MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-342J15
Chromosome	6 (Build37)
Map Location	112,585,844 - 112,724,390
singlet/doublet	doublet
Overlap gene	Rad18, Srgap3
Upstream gene	1700054K19Rik, Lmcd1, D630042P16Rik, LOC619975, Cav3, Oxtr, LOC434076, EG434077
Downstream gene	EG666387, EG620161, LOC666397, Thumpd3, EG434078, Setd5, Lhfpl4, Mtmr14, Cpne9, Brpf1, Ogg1, Camk1, Tada3l, Arpc4, Ttll3, Rpusd3, Cidec, Jagn1, Il17re, Il17rc, Creld1, Prrt3, Tmem111, Fancd2, 4931417G12Rik, 6720456B07Rik, Vhlh, Irak2, Tatdn2, Ghrl, Sec13, Atp2b2
Link	Open Mouse BAC browser

Click to get alignment info.

name	1700054K19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67336 MGI:1914586
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs

name	Lmcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30937 MGI:1353635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630042P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243612 MGI:2443733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619975 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins pseudo : _no_value

name	Cav3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12391 MGI:107570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oxtr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18430 MGI:109147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 5 Proteins pseudo : _no_value

name	EG434077 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434077 MGI:3645010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 215 ESTs, 4 Proteins

name	Rad18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58186 MGI:1890476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srgap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259302 MGI:2152938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666387 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666387 MGI:3643192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	EG620161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620161 MGI:3648731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	LOC666397 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Thumpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14911 MGI:1277973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434078 MGI:3645011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Setd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72895 MGI:1920145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lhfpl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269788 MGI:3057108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97287 MGI:1916075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpne9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211232 MGI:2443052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brpf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78783 MGI:1926033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18294 MGI:1097693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52163 MGI:1098535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tada3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101206 MGI:1915724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68089 MGI:1915339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101100 MGI:2141418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpusd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101122 MGI:2141440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 35 ESTs, 4 Proteins

name	Cidec (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14311 MGI:95585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jagn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67767 MGI:1915017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il17re (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57890 MGI:1889371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Il17rc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171095 MGI:2159336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creld1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171508 MGI:2152539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prrt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210673 MGI:2444810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66087 MGI:1913337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fancd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211651 MGI:2448480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931417G12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70979 MGI:1918229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6720456B07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101314 MGI:1915406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vhlh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22346 MGI:103223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irak2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108960 MGI:2429603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tatdn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381801 MGI:3576210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ghrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58991 MGI:1930008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110379 MGI:99832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11941 MGI:105368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700054K19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255260 GeneID:67336 MGI:1914586
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs product : RIKEN cDNA 1700054K19 gene transcript_id : XM_001480075.1

name	Lmcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450156 GeneID:30937 MGI:1353635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM and cysteine-rich domains 1 transcript_id : NM_144799.1

name	D630042P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802588 GeneID:243612 MGI:2443733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D630042P16 gene transcript_id : NM_175525.3

name	Cav3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982475 GeneID:12391 MGI:107570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caveolin 3 transcript_id : NM_007617.2

name	Oxtr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487242 GeneID:18430 MGI:109147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxytocin receptor transcript_id : NM_001081147.1

name	EG434077 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378025 GeneID:434077 MGI:3645010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 215 ESTs, 4 Proteins product : predicted gene, EG434077 transcript_id : XM_485815.4

name	Rad18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946725 GeneID:58186 MGI:1890476
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD18 homolog (S. cerevisiae) transcript_id : NM_021385.1

name	Srgap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125345725 GeneID:259302 MGI:2152938
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLIT-ROBO Rho GTPase activating protein 3 transcript_id : NM_080448.3

name	EG666387 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378030 GeneID:666387 MGI:3643192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : predicted gene, EG666387 transcript_id : XM_983525.1

name	EG620161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255398 GeneID:620161 MGI:3648731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : predicted gene, EG620161 transcript_id : XM_884551.3

name	Thumpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982314 GeneID:14911 MGI:1277973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THUMP domain containing 3 transcript_id : NM_008188.2

name	EG434078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83029581 GeneID:434078 MGI:3645011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG434078 transcript_id : XM_489149.3

name	Setd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31742487 GeneID:72895 MGI:1920145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain containing 5 transcript_id : NM_028385.1

name	Lhfpl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922608 GeneID:269788 MGI:3057108
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipoma HMGIC fusion partner-like protein 4 transcript_id : NM_177763.3

name	Mtmr14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930426 GeneID:97287 MGI:1916075
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 14 transcript_id : NM_026849.1

name	Cpne9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881815 GeneID:211232 MGI:2443052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine family member IX transcript_id : NM_170673.3

name	Brpf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794209 GeneID:78783 MGI:1926033
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain and PHD finger containing, 1 transcript_id : NM_030178.1

name	Ogg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374385 GeneID:18294 MGI:1097693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 8-oxoguanine DNA-glycosylase 1 transcript_id : NM_010957.3

name	Camk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129899 GeneID:52163 MGI:1098535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase I transcript_id : NM_133926.2

name	Tada3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129897 GeneID:101206 MGI:1915724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional adaptor 3 (NGG1 homolog, yeast)-like transcript_id : NM_133932.2

name	Arpc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365377 GeneID:68089 MGI:1915339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 4 transcript_id : NM_026552.2

name	Ttll3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350803 GeneID:101100 MGI:2141418
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 3 transcript_id : NM_133923.4

name	Rpusd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378026 GeneID:101122 MGI:2141440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 35 ESTs, 4 Proteins product : RNA pseudouridylate synthase domain containing 3, transcript variant 1 transcript_id : XM_132830.8

name	Cidec (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802598 GeneID:14311 MGI:95585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell death-inducing DFFA-like effector c transcript_id : NM_178373.3

name	Jagn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350585 GeneID:67767 MGI:1915017
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jagunal homolog 1 (Drosophila) transcript_id : NM_026365.2

name	Il17re (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801849 GeneID:57890 MGI:1889371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor E transcript_id : NM_145826.3

name	Il17re (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404278 GeneID:57890 MGI:1889371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor E transcript_id : NM_001034031.1

name	Il17re (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404280 GeneID:57890 MGI:1889371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor E transcript_id : NM_001034029.1

name	Il17rc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30841017 GeneID:171095 MGI:2159336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17 receptor C transcript_id : NM_134159.2

name	Creld1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527147 GeneID:171508 MGI:2152539
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich with EGF-like domains 1 transcript_id : NM_133930.1

name	Prrt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130011 GeneID:210673 MGI:2444810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich transmembrane protein 3 transcript_id : NM_172487.3

name	Tmem111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383973 GeneID:66087 MGI:1913337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 111 transcript_id : NM_175101.3

name	Fancd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802416 GeneID:211651 MGI:2448480
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fanconi anemia, complementation group D2 transcript_id : NM_001033244.2

name	4931417G12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802852 GeneID:70979 MGI:1918229
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931417G12 gene transcript_id : NM_027633.2

name	6720456B07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527153 GeneID:101314 MGI:1915406
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720456B07 gene transcript_id : NM_133937.1

name	Vhlh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130344 GeneID:22346 MGI:103223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : von Hippel-Lindau syndrome homolog transcript_id : NM_009507.3

name	Irak2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802874 GeneID:108960 MGI:2429603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin-1 receptor-associated kinase 2 transcript_id : NM_172161.3

name	Tatdn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345009 GeneID:381801 MGI:3576210
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TatD DNase domain containing 2 transcript_id : NM_001033463.2

name	Ghrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358944 GeneID:58991 MGI:1930008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ghrelin transcript_id : NM_021488.4

name	Sec13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385772 GeneID:110379 MGI:99832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC13 homolog (S. cerevisiae) transcript_id : NM_024206.4

name	Atp2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861455 GeneID:11941 MGI:105368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 2 transcript_id : NM_009723.2

name	Atp2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861453 GeneID:11941 MGI:105368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 2 transcript_id : NM_001036684.1

name	1700054K19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255261 GeneID:67336 MGI:1914586
definition	codon_start : 1 product : hypothetical protein LOC67336 protein_id : XP_001480125.1

name	Lmcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450157 CCDS:CCDS20403.1 GeneID:30937 MGI:1353635
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI] codon_start : 1 product : LIM and cysteine-rich domains 1 protein_id : NP_659048.1

name	D630042P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425294 CCDS:CCDS20405.1 GeneID:243612 MGI:2443733
definition	codon_start : 1 product : Fls485 protein protein_id : NP_780734.1

name	Cav3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680852 CCDS:CCDS20406.1 GeneID:12391 MGI:107570
definition	GO_component : GO:0005901 - caveola [Evidence TAS]; GO:0016599 - caveolar membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence TAS] codon_start : 1 product : caveolin 3 protein_id : NP_031643.1

name	Oxtr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487243 GeneID:18430 MGI:109147
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004990 - oxytocin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0005000 - vasopressin receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : oxytocin receptor protein_id : NP_001074616.1

name	EG434077 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51716991 GeneID:434077 MGI:3645010
definition	codon_start : 1 product : similar to RIKEN cDNA 0610010K06 gene protein_id : XP_485815.1

name	Rad18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946726 GeneID:58186 MGI:1890476
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : post-replication repair protein RAD18SC product : RAD18 homolog protein_id : NP_067360.1

name	Srgap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125345726 GeneID:259302 MGI:2152938
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : rho GTPase activating protein 14; SLIT-ROBO Rho GTPase activating protein 2 product : brain stress early protein Gbi protein_id : NP_536696.3

name	EG666387 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378031 GeneID:666387 MGI:3643192
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988619.1

name	EG620161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029580 GeneID:620161 MGI:3648731
definition	codon_start : 1 product : similar to 40S ribosomal protein S29 protein_id : XP_889644.1

name	Thumpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680129 CCDS:CCDS20410.1 GeneID:14911 MGI:1277973
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : gene trap ROSA 26 antisense, Philippe Soriano product : THUMP domain containing 3 protein_id : NP_032214.1

name	EG434078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029582 GeneID:434078 MGI:3645011
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489149.3

name	Setd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31742488 CCDS:CCDS20411.1 GeneID:72895 MGI:1920145
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : SET domain containing 5 protein_id : NP_082661.1

name	Lhfpl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922609 GeneID:269788 MGI:3057108
definition	codon_start : 1 product : lipoma HMGIC fusion partner-like 4 protein_id : NP_808431.2

name	Mtmr14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930427 CCDS:CCDS20412.1 GeneID:97287 MGI:1916075
definition	codon_start : 1 product : myotubularin related protein 14 protein_id : NP_081125.1

name	Cpne9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28416905 CCDS:CCDS20413.1 GeneID:211232 MGI:2443052
definition	codon_start : 1 product : copine-like protein protein_id : NP_733773.2

name	Brpf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794210 GeneID:78783 MGI:1926033
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : bromodomain containing 1 protein_id : NP_084454.1

name	Ogg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18921208 CCDS:CCDS20414.1 GeneID:18294 MGI:1097693
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IMP]; GO:0005634 - nucleus [Evidence IMP] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0019104 - DNA N-glycosylase activity [Evidence TAS]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0000702 - oxidized base lesion DNA N-glycosylase activity [Evidence TAS]; GO:0008534 - oxidized purine base lesion DNA N-glycosylase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0006284 - base-excision repair [Evidence IMP] [Evidence IDA]; GO:0006281 - DNA repair [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : 8-oxoguanine DNA-glycosylase 1 protein_id : NP_035087.2

name	Camk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527140 CCDS:CCDS20415.1 GeneID:52163 MGI:1098535
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 product : calcium/calmodulin-dependent protein kinase I protein_id : NP_598687.1

name	Tada3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149314 CCDS:CCDS20416.1 GeneID:101206 MGI:1915724
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcriptional adaptor 3-like protein_id : NP_598693.1

name	Arpc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386054 CCDS:CCDS20417.1 GeneID:68089 MGI:1915339
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030041 - actin filament polymerization [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : actin related protein 2/3 complex, subunit 4 (20 kDa) product : actin related protein 2/3 complex, subunit 4 protein_id : NP_080828.1

name	Ttll3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793427 GeneID:101100 MGI:2141418
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : tubulin tyrosine ligase-like family, member 3 protein_id : NP_598684.3

name	Rpusd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63548662 GeneID:101122 MGI:2141440
definition	codon_start : 1 product : RNA pseudouridylate synthase domain containing 3 isoform 1 protein_id : XP_132830.4

name	Cidec (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410022 CCDS:CCDS20418.1 GeneID:14311 MGI:95585
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 note : CIDE-3alpha; fat specific gene 27 product : cell death-inducing DFFA-like effector c protein_id : NP_848460.1

name	Jagn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385862 CCDS:CCDS20419.1 GeneID:67767 MGI:1915017
definition	codon_start : 1 product : jagunal homolog 1 protein_id : NP_080641.1

name	Il17re (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559935 CCDS:CCDS20420.1 GeneID:57890 MGI:1889371
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : interleukin 17 receptor E isoform 1 protein_id : NP_665825.2

name	Il17re (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404281 CCDS:CCDS20421.1 GeneID:57890 MGI:1889371
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : interleukin 17 receptor E isoform 2 protein_id : NP_001029201.1

name	Il17re (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404279 CCDS:CCDS20421.1 GeneID:57890 MGI:1889371
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : interleukin 17 receptor E isoform 3 protein_id : NP_001029203.1

name	Il17rc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841018 CCDS:CCDS20422.1 GeneID:171095 MGI:2159336
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : interleukin 17 receptor-like product : interleukin 17 receptor C protein_id : NP_598920.2

name	Creld1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527148 CCDS:CCDS20423.1 GeneID:171508 MGI:2152539
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cysteine-rich with EGF-like domains 1 protein_id : NP_598691.1

name	Prrt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793406 CCDS:CCDS20424.1 GeneID:210673 MGI:2444810
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : proline-rich transmembrane protein 3 protein_id : NP_766075.2

name	Tmem111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28827824 CCDS:CCDS20425.1 GeneID:66087 MGI:1913337
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66087 protein_id : NP_780310.1

name	Fancd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776592 CCDS:CCDS20426.1 GeneID:211651 MGI:2448480
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Fanconi anemia, complementation group D2 protein_id : NP_001028416.1

name	4931417G12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037227 CCDS:CCDS20427.1 GeneID:70979 MGI:1918229
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70979 protein_id : NP_081909.1

name	6720456B07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527154 GeneID:101314 MGI:1915406
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC101314 protein_id : NP_598698.1

name	Vhlh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678567 CCDS:CCDS20429.1 GeneID:22346 MGI:103223
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0043534 - blood vessel endothelial cell migration [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : von Hippel-Lindau syndrome protein homolog protein_id : NP_033533.1

name	Irak2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543003 CCDS:CCDS20430.1 GeneID:108960 MGI:2429603
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051092 - activation of NF-kappaB transcription factor [Evidence IDA]; GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence IDA]; GO:0031663 - lipopolysaccharide-mediated signaling pathway [Evidence IDA]; GO:0043433 - negative regulation of transcription factor activity [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : interleukin-1 receptor-associated kinase 2c product : interleukin-1 receptor-associated kinase 2 protein_id : NP_751893.2

name	Tatdn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677456 CCDS:CCDS20431.1 GeneID:381801 MGI:3576210
definition	codon_start : 1 exception : mismatches in translation product : TatD DNase domain containing 2 protein_id : NP_001028635.1

name	Ghrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19224664 CCDS:CCDS20432.1 GeneID:58991 MGI:1930008
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0031768 - ghrelin receptor binding [Evidence ISS]; GO:0016608 - growth hormone-releasing hormone activity [Evidence ISS]; GO:0005179 - hormone activity [Evidence TAS] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0030252 - growth hormone secretion [Evidence ISS]; GO:0009755 - hormone-mediated signaling [Evidence ISS]; GO:0040018 - positive regulation of body size [Evidence ISS]; GO:0050791 - regulation of physiological process [Evidence IEA] codon_start : 1 note : motilin-related peptide; proghrelin product : ghrelin protein_id : NP_067463.2

name	Sec13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29150272 GeneID:110379 MGI:99832
definition	GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS] codon_start : 1 note : SEC13 related product : SEC13-like 1 protein_id : NP_077168.2

name	Atp2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753140 CCDS:CCDS20433.1 GeneID:11941 MGI:105368
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005929 - cilium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015085 - calcium ion transporter activity [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP] [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0000902 - cell morphogenesis [Evidence IMP]; GO:0021707 - cerebellar granule cell differentiation [Evidence IMP]; GO:0021702 - cerebellar Purkinje cell differentiation [Evidence IMP]; GO:0046068 - cGMP metabolism [Evidence IMP]; GO:0050910 - detection of mechanical stimulus during sensory perception of sound [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007595 - lactation [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0045299 - otolith mineralization [Evidence IMP]; GO:0050885 - regulation of balance [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] [Evidence IGI]; GO:0042428 - serotonin metabolism [Evidence IMP]; GO:0050808 - synapse organization and biogenesis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; wriggle; deaf waddler product : plasma membrane calcium ATPase 2 isoform 1 protein_id : NP_033853.1

name	Atp2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861454 CCDS:CCDS20433.1 GeneID:11941 MGI:105368
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005929 - cilium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015085 - calcium ion transporter activity [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP] [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0000902 - cell morphogenesis [Evidence IMP]; GO:0021707 - cerebellar granule cell differentiation [Evidence IMP]; GO:0021702 - cerebellar Purkinje cell differentiation [Evidence IMP]; GO:0046068 - cGMP metabolism [Evidence IMP]; GO:0050910 - detection of mechanical stimulus during sensory perception of sound [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007595 - lactation [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0045299 - otolith mineralization [Evidence IMP]; GO:0050885 - regulation of balance [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] [Evidence IGI]; GO:0042428 - serotonin metabolism [Evidence IMP]; GO:0050808 - synapse organization and biogenesis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; wriggle; deaf waddler product : plasma membrane calcium ATPase 2 isoform 2 protein_id : NP_001031761.1

name	LOC666397 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666397
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130834
definition	standard_name : D6Mit287

name	(CDS detail)
type	STS
link
xref	UniSTS:123095
definition	standard_name : 11.MMHAP90FRD8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130941
definition	standard_name : D6Mit389

name	(CDS detail)
type	STS
link
xref	UniSTS:130956
definition	standard_name : D6Mit54

name	(CDS detail)
type	STS
link
xref	UniSTS:235517
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:244322
definition	standard_name : AI071230

name	(CDS detail)
type	STS
link
xref	UniSTS:179431
definition	standard_name : AW455500

name	(CDS detail)
type	STS
link
xref	UniSTS:159555
definition	standard_name : AI385751

name	(CDS detail)
type	STS
link
xref	UniSTS:235518
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484965
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:271619
definition	standard_name : PMC170950P1

name	(CDS detail)
type	STS
link
xref	UniSTS:272964
definition	standard_name : PMC316374P3

name	(CDS detail)
type	STS
link
xref	UniSTS:130650
definition	standard_name : D6Mit107

name	(CDS detail)
type	STS
link
xref	UniSTS:235519
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130776
definition	standard_name : D6Mit23

name	(CDS detail)
type	STS
link
xref	UniSTS:96455
definition	standard_name : RH102121

name	(CDS detail)
type	STS
link
xref	UniSTS:125292
definition	standard_name : MHAa70g1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:215151
definition	standard_name : RH131868

name	(CDS detail)
type	STS
link
xref	UniSTS:159556
definition	standard_name : AI452337

name	(CDS detail)
type	STS
link
xref	UniSTS:123899
definition	standard_name : 30.MMHAP28FRB12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130882
definition	standard_name : D6Mit328

name	(CDS detail)
type	STS
link
xref	UniSTS:208009
definition	standard_name : AI036285

name	(CDS detail)
type	STS
link
xref	UniSTS:213491
definition	standard_name : RH130204

name	(CDS detail)
type	STS
link
xref	UniSTS:179432
definition	standard_name : AW556087

name	(CDS detail)
type	STS
link
xref	UniSTS:179433
definition	standard_name : AV258896

name	(CDS detail)
type	STS
link
xref	UniSTS:271057
definition	standard_name : PMC150244P1

name	(CDS detail)
type	STS
link
xref	UniSTS:235520
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210580
definition	standard_name : RH136600

name	(CDS detail)
type	STS
link
xref	UniSTS:210571
definition	standard_name : RH136591

name	(CDS detail)
type	STS
link
xref	UniSTS:230202
definition	standard_name : G66214

name	(CDS detail)
type	STS
link
xref	UniSTS:64710
definition	standard_name : RH12737

name	(CDS detail)
type	STS
link
xref	UniSTS:164334
definition	standard_name : AI604880

name	(CDS detail)
type	STS
link
xref	UniSTS:130931
definition	standard_name : D6Mit378

name	(CDS detail)
type	STS
link
xref	UniSTS:159557
definition	standard_name : AW553738

name	(CDS detail)
type	STS
link
xref	UniSTS:208011
definition	standard_name : BB407082

name	(CDS detail)
type	STS
link
xref	UniSTS:144081
definition	standard_name : Ogg1

name	(CDS detail)
type	STS
link
xref	UniSTS:167474
definition	standard_name : D6Ertd263e

name	(CDS detail)
type	STS
link
xref	UniSTS:159558
definition	standard_name : AI505105

name	(CDS detail)
type	STS
link
xref	UniSTS:130643
definition	standard_name : D6Mit10

name	(CDS detail)
type	STS
link
xref	UniSTS:208013
definition	standard_name : BB284401

name	(CDS detail)
type	STS
link
xref	UniSTS:164336
definition	standard_name : AI987856

name	(CDS detail)
type	STS
link
xref	UniSTS:270317
definition	standard_name : PMC117179P1

name	(CDS detail)
type	STS
link
xref	UniSTS:268964
definition	standard_name : MARC_26162-26163:1030455175:1

name	(CDS detail)
type	STS
link
xref	UniSTS:238061
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179434
definition	standard_name : AI327076

name	(CDS detail)
type	STS
link
xref	UniSTS:179435
definition	standard_name : AI450050

name	(CDS detail)
type	STS
link
xref	UniSTS:124430
definition	standard_name : 41.MMHAP80FLF5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:164337
definition	standard_name : AI527266

name	(CDS detail)
type	STS
link
xref	UniSTS:143143
definition	standard_name : Fsp27

name	(CDS detail)
type	STS
link
xref	UniSTS:165481
definition	standard_name : AW146438

name	(CDS detail)
type	STS
link
xref	UniSTS:212888
definition	standard_name : RH129589

name	(CDS detail)
type	STS
link
xref	UniSTS:161809
definition	standard_name : RH124987

name	(CDS detail)
type	STS
link
xref	UniSTS:164335
definition	standard_name : AI843811

name	(CDS detail)
type	STS
link
xref	UniSTS:248834
definition	standard_name : BF415092

name	(CDS detail)
type	STS
link
xref	UniSTS:179436
definition	standard_name : AW260416

name	(CDS detail)
type	STS
link
xref	UniSTS:209995
definition	standard_name : RH135999

name	(CDS detail)
type	STS
link
xref	UniSTS:271784
definition	standard_name : PMC194856P1

name	(CDS detail)
type	STS
link
xref	UniSTS:130653
definition	standard_name : D6Mit11

name	(CDS detail)
type	STS
link
xref	UniSTS:271804
definition	standard_name : PMC196256P1

name	(CDS detail)
type	STS
link
xref	UniSTS:208012
definition	standard_name : AU015151

name	(CDS detail)
type	STS
link
xref	UniSTS:185678
definition	standard_name : BB137857

name	(CDS detail)
type	STS
link
xref	UniSTS:165482
definition	standard_name : AW011779

name	(CDS detail)
type	STS
link
xref	UniSTS:217900
definition	standard_name : RH134621

name	(CDS detail)
type	STS
link
xref	UniSTS:272192
definition	standard_name : PMC23053P2

name	(CDS detail)
type	STS
link
xref	UniSTS:272191
definition	standard_name : PMC23053P1

name	(CDS detail)
type	STS
link
xref	UniSTS:163396
definition	standard_name : U12570

name	(CDS detail)
type	STS
link
xref	UniSTS:144755
definition	standard_name : Vhlh

name	(CDS detail)
type	STS
link
xref	UniSTS:235523
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179439
definition	standard_name : AI649099

name	(CDS detail)
type	STS
link
xref	UniSTS:125454
definition	standard_name : MHAa97b9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179438
definition	standard_name : AI646012

name	(CDS detail)
type	STS
link
xref	UniSTS:272300
definition	standard_name : PMC262394P1

name	(CDS detail)
type	STS
link
xref	UniSTS:272302
definition	standard_name : PMC262394P3

name	(CDS detail)
type	STS
link
xref	UniSTS:272301
definition	standard_name : PMC262394P2

name	(CDS detail)
type	STS
link
xref	UniSTS:234686
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:95075
definition	standard_name : G43664

name	(CDS detail)
type	STS
link
xref	UniSTS:150914
definition	standard_name : D3S2930E

name	(CDS detail)
type	STS
link
xref	UniSTS:43011
definition	standard_name : D3S3990

name	LOC619975 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255396 GeneID:619975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_034821.1

name	LOC434076 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255397 GeneID:434076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 5 Proteins product : similar to zinc finger protein 289 pseudo : _no_value transcript_id : XR_035710.1

clone name	MSMg01-116B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272A20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113L13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-342J15.b	B6Ng01-342J15.g
ACC	GA125636	GA125637
length	1,124	1,136
definition	B6Ng01-342J15.b	B6Ng01-342J15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(112,723,269 - 112,724,390)	(112,585,844 - 112,587,007)
sequence	gaattcaagggtactgaagctcctcacataagaacactattcaaagaact tgtgcgtatcctcctgtatacttgaaatcgcctctgcattacttagcata cctaacactatgcaactgttgtgcacggttgtgttgtattgcttaggggg caataagaaaatgcctgcctacattcagtccagagattttttccccctcc tatatatactttctgtccttggttggctgaatttgtggacatgcagtttg tagacaagacagaccaacaatgtgattgtcacaattgtctccggtgcatc tttactcattcctaacagtgacaggagcacttgtcaactgcttctggttc actgtgctcactactgtctgtccaagcagttactttcattccacaactcc ctgccttgcaactgattagtctggcttgctaagattatgttaaaggtctc ttcaagcccacagtgactgtgcaaatatgactgaagaaccacgctggcga cagcaggagggtagacgctagagtaagaggaccctagttcccatctggta ctgcctttgccgtccgtgtccaacacgggtaacccagggcagactccttg gccttgctggacctgtgtcctgggctctggatggaatgttaatgatagcc cccaccctggctccacagatctgcaatgacagagttcctttctgcaggtc tgccaggtcagtgcacagcagcctgtccagacagagctgctcatgcggta ccaccagctgcagtccaggctggccactctcaagattgagaatgaagagg tgagtgagctgctaccctgtgtctagtttctttgggcttgtgcagtggag tctcatgccctggactgtatagaaaatgatggctcattggtgggagacta tacaaccgcacagcccacctgcactaagaatatttagtgccctaaaggat gcttacaagacctcacgtgaaagggaaacagagaaagcccggactctatg tttagaacgattgcagatttgcaggcttagatgcttggaaaatgtttgaa ctgttgagccttgcctccatcctcagctgtagagtgatgatagttaccta atgaagttcattgccttttctgcc	gaattcctgagatacagagcgacgtgttatgcttacttggtaaaatcaat aaaagcaagcagaatcagcggtttactatgtacccatgttccagaatgga tctgggtgagaggggaaaaggacagagacgtcatacaaattaattctgcc ttgcctactgatgaggaacccagacaaccattccaggaagagataatgga atgctatctagttattaagctaaggtaagagttaaaaccagcctgcaaga cttccaagactgcaggcaagtagaacccacccacatggctgttcttcacc taacttgaacattcagttcttagaccacgaaggcagtggtggtctaaaat acaggctgatggaaaccctcacgttgaaatgggagaatgcctgggatgga gtgaacgagaggcttaagtctccctctagagaggtggcatcagctcccag atctccatccttcatccacagaagcagatactgtgtttacgacttctcag caaactttctactttgaaacacttgtgttctatcttagctcaccctttcc tcagactctcactgtctctaagaccttgtaatacctgctcttctgataaa agacaagtagtgtggcagtgactggaacaacgaatcccaagcaaccagtt aaaaacacaaaattccaacagcaaaaggtggtaaatgacggatcattttt gccccatccatttttttacactagtacatggattaagggattgtgatttt ttaaaaagtaaactagagtcagctgttaactggccaccacctaggagacc tgcttatattgattcaaacagttactgcctgtctaacagtcagaaggaac tacgagttcctgcagcctctacaacttttctcagtgttcttaaaagcaca ctcgctactcctttttgttcttcattttctcaatgaataattattctgca catttaaaattgaaccattttatgatcaaacagcacacacagacatattc tttggacaagaatatccagtttgaaaggtattcgatagcagcatcacttg acagttcgttacttggtggagcatcgactcgataacagtgcctgcctatg gctaggactgcttactgacacacgctacggcttccc
quality values	Open. Hide. 62 47 22 38 62 37 26 47 62 62 47 62 54 47 54 62 54 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 62 62 59 54 54 62 59 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 54 54 62 62 62 58 54 58 54 58 58 58 58 58 58 54 54 54 58 58 58 49 58 54 42 58 58 58 54 58 58 58 58 58 54 49 58 58 58 58 58 54 54 47 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 42 39 58 54 54 54 54 58 58 51 54 58 53 58 50 50 50 58 58 49 58 50 58 50 58 53 54 58 58 58 46 41 51 58 51 51 58 58 58 49 45 31 58 51 58 41 51 54 53 58 54 58 58 58 52 58 52 58 29 49 51 34 58 51 51 58 33 49 31 49 50 50 46 51 53 33 58 53 53 58 58 58 49 52 53 58 58 49 53 47 50 52 39 46 37 50 41 53 46 42 53 51 52 41 32 54 50 58 49 42 42 50 51 25 41 53 39 58 53 58 53 53 58 53 42 42 29 54 39 49 54 41 49 41 32 37 54 41 45 52 40 40 50 39 37 45 52 49 37 52 31 54 44 50 53 41 26 34 37 37 46 35 21 32 53 28 38 53 52 40 53 40 33 42 51 35 49 54 34 42 45 46 32 53 51 31 37 45 40 37 34 32 43 33 33 40 33 46 45 38 33 34 31 11 44 26 32 47 32 52 39 32 34 31 32 23 38 45 45 26 32 31 33 32 31 33 29 53 18 37 25 32 53 32 41 36 41 18 40 39 42 34 43 25 28 52 45 24 30 18 28 32 31 31 29 26 31 51 51 45 51 51 31 41 46 46 31 51 32 31 29 32 31 37 31 25 30 31 28 13 31 37 37 33 28 29 43 24 46 31 31 13 24 6 14 26 31 17 33 38 31 32 43 48 48 30 28 31 35 18 31 33 22 35 38 33 31 26 31 42 31 32 48 31 31 20 26 18 34 26 31 27 32 31 27 36 35 21 31 31 31 21 16 27 47 33 31 24 23 21 32 31 26 27 32 26 27 12 30 13 8 15 21 48 21 25 33 34 37 22 48 38 28 25 47 32 32 33 24 24 32 31 26 32 33 37 19 22 9 31 28 32 20 20 12 31 26 27 34 25 48 21 6 47 18 30 48 23 29 41 14 31 15 30 44 32 11 7 34 11 33 15 17 7 13 5 11 27 25 29 23 43 24 27 13 13 33 27 22 34 17 23 34 16 10 10 30 15 43 25 12 25 21 18 25 26 22 25 22 7 29 9 23 15 23 11 25 7 4 32 34 24 24 21 28 34 27 15 13 16 24 27 13 9 5 6 9 5 18 17 9 8 23 6 9 16 9 28 11 13 17 8 10 26 20 10 28 7 16 8 7 6 16 7 6 6 9 27 15 23 13 28 13 13 10 11 10 18 7 10 21 5 12 7 14 7 21 13 13 13 10 7 16 8 17 15 30 28 8 18 13 17 13 12	Open. Hide. 62 49 51 44 62 62 62 62 62 62 59 59 51 59 49 26 46 62 62 62 62 59 59 62 62 62 62 59 62 59 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 54 54 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 54 54 54 58 58 58 58 58 58 58 58 54 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 51 58 54 58 58 58 53 49 58 58 58 58 48 58 58 58 58 53 52 58 46 58 58 58 54 53 58 51 58 58 58 54 58 47 49 58 52 51 35 58 51 58 58 39 49 58 53 53 47 58 58 58 58 51 58 51 49 53 58 58 49 46 50 58 51 58 52 53 40 50 58 53 45 41 53 53 58 42 58 51 37 53 53 53 58 46 39 51 58 58 50 40 50 25 51 53 53 58 50 50 50 58 54 40 51 53 52 50 51 52 58 32 49 50 28 26 54 54 54 52 52 40 49 32 54 54 51 45 53 49 49 28 52 53 34 53 41 40 54 49 29 39 54 21 54 54 26 52 54 35 37 53 37 32 35 54 29 30 45 37 41 54 54 54 51 33 33 54 54 53 30 45 40 47 19 33 54 54 54 54 54 35 32 42 23 51 41 35 33 31 35 40 31 34 51 33 23 23 37 24 47 31 49 46 22 13 31 47 30 32 40 20 52 53 53 53 41 37 53 53 53 32 32 32 43 53 31 32 34 31 27 38 25 29 43 31 30 31 36 42 24 31 29 23 30 25 22 33 30 33 27 31 42 36 35 46 33 38 32 42 42 22 31 18 41 29 42 32 32 32 31 38 32 31 43 42 18 23 46 34 27 47 34 34 32 31 34 31 29 38 34 42 28 37 26 32 17 32 31 37 27 32 32 26 21 38 32 28 32 27 11 22 22 27 26 31 31 32 15 39 17 16 32 22 22 30 30 21 29 26 31 29 32 31 34 32 27 22 27 32 37 48 44 33 29 26 33 27 24 28 38 14 19 29 22 25 31 44 44 31 15 27 22 32 27 27 34 37 30 37 26 28 21 31 22 32 37 48 47 47 26 31 15 18 28 18 21 31 11 30 48 48 28 19 17 23 19 22 27 33 30 10 20 17 33 13 18 9 4 11 32 24 21 29 13 6 17 32 48 19 19 43 43 28 10 22 25 13 16 14 21 18 29 47 47 27 6 13 13 30 12 26 14 40 9 27 7 16 28 16 18 15 16 13 16 7 19 19 16 9 26 5 4 6 13 16 34 17 10 8 17 16 11 28 20 15 15 9 8 7 15 13 5 5 11 40 11 5 3 32 28 9 16 16 16 16 19 18 12 13 4 12 5 18 16 10 10 27 17 22 4 7 18 22 11 22 6 10 10 11 11 8 16 5 3 4 22 5 8 21 6 6 24 6 8 9 2 8 23 10 7 24 9 7 6 3 1 2 4 4 11 6 12 1 2 2 7 9 8 7 11 4 4 8 3 5 1 1 6 8 5 4 7 4 8 7 7 5 9 7 10 2 1 2 2 1 5 6 6 5 4 9 4 17 14 7 13 4 12 25 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_112723269_112724390
seq2: B6Ng01-342J15.b_45_1168 (reverse)

seq1  GGCAGAAAAG--CATGAAC-TCATTA-GTAACTATCAATCACTCTACAGC  46
      ||||||||||   |||||| |||||| ||||||||| |||||||||||||
seq2  GGCAGAAAAGGCAATGAACTTCATTAGGTAACTATC-ATCACTCTACAGC  49

seq1  TGA-GATGGAGCCAAGGCTC-ACAGTTCAAAACATTTTCCCAAGCATTCT  94
      ||| ||||||| |||||||| ||||||| ||||||||| ||||||| |||
seq2  TGAGGATGGAGGCAAGGCTCAACAGTTC-AAACATTTT-CCAAGCA-TCT  96

seq1  AAGCCTGCAAATCTGCAATCGTTCTAAACATAGAGTCC-GGCTTTCTCTT  143
      |||||||||||||||||||||||||||||||||||||| ||||||||| |
seq2  AAGCCTGCAAATCTGCAATCGTTCTAAACATAGAGTCCGGGCTTTCTC-T  145

seq1  GTTTCCCTTTCACGTGAGGTCTTGTAAGCATCCTTTAGGGCACTAAATAT  193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCCTTTCACGTGAGGTCTTGTAAGCATCCTTTAGGGCACTAAATAT  195

seq1  TCTTAGTGCAGGTGGGCTGTGCGGTTGTATAGTCTCCCACCAATGAGCCA  243
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGTGCAGGTGGGCTGTGCGGTTGTATAGTCTCCCACCAATGAGCCA  245

seq1  TCATTTTCTATACAGTCCAGGGCATGAGACTCCACTGCACAAGCCCAAAG  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTTCTATACAGTCCAGGGCATGAGACTCCACTGCACAAGCCCAAAG  295

seq1  AAACTAGACACAGGGTAGCAGCTCACTCACCTCTTCATTCTCAATCTTGA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTAGACACAGGGTAGCAGCTCACTCACCTCTTCATTCTCAATCTTGA  345

seq1  GAGTGGCCAGCCTGGACTGCAGCTGGTGGTACCGCATGAGCAGCTCTGTC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGGCCAGCCTGGACTGCAGCTGGTGGTACCGCATGAGCAGCTCTGTC  395

seq1  TGGACAGGCTGCTGTGCACTGACCTGGCAGACCTGCAGAAAGGAACTCTG  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACAGGCTGCTGTGCACTGACCTGGCAGACCTGCAGAAAGGAACTCTG  445

seq1  TCATTGCAGATCTGTGGAGCCAGGGTGGGGGCTATCATTAACATTCCATC  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTGCAGATCTGTGGAGCCAGGGTGGGGGCTATCATTAACATTCCATC  495

seq1  CAGAGCCCAGGACACAGGTCCAGCAAGGCCAAGGAGTCTGCCCTGGGTTA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGCCCAGGACACAGGTCCAGCAAGGCCAAGGAGTCTGCCCTGGGTTA  545

seq1  CCCGTGTTGGACACGGACGGCAAAGGCAGTACCAGATGGGAACTAGGGTC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGTGTTGGACACGGACGGCAAAGGCAGTACCAGATGGGAACTAGGGTC  595

seq1  CTCTTACTCTAGCGTCTACCCTCCTGCTGTCGCCAGCGTGGTTCTTCAGT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTACTCTAGCGTCTACCCTCCTGCTGTCGCCAGCGTGGTTCTTCAGT  645

seq1  CATATTTGCACAGTCACTGTGGGCTTGAAGAGACCTTTAACATAATCTTA  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATTTGCACAGTCACTGTGGGCTTGAAGAGACCTTTAACATAATCTTA  695

seq1  GCAAGCCAGACTAATCAGTTGCAAGGCAGGGAGTTGTGGAATGAAAGTAA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGCCAGACTAATCAGTTGCAAGGCAGGGAGTTGTGGAATGAAAGTAA  745

seq1  CTGCTTGGACAGACAGTAGTGAGCACAGTGAACCAGAAGCAGTTGACAAG  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTTGGACAGACAGTAGTGAGCACAGTGAACCAGAAGCAGTTGACAAG  795

seq1  TGCTCCTGTCACTGTTAGGAATGAGTAAAGATGCACCGGAGACAATTGTG  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCCTGTCACTGTTAGGAATGAGTAAAGATGCACCGGAGACAATTGTG  845

seq1  ACAATCACATTGTTGGTCTGTCTTGTCTACAAACTGCATGTCCACAAATT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATCACATTGTTGGTCTGTCTTGTCTACAAACTGCATGTCCACAAATT  895

seq1  CAGCCAACCAAGGACAGAAAGTATATATAGGAGGGGGAAAAAATCTCTGG  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCAACCAAGGACAGAAAGTATATATAGGAGGGGGAAAAAATCTCTGG  945

seq1  ACTGAATGTAGGCAGGCATTTTCTTATTGCCCCCTAAGCAATACAACACA  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAATGTAGGCAGGCATTTTCTTATTGCCCCCTAAGCAATACAACACA  995

seq1  ACCGTGCACAACAGTTGCATAGTGTTAGGTATGCTAAGTAATGCAGAGGC  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCGTGCACAACAGTTGCATAGTGTTAGGTATGCTAAGTAATGCAGAGGC  1045

seq1  GATTTCAAGTATACAGGAGGATACGCACAAGTTCTTTGAATAGTGTTCTT  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTCAAGTATACAGGAGGATACGCACAAGTTCTTTGAATAGTGTTCTT  1095

seq1  ATGTGAGGAGCTTCAGTACCCTTGAATTC  1122
      |||||||||||||||||||||||||||||
seq2  ATGTGAGGAGCTTCAGTACCCTTGAATTC  1124

seq1: chr6_112585844_112587007
seq2: B6Ng01-342J15.g_66_1201

seq1  GAATTCCTGAGATACAGAGCGACGTGTTATGCTTACTTGGTAAAATCAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGAGATACAGAGCGACGTGTTATGCTTACTTGGTAAAATCAAT  50

seq1  AAAAGCAAGCAGAATCAGCGGTTTACTATGTACCCATGTTCCAGAATGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCAAGCAGAATCAGCGGTTTACTATGTACCCATGTTCCAGAATGGA  100

seq1  TCTGGGTGAGAGGGGAAAAGGACAGAGACGTCATACAAATTAATTCTGCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGTGAGAGGGGAAAAGGACAGAGACGTCATACAAATTAATTCTGCC  150

seq1  TTGCCTACTGATGAGGAACCCAGACAACCATTCCAGGAAGAGATAATGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCTACTGATGAGGAACCCAGACAACCATTCCAGGAAGAGATAATGGA  200

seq1  ATGCTATCTAGTTATTAAGCTAAGGTAAGAGTTAAAACCAGCCTGCAAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTATCTAGTTATTAAGCTAAGGTAAGAGTTAAAACCAGCCTGCAAGA  250

seq1  CTTCCAAGACTGCAGGCAAGTAGAACCCACCCACATGGCTGTTCTTCACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCAAGACTGCAGGCAAGTAGAACCCACCCACATGGCTGTTCTTCACC  300

seq1  TAACTTGAACATTCAGTTCTTAGACCACGAAGGCAGTGGTGGTCTAAAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTTGAACATTCAGTTCTTAGACCACGAAGGCAGTGGTGGTCTAAAAT  350

seq1  ACAGGCTGATGGAAACCCTCACGTTGAAATGGGAGAATGCCTGGGATGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGCTGATGGAAACCCTCACGTTGAAATGGGAGAATGCCTGGGATGGA  400

seq1  GTGAACGAGAGGCTTAAGTCTCCCTCTAGAGAGGTGGCATCAGCTCCCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAACGAGAGGCTTAAGTCTCCCTCTAGAGAGGTGGCATCAGCTCCCAG  450

seq1  ATCTCCATCCTTCATCCACAGAAGCAGATACTGTGTTTACGACTTCTCAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCCATCCTTCATCCACAGAAGCAGATACTGTGTTTACGACTTCTCAG  500

seq1  CAAACTTTCTACTTTGAAACACTTGTGTTCTATCTTAGCTCACCCTTTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACTTTCTACTTTGAAACACTTGTGTTCTATCTTAGCTCACCCTTTCC  550

seq1  TCAGACTCTCACTGTCTCTAAGACCTTGTAATACCTGCTCTTCTGATAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGACTCTCACTGTCTCTAAGACCTTGTAATACCTGCTCTTCTGATAAA  600

seq1  AGACAAGTAGTGTGGCAGTGACTGGAACAACGAATCCCAAGCAACCAGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAAGTAGTGTGGCAGTGACTGGAACAACGAATCCCAAGCAACCAGTT  650

seq1  AAAAACACAAAATTCCAACAGCAAAAGGTGGTAAATGACGGATCATTTTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACACAAAATTCCAACAGCAAAAGGTGGTAAATGACGGATCATTTTT  700

seq1  GCCCCATCCATTTTTTTACACTAGTACATGGATTAAGGGATTGTGATTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCCATCCATTTTTTTACACTAGTACATGGATTAAGGGATTGTGATTTT  750

seq1  TTAAAAAGTAAACTAGAGTCAGCTGTTAACTGGCCACCACCTAGGAGACC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAAGTAAACTAGAGTCAGCTGTTAACTGGCCACCACCTAGGAGACC  800

seq1  TGCTTATATTGATTCAAACAGTTACTGCCTGTCTAACAGTCAGAAGGAAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTATATTGATTCAAACAGTTACTGCCTGTCTAACAGTCAGAAGGAAC  850

seq1  TACGAGTTCCTGCAGCCTCTACAACTTTTCTCAGTGTTCTTAAAAGCACA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACGAGTTCCTGCAGCCTCTACAACTTTTCTCAGTGTTCTTAAAAGCACA  900

seq1  CTCGCTACTCCTTTTTGTTCTTCATTTTTCTCAATGAATAATTAATTCTG  950
      |||||||||||||||||||||||| |||||||||||||||||| ||||||
seq2  CTCGCTACTCCTTTTTGTTCTTCA-TTTTCTCAATGAATAATT-ATTCTG  948

seq1  CCAACATTTAAAAATTGAACCATTTTTATGAATCAAACAGCACACACAGA  1000
      |  |||||| |||||||||||| ||||||| |||||||||||||||||||
seq2  C--ACATTT-AAAATTGAACCA-TTTTATG-ATCAAACAGCACACACAGA  993

seq1  CATA-TCTTTGGACAAGAATATCCCAAGTTTGGAAAGTATTCGATAAGCA  1049
      |||| |||||||||||||||||||  |||||| || ||||||||| ||||
seq2  CATATTCTTTGGACAAGAATATCC--AGTTTGAAAGGTATTCGAT-AGCA  1040

seq1  GCAATCCACTTTGAACAGTTCGGTTTACCTGGTGGGAGGGCATCAGACTC  1099
      |||   |||||   ||||||||  |||| |||||   | ||||| |||||
seq2  GCA--TCACTT--GACAGTTCG--TTACTTGGTG---GAGCATC-GACTC  1080

seq1  GGTATACAGGTGCCTGCCTATGGGGCCAGCACTGCTAACTGCACCACACA  1149
      | || ||| ||||||||||||  ||| || |||||| ||||    |||||
seq2  GATA-ACA-GTGCCTGCCTAT--GGCTAGGACTGCTTACTG----ACACA  1122

seq1  CGCTACGTGCTTCCC  1164
      ||||||| |||||||
seq2  CGCTACG-GCTTCCC  1136

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information