGGTGGAGCTCCTTTTGGCTTT  448

seq1  ATTGGCTTTAAAAGGCTGTTCTGTCTAATCGCTTCTAAAATTCCTGGTAA  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGCTTTAAAAGGCTGTTCTGTCTAATCGCTTCTAAAATTCCTGGTAA  498

seq1  ATGTTTGCCGCAGACGGCATTGGTGATGATTTGAGGCTGTTGAACAGCTT  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTTGCCGCAGACGGCATTGGTGATGATTTGAGGCTGTTGAACAGCTT  548

seq1  TACAAAGGTGCACATAATTGTGTTGTTGGGGATAAGAGTTGAAAACTCTG  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAAAGGTGCACATAATTGTGTTGTTGGGGATAAGAGTTGAAAACTCTG  598

seq1  ACCACTGCTTATGTATTATGTCATTTTAACTTCCAGAGTTAAACGAGACT  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACTGCTTATGTATTATGTCATTTTAACTTCCAGAGTTAAACGAGACT  648

seq1  TTATATCACTTTCCTTCTGTATTCAAGTATTGTTTTGTTTCCTGTTTTTC  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATATCACTTTCCTTCTGTATTCAAGTATTGTTTTGTTTCCTGTTTTTC  698

seq1  TGTCTTTATAATACAGTAACTATGTATTACTTGCCATGTGTTGTATGTGT  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTTATAATACAGTAACTATGTATTACTTGCCATGTGTTGTATGTGT  748

seq1  CTGACTTACTGCTGATAATTGTGGTGACAGGTAAGAAGAAAATACGGTGG  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACTTACTGCTGATAATTGTGGTGACAGGTAAGAAGAAAATACGGTGG  798

seq1  GACCCAGTTAGGAGGCGCTTCATTCAGTCCTGTCCCATCATAAGGATCCC  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCAGTTAGGAGGCGCTTCATTCAGTCCTGTCCCATCATAAGGATCCC  848

seq1  TAACAGGTTCTTGAGAGGTGGGTGATAACAGGCAAGAGGTCTGTGCTTCC  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACAGGTTCTTGAGAGGTGGGTGATAACAGGCAAGAGGTCTGTGCTTCC  898

seq1  TGTGGGTTGAAGGGAATTTTGAATGGATTTTCTAAATTCAAAACTGTTCT  936
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGGTTGAAGGGAATTTTGAATGGATTTTCTAAATTCAAAACTGTTCT  948

seq1  CTTTAAGTTGTCTTAACAGCCAAAATTGAAGCAAAAAGTCTAGGCCTTAG  986
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAAGTTGTCTTAACAGCCAAAATTGAAGCAAAAAGTCTAGGCCTTAG  998

seq1  TTTTAAATTTATGTTTTATATTGACCACTGTTGGGATTATAATGATAAGT  1036
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAAATTTATGTTTTATATTGACCACTGTTGGGATTATAATGATAAGT  1048

seq1  TTTGGGGAAGTTAGATTCTCTTAATGTATCTTAGATAGTAGAGTAGATTA  1086
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGGGAAGTTAGATTCTCTTAATGTATCTTAGATAGTAGAGTAGATTA  1098

seq1  CCTCACTAGTATCAGTGGCAGACCACCATAACCACATCAAAAAACCTTCA  1136
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCACTAGTATCAGTGGCAGACCACCATAACCACATCAAAAAACCTTCA  1148

seq1  AGTGTAGGATGTGATTCTAAGGAAGAACCAAGTGATGATATGATAGGCTA  1186
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTAGGATGTGATTCTAAGGAAGAACCAAGTGATGATATGATAGGCTA  1198

seq1  AGAATTC  1193
      |||||||
seq2  AGAATTC  1205

seq1: chr6_30229444_30230505
seq2: B6Ng01-301F11.g_67_1126

seq1  GAATTCCAGATTACAAACACTTGGTCTATAATGAGCCAAATTAAAGTTAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGATTACAAACACTTGGTCTATAATGAGCCAAATTAAAGTTAA  50

seq1  AAGATCTATAATACATACAGTATTTGGTCCTGGAGAGATGGCTCAATGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATCTATAATACATACAGTATTTGGTCCTGGAGAGATGGCTCAATGGT  100

seq1  TACGAGCCTGGCTGTTCTACCAGAAGACTCGGATTCCCAGTGACAGGGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACGAGCCTGGCTGTTCTACCAGAAGACTCGGATTCCCAGTGACAGGGCT  150

seq1  GGTCACAACTGAACCCTGGATCCTACTTAACCTATAGATCCCAAGTGCTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCACAACTGAACCCTGGATCCTACTTAACCTATAGATCCCAAGTGCTA  200

seq1  CAACTACAGGTATGCACCACCACACCAAATTAATGCCTGTTGTTCTTTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTACAGGTATGCACCACCACACCAAATTAATGCCTGTTGTTCTTTAA  250

seq1  AAACAAAACAAAAAAACAAGACTACAGAACAAAGACAAAAGAGAAATTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAAACAAAAAAACAAGACTACAGAACAAAGACAAAAGAGAAATTTA  300

seq1  CTGCTTGTATTTATATATTATTTGAAAAAATCTTGGCCAGGTCTTTGTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTTGTATTTATATATTATTTGAAAAAATCTTGGCCAGGTCTTTGTCT  350

seq1  CATCTACTGAATCATCCATCCTGCTTTTTCAGATGGCCCTGAAAAACAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTACTGAATCATCCATCCTGCTTTTTCAGATGGCCCTGAAAAACAAA  400

seq1  ACTGAAACAAGGTAAGGACCACAAGTTTCCCACTCCTAACATATACAGTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAAACAAGGTAAGGACCACAAGTTTCCCACTCCTAACATATACAGTA  450

seq1  ACAGATTTGCCTGCTGCCCAGGACACAGGGAAAAGATGTTTTAGCCTTGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGATTTGCCTGCTGCCCAGGACACAGGGAAAAGATGTTTTAGCCTTGC  500

seq1  CTGCATCCCATCAGACAAGGGCGACTACTGTCCTGCCTTAATCTTACACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCATCCCATCAGACAAGGGCGACTACTGTCCTGCCTTAATCTTACACC  550

seq1  TGTAATACTAGTCCTACAGTGGACAAAAGCTTGCCTTAAACAGGAAACTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAATACTAGTCCTACAGTGGACAAAAGCTTGCCTTAAACAGGAAACTG  600

seq1  TGGAAATGCTTGGGTAAGCAGGTGATGCACTGACTCAGGCTAGCATTGCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAATGCTTGGGTAAGCAGGTGATGCACTGACTCAGGCTAGCATTGCA  650

seq1  GGAACAGCCCTTCACAACACTTTAGCTAATTCCAGGATCCATTTCTAGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACAGCCCTTCACAACACTTTAGCTAATTCCAGGATCCATTTCTAGAA  700

seq1  ACGAAAGGGACACAGCATCTCATCACTGGCTTAATCTTTCCAGTGGTACA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGAAAGGGACACAGCATCTCATCACTGGCTTAATCTTTCCAGTGGTACA  750

seq1  GTGCTTGCCTGTCATGTCCAAAGCCTTAGGTTTATTCCTTAAGTGGAAGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTTGCCTGTCATGTCCAAAGCCTTAGGTTTATTCCTTAAGTGGAAGG  800

seq1  ATGCCCCCTGACAACCCATGGTGAAGTTTCAAACCTCCATAGATACTTAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCCCCTGACAACCCATGGTGAAGTTTCAAACCTCCATAGATACTTAT  850

seq1  TTTTTTCCAAGGGTCCTCCTTTCGTTGACTGGTGGGAGACACCAGAGAAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTCCAAGGGTCCTCCTTTCGTTGACTGGTGGGAGACACCAGAGAAG  900

seq1  TATGAAGTGAATTCTATAGATTCCAGAGTAGTAGTCCCAGATCAGCAGAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAAGTGAATTCTATAGATTCCAGAGTAGTAGTCCCAGATCAGCAGAT  950

seq1  CAGCCTGTCTACCAACAG-AAACCCACAGTTGATCAGACGCACCTGCACT  999
      |||||||||||||||||| |||||||||||||||||||||||| ||||||
seq2  CAGCCTGTCTACCAACAGAAAACCCACAGTTGATCAGACGCACTTGCACT  1000

seq1  CAAGTACGTACAGACTTATATCCATCCACCAACCACCTTCCATGCTTTCT  1049
      ||||||||||||||| |||||||||||||| ||||| |||||||| ||| 
seq2  CAAGTACGTACAGAC-TATATCCATCCACC-ACCACTTTCCATGCCTTCC  1048

seq1  TGTTTGACTCTTT  1062
      || ||||||||||
seq2  TG-TTGACTCTTT  1060

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information