MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-141B08
Chromosome	6 (Build37)
Map Location	87,806,538 - 87,806,705
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Aak1, LOC100043555, Nfu1, Gfpt1, D6Ertd527e, Antxr1, Gkn1, Gkn2, 1190003M12Rik, Bmp10, Arhgap25, Prokr1, 2010301N04Rik, 1810020O05Rik, AB041550, LOC100043118, EG545864, Gp9, Rab43, Isy1, Cnbp
Downstream gene	Copg, 8430410A17Rik, LOC665416, H1fx, EG434064, LOC100043131, Rab7, Rpn1, Gata2, Dnajb8, Eefsec, Ruvbl1, Sec61a1, 4933428M03Rik, Mgll, Abtb1, Podxl2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269774 MGI:1098687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins

name	Nfu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Ertd527e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs

name	Antxr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69538 MGI:1916788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gkn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66283 MGI:1913533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gkn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66284 MGI:1913534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190003M12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68888 MGI:1916138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12154 MGI:1338820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Prokr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58182 MGI:1929676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010301N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72103 MGI:1919353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810020O05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:613264 MGI:3586838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	AB041550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58229 MGI:1931020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG545864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545864 MGI:3647624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 2630 ESTs, 8 Proteins

name	Gp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54368 MGI:1860137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69834 MGI:1917084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Isy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57905 MGI:1923310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12785 MGI:88431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54161 MGI:1858696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	8430410A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232210 MGI:1914053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins pseudo : _no_value

name	H1fx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243529 MGI:2685307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434064 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434064 MGI:3648213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100043131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rab7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19349 MGI:105068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103963 MGI:98084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gata2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14461 MGI:95662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56691 MGI:1922801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eefsec (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65967 MGI:2137092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ruvbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56505 MGI:1928760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec61a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53421 MGI:1858417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933428M03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74589 MGI:1918481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgll (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23945 MGI:1346042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abtb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80283 MGI:1933148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Podxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319655 MGI:2442488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046263 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_001040106.2

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046243 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_177762.6

name	LOC100043555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255329 GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins product : similar to Aak1 protein transcript_id : XM_001480194.1

name	Nfu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130523 GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) transcript_id : NM_020045.2

name	Gfpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980779 GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine fructose-6-phosphate transaminase 1 transcript_id : NM_013528.2

name	D6Ertd527e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377982 GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs product : DNA segment, Chr 6, ERATO Doi 527, expressed transcript_id : XM_489144.3

name	Antxr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971258 GeneID:69538 MGI:1916788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anthrax toxin receptor 1 transcript_id : NM_054041.2

name	Gkn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384881 GeneID:66283 MGI:1913533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrokine 1 transcript_id : NM_025466.1

name	Gkn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384883 GeneID:66284 MGI:1913534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrokine 2 transcript_id : NM_025467.1

name	1190003M12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326172 GeneID:68888 MGI:1916138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190003M12 gene transcript_id : NM_026860.1

name	Bmp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857762 GeneID:12154 MGI:1338820
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 10 transcript_id : NM_009756.1

name	Arhgap25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582810 GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 25 transcript_id : NM_001037727.1

name	Arhgap25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582812 GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 25 transcript_id : NM_175476.3

name	Prokr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254342 GeneID:58182 MGI:1929676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prokineticin receptor 1 transcript_id : NM_021381.3

name	2010301N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361671 GeneID:72103 MGI:1919353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010301N04 gene transcript_id : NM_024251.3

name	1810020O05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255231 GeneID:613264 MGI:3586838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : Riken cDNA 1810020O05 gene transcript_id : XM_001479524.1

name	AB041550 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946781 GeneID:58229 MGI:1931020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein, MNCb-4779 transcript_id : NM_021418.1

name	LOC100043118 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255233 GeneID:100043118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to coiled-coil domain containing 48 transcript_id : XM_001479529.1

name	Gp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055225 GeneID:54368 MGI:1860137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein 9 (platelet) transcript_id : NM_018762.1

name	Rab43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476068 GeneID:69834 MGI:1917084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB43, member RAS oncogene family transcript_id : NM_001039394.1

name	Rab43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476067 GeneID:69834 MGI:1917084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB43, member RAS oncogene family transcript_id : NM_133717.2

name	Isy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372613 GeneID:57905 MGI:1923310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ISY1 splicing factor homolog (S. cerevisiae) transcript_id : NM_133934.3

name	Cnbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476048 GeneID:12785 MGI:88431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cellular nucleic acid binding protein transcript_id : NM_013493.2

name	Copg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130780 GeneID:54161 MGI:1858696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit gamma transcript_id : NM_017477.2

name	Copg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059162 GeneID:54161 MGI:1858696
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit gamma transcript_id : NM_201244.1

name	8430410A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343454 GeneID:232210 MGI:1914053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430410A17 gene transcript_id : NM_173737.2

name	H1fx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348565 GeneID:243529 MGI:2685307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H1 histone family, member X transcript_id : NM_198622.1

name	EG434064 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255236 GeneID:434064 MGI:3648213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG434064 transcript_id : XM_976858.2

name	LOC100043131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255237 GeneID:100043131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043131 transcript_id : XM_001479559.1

name	Rab7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679598 GeneID:19349 MGI:105068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB7, member RAS oncogene family transcript_id : NM_009005.1

name	Rpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802696 GeneID:103963 MGI:98084
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribophorin I transcript_id : NM_133933.3

name	Gata2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378318 GeneID:14461 MGI:95662
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA binding protein 2 transcript_id : NM_008090.4

name	Dnajb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910415 GeneID:56691 MGI:1922801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 8 transcript_id : NM_019964.1

name	Eefsec (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038122 GeneID:65967 MGI:2137092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic elongation factor, selenocysteine-tRNA-specific transcript_id : NM_023060.3

name	Ruvbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053923 GeneID:56505 MGI:1928760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RuvB-like protein 1 transcript_id : NM_019685.2

name	Sec61a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387803 GeneID:53421 MGI:1858417
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sec61 alpha 1 subunit (S. cerevisiae) transcript_id : NM_016906.3

name	4933428M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312803 GeneID:74589 MGI:1918481
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933428M03 gene transcript_id : NM_029013.1

name	Mgll (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982751 GeneID:23945 MGI:1346042
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoglyceride lipase transcript_id : NM_011844.3

name	Abtb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365947 GeneID:80283 MGI:1933148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and BTB (POZ) domain containing 1 transcript_id : NM_030251.2

name	Podxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542456 GeneID:319655 MGI:2442488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podocalyxin-like 2 transcript_id : NM_176973.3

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91992157 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : AP2 associated kinase 1 isoform 1 protein_id : NP_001035195.1

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73695877 CCDS:CCDS20317.1 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : AP2 associated kinase 1 isoform 2 protein_id : NP_808430.2

name	LOC100043555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255330 GeneID:100043555
definition	codon_start : 1 product : similar to Aak1 protein protein_id : XP_001480244.1

name	Nfu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910264 GeneID:56748 MGI:1913290
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : HIRA-interacting protein 5 product : histone cell cycle regulation defective interacting protein 5 protein_id : NP_064429.1

name	Gfpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305085 GeneID:14583 MGI:95698
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004360 - glutamine-fructose-6-phosphate transaminase (isomerizing) activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutamine:fructose-6-phosphate amidotransferase 1 product : glutamine fructose-6-phosphate transaminase 1 protein_id : NP_038556.1

name	D6Ertd527e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029415 GeneID:52372 MGI:1261919
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489144.2

name	Antxr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189436 CCDS:CCDS20318.1 GeneID:69538 MGI:1916788
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : tumor endothelial marker 8 product : anthrax toxin receptor 1 protein_id : NP_473382.1

name	Gkn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384882 CCDS:CCDS20319.1 GeneID:66283 MGI:1913533
definition	GO_component : GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : foveolin product : gastrokine 1 protein_id : NP_079742.1

name	Gkn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384884 GeneID:66284 MGI:1913534
definition	codon_start : 1 product : blottin protein_id : NP_079743.1

name	1190003M12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326173 CCDS:CCDS20320.1 GeneID:68888 MGI:1916138
definition	codon_start : 1 product : hypothetical protein LOC68888 protein_id : NP_081136.1

name	Bmp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857763 GeneID:12154 MGI:1338820
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] [Evidence IC] GO_function : GO:0005125 - cytokine activity [Evidence IC] [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IC] [Evidence IEA] GO_process : GO:0010002 - cardioblast differentiation [Evidence IC]; GO:0007267 - cell-cell signaling [Evidence IC]; GO:0009790 - embryonic development [Evidence NAS]; GO:0035050 - embryonic heart tube development [Evidence NAS]; GO:0040007 - growth [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IC] codon_start : 1 exception : mismatches in translation product : bone morphogenetic protein 10 preproprotein protein_id : NP_033886.1

name	Arhgap25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582811 CCDS:CCDS20321.1 GeneID:232201 MGI:2443687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : Rho GTPase activating protein 25 isoform a protein_id : NP_001032816.1

name	Arhgap25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582813 CCDS:CCDS20322.1 GeneID:232201 MGI:2443687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : Rho GTPase activating protein 25 isoform b protein_id : NP_780685.2

name	Prokr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254343 CCDS:CCDS20323.1 GeneID:58182 MGI:1929676
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 73 protein_id : NP_067356.2

name	2010301N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541860 CCDS:CCDS20324.1 GeneID:72103 MGI:1919353
definition	codon_start : 1 product : hypothetical protein LOC72103 protein_id : NP_077213.2

name	1810020O05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255232 GeneID:613264 MGI:3586838
definition	codon_start : 1 product : similar to hCG20001 protein_id : XP_001479574.1

name	AB041550 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946782 CCDS:CCDS20326.1 GeneID:58229 MGI:1931020
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC58229 protein_id : NP_067393.1

name	LOC100043118 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255234 GeneID:100043118
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479579.1

name	Gp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055226 CCDS:CCDS20328.1 GeneID:54368 MGI:1860137
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : platelet glycoprotein IX product : glycoprotein 9 (platelet) protein_id : NP_061232.1

name	Rab43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476069 CCDS:CCDS20329.1 GeneID:69834 MGI:1917084
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : RAB43, member RAS oncogene family isoform a protein_id : NP_001034483.1

name	Rab43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746181 CCDS:CCDS20330.1 GeneID:69834 MGI:1917084
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : RAB43, member RAS oncogene family isoform b protein_id : NP_598478.1

name	Isy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149316 GeneID:57905 MGI:1923310
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : ISY1 splicing factor homolog protein_id : NP_598695.1

name	Cnbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304969 GeneID:12785 MGI:88431
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : cellular nucleic acid binding protein 1 product : cellular nucleic acid binding protein protein_id : NP_038521.1

name	Copg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567338 GeneID:54161 MGI:1858696
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; coatomer protein complex, subunit gamma 1 product : coatomer protein complex, subunit gamma isoform 1 protein_id : NP_059505.1

name	Copg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059163 GeneID:54161 MGI:1858696
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; coatomer protein complex, subunit gamma 1 product : coatomer protein complex, subunit gamma isoform 2 protein_id : NP_957696.1

name	8430410A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424571 GeneID:232210 MGI:1914053
definition	codon_start : 1 product : hypothetical protein LOC232210 protein_id : NP_776098.1

name	H1fx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348566 CCDS:CCDS20331.1 GeneID:243529 MGI:2685307
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : H1 histone family, member X protein_id : NP_941024.1

name	EG434064 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377989 GeneID:434064 MGI:3648213
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981952.1

name	LOC100043131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255238 GeneID:100043131
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479609.1

name	Rab7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679599 GeneID:19349 MGI:105068
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA] [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAB7, member RAS oncogene family protein_id : NP_033031.1

name	Rpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543605 CCDS:CCDS20332.1 GeneID:103963 MGI:98084
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribophorin I protein_id : NP_598694.2

name	Gata2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982351 CCDS:CCDS20333.1 GeneID:14461 MGI:95662
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0006909 - phagocytosis [Evidence IEA]; GO:0021983 - pituitary gland development [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GATA-binding protein 2 product : GATA binding protein 2 protein_id : NP_032116.3

name	Dnajb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910416 CCDS:CCDS20334.1 GeneID:56691 MGI:1922801
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : DnaJ homolog 6 product : DnaJ homolog, subfamily B, member 8 protein_id : NP_064348.1

name	Eefsec (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746442 CCDS:CCDS20335.1 GeneID:65967 MGI:2137092
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0001514 - selenocysteine incorporation [Evidence IMP] [Evidence IDA] codon_start : 1 note : MJ0495-like protein SelB product : eukaryotic elongation factor, selenocysteine-tRNA-specific protein_id : NP_075547.1

name	Ruvbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790083 CCDS:CCDS20336.1 GeneID:56505 MGI:1928760
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Pontin 52 product : RuvB-like protein 1 protein_id : NP_062659.1

name	Sec61a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394252 GeneID:53421 MGI:1858417
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA] GO_process : GO:0009306 - protein secretion [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : transport protein sec61 alpha subunit; SEC61, alpha subunit product : Sec61 alpha subunit homolog protein_id : NP_058602.1

name	4933428M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312804 CCDS:CCDS20337.1 GeneID:74589 MGI:1918481
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74589 protein_id : NP_083289.1

name	Mgll (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754690 CCDS:CCDS20338.1 GeneID:23945 MGI:1346042
definition	GO_function : GO:0047372 - acylglycerol lipase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] citation : [PUBMED 9341166] codon_start : 1 note : monoacylglycerol lipase product : monoglyceride lipase protein_id : NP_035974.1

name	Abtb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384866 CCDS:CCDS20339.1 GeneID:80283 MGI:1933148
definition	GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mFLJ00331 protein product : ankyrin repeat and BTB (POZ) domain containing 1 protein_id : NP_084527.1

name	Podxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542457 CCDS:CCDS20340.1 GeneID:319655 MGI:2442488
definition	codon_start : 1 exception : mismatches in translation product : podocalyxin-like 2 protein_id : NP_795947.2

name	(CDS detail)
type	STS
link
xref	UniSTS:130877
definition	standard_name : D6Mit323

name	(CDS detail)
type	STS
link
xref	UniSTS:215646
definition	standard_name : RH132363

name	(CDS detail)
type	STS
link
xref	UniSTS:179408
definition	standard_name : AU067724

name	(CDS detail)
type	STS
link
xref	UniSTS:164330
definition	standard_name : AU067726

name	(CDS detail)
type	STS
link
xref	UniSTS:207988
definition	standard_name : RH126710

name	(CDS detail)
type	STS
link
xref	UniSTS:167472
definition	standard_name : RH126656

name	(CDS detail)
type	STS
link
xref	UniSTS:162071
definition	standard_name : RH125249

name	(CDS detail)
type	STS
link
xref	UniSTS:165475
definition	standard_name : AI324119

name	(CDS detail)
type	STS
link
xref	UniSTS:159538
definition	standard_name : AI449986

name	(CDS detail)
type	STS
link
xref	UniSTS:167494
definition	standard_name : D6Ertd527e

name	(CDS detail)
type	STS
link
xref	UniSTS:159534
definition	standard_name : AU043841

name	(CDS detail)
type	STS
link
xref	UniSTS:235487
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235488
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130991
definition	standard_name : D6Mit9

name	(CDS detail)
type	STS
link
xref	UniSTS:496636
definition	standard_name : Bmp10

name	(CDS detail)
type	STS
link
xref	UniSTS:266025
definition	standard_name : PCBP1

name	(CDS detail)
type	STS
link
xref	UniSTS:22959
definition	standard_name : A006T05

name	(CDS detail)
type	STS
link
xref	UniSTS:130758
definition	standard_name : D6Mit213

name	(CDS detail)
type	STS
link
xref	UniSTS:179410
definition	standard_name : AI452191

name	(CDS detail)
type	STS
link
xref	UniSTS:130774
definition	standard_name : D6Mit228

name	(CDS detail)
type	STS
link
xref	UniSTS:490558
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270581
definition	standard_name : PMC129049P1

name	(CDS detail)
type	STS
link
xref	UniSTS:256435
definition	standard_name : Gp9

name	(CDS detail)
type	STS
link
xref	UniSTS:219169
definition	standard_name : RH137081

name	(CDS detail)
type	STS
link
xref	UniSTS:163395
definition	standard_name : AB007464

name	(CDS detail)
type	STS
link
xref	UniSTS:235491
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235490
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179411
definition	standard_name : AW490415

name	(CDS detail)
type	STS
link
xref	UniSTS:159536
definition	standard_name : AI181014

name	(CDS detail)
type	STS
link
xref	UniSTS:210545
definition	standard_name : RH136565

name	(CDS detail)
type	STS
link
xref	UniSTS:141362
definition	standard_name : Cnbp

name	(CDS detail)
type	STS
link
xref	UniSTS:25935
definition	standard_name : SHGC-77307

name	(CDS detail)
type	STS
link
xref	UniSTS:216088
definition	standard_name : RH132805

name	(CDS detail)
type	STS
link
xref	UniSTS:161571
definition	standard_name : RH124749

name	(CDS detail)
type	STS
link
xref	UniSTS:479151
definition	standard_name : Cnbp

name	(CDS detail)
type	STS
link
xref	UniSTS:224585
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:271437
definition	standard_name : PMC15869P1

name	(CDS detail)
type	STS
link
xref	UniSTS:210532
definition	standard_name : RH136550

name	(CDS detail)
type	STS
link
xref	UniSTS:142652
definition	standard_name : RH125682

name	(CDS detail)
type	STS
link
xref	UniSTS:167498
definition	standard_name : D6Ertd71e

name	(CDS detail)
type	STS
link
xref	UniSTS:207991
definition	standard_name : AW546958

name	(CDS detail)
type	STS
link
xref	UniSTS:124773
definition	standard_name : D18356

name	(CDS detail)
type	STS
link
xref	UniSTS:207992
definition	standard_name : RH127177

name	(CDS detail)
type	STS
link
xref	UniSTS:254130
definition	standard_name : SRCR23H

name	(CDS detail)
type	STS
link
xref	UniSTS:144311
definition	standard_name : Rab7-ps1

name	(CDS detail)
type	STS
link
xref	UniSTS:270460
definition	standard_name : PMC124275P2

name	(CDS detail)
type	STS
link
xref	UniSTS:225345
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167477
definition	standard_name : RH126941

name	(CDS detail)
type	STS
link
xref	UniSTS:144310
definition	standard_name : Rab7

name	(CDS detail)
type	STS
link
xref	UniSTS:210244
definition	standard_name : RH136250

name	(CDS detail)
type	STS
link
xref	UniSTS:142648
definition	standard_name : D6Wsu137e

name	(CDS detail)
type	STS
link
xref	UniSTS:130946
definition	standard_name : D6Mit40

name	(CDS detail)
type	STS
link
xref	UniSTS:273134
definition	standard_name : PMC327172P1

name	(CDS detail)
type	STS
link
xref	UniSTS:468005
definition	standard_name : Gata2

name	(CDS detail)
type	STS
link
xref	UniSTS:270438
definition	standard_name : PMC123124P2

name	(CDS detail)
type	STS
link
xref	UniSTS:273367
definition	standard_name : PMC58532P1

name	(CDS detail)
type	STS
link
xref	UniSTS:464674
definition	standard_name : Gata2

name	(CDS detail)
type	STS
link
xref	UniSTS:159531
definition	standard_name : AB000096

name	(CDS detail)
type	STS
link
xref	UniSTS:159537
definition	standard_name : AI326313

name	(CDS detail)
type	STS
link
xref	UniSTS:123383
definition	standard_name : 18.MMHAP4FLF3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123735
definition	standard_name : 26.MMHAP36FLA5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130772
definition	standard_name : D6Mit226

name	(CDS detail)
type	STS
link
xref	UniSTS:162635
definition	standard_name : RH125916

name	(CDS detail)
type	STS
link
xref	UniSTS:161530
definition	standard_name : RH124708

name	(CDS detail)
type	STS
link
xref	UniSTS:130810
definition	standard_name : D6Mit261.1

name	(CDS detail)
type	STS
link
xref	UniSTS:116324
definition	standard_name : D6Mit261

name	(CDS detail)
type	STS
link
xref	UniSTS:130732
definition	standard_name : D6Mit190

name	(CDS detail)
type	STS
link
xref	UniSTS:233942
definition	standard_name : Mgll

name	(CDS detail)
type	STS
link
xref	UniSTS:211734
definition	standard_name : RH128426

name	(CDS detail)
type	STS
link
xref	UniSTS:161784
definition	standard_name : RH124962

name	(CDS detail)
type	STS
link
xref	UniSTS:164332
definition	standard_name : AI847549

name	EG545864 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255333 GeneID:545864 MGI:3647624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1272 ESTs, 4 Proteins product : predicted gene, EG545864 transcript_id : XR_035706.1

name	LOC665416 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255235 GeneID:665416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : similar to Rps19 protein pseudo : _no_value transcript_id : XR_034267.1

clone name	MSMg01-365J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-485N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-141B08.T7 (MSMg01no141_b08.b1)	MSMg01-141B08.TJ (MSMg01no141_b08.g1)
ACC	AG346051	AG346052
length	1,299	1,407
length of high quality (start - end)	169 (92 - 260)	---
definition	CHROMAT_FILE: MSMg01no141_b08.b1 PHD_FILE: MSMg01no141_b08.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:59:05 2005	CHROMAT_FILE: MSMg01no141_b08.g1 PHD_FILE: MSMg01no141_b08.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:59:05 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CAACTTTTNNNAATCACTGGGCGCTATAGACTCCTATAGGGAGAGGATCC GCGGAATTCTCATGGTCACCAGNTTCCTTTAAAGGCCCCTTGCTCCCCAA GTTAATTGGTCAATAACCCTTTAAAGCCTGTGATTGCCCAGTAGAGAGAG TCAGGCAGGACTCTTGAGGATTGTGTGAGTGCATCTCCATAGAGACCAGA GAAGGAGAAGAGAGGAGACAAAGAGAGAAGGAAGGGGGAGGGATGAAGAG GGGAGGAGGTTGCCCTGATAGGAGATTGATCATGATCTCTTGTCCTGGAT AAACATCTAGTATCAAGTTACATGATGGCTAGTTATTATTTATATTAGCT CCTATCCTGTCTAATCTAGGGTTATTGTTTGTTCATAAATACTAAGATTG CGTGTCTTTTTTTTTTGTAGATAGAACTTATTAATTCCTACTTTTTGATC GTGTTCTCCCCACTTTTTGTTGCCCTCGCTTGGATTAATATCTTCGGTTG TCCTCTGAACTTCTTTTTGATGTATGTTTCTTATTTATTTCTTCTTCCTT ATCTCTTTCTTTTCTTTTTTATATTTTATTCTTTTTTTATTTTTATCTTC CTTTTTTTTTTTTTCTGTTTTTTTTGTTTTTTATGTCTTTTTTTTCTTTT ATTTCTTATTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTGTCTTTTCTTT TTTTCTTTTTTTTTTTTTCGTATTTTTTTTCTTTTTCTTATTTTTTTCTT CTTTTGTTTTCTTTCTTCTTTTTTTTTTTTTTTTTTTTTTTTCCTTTTTT TTTTTTTTCTTTTCTTTTCTTTCTTTTTCTTTTTTTTTTTTTATTTTTTT TTCCTTTTTTCTTTTCTTTCTTTCTTTTTTCTTTATCTTTTTTTTTTTTC TTTTTTTCTTACTTTTTCTTCTTTTTTCCTTTTTCTTTGTTCTTTTTTTT TTTCTCTTCTCTTTCTTTTTTTTTTCTTTTTCTCTCTTCTTTTTTTTTTT TTTTCCTTCTTTCCTTTTTCTTTCTTTTTTTATTCTCTTTTTTTTTTTTT TCTTCTTCTTTTTCTTCTTTTCTTTTCCTTTTATCTTCTCTCTTTATTTT TTTTTTTTTTCTTCTTTTTTCTTCTTCTTTTCTTTTCTTTTTTTCTTTTC ATTTATTCTTGATTTCTTTTATTCATGTTTCTCTCTCTTATATTTTTTCT ATTCTTATTTTCTTCCTCTTCCTTTTCCCTTTTTATCCTCTTTCTTCTTC TATCTTACTCCTTCTTCCTCATTCTCTAATTTCGCTTTCTTCTTCTGTT	TTTTTCGCAGTGTGCCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXCCCTTTTAGAAAACTTTTCAGAAAGTATATAAATG CTATAGCCCCCCTATTTCGTCTCCCGGTCACCCCCCTGTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTTNTTTTTCTTTTT TTTTTTTTTTTNTTTTTTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNTCTTTTT TTTTTTTTTTTTTNTTTTTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTCT CTCCCTCTCCTTTTTTTTTTCTCTCTCCCCCTNTCCCCTCCCTTTTCTTC TTCTCCTTCTTTTCCTCCTCTTCTCTTCTTCCCTCCTCTCCCCTCCTCTT TTTTTTCCCCTTCTTTTTTCCTTCTCCCCTCCCTTCCTTTTCTTTTTTCT CCCCTCTTTTCTCTCTCTTCCTCTCTCCTTTCTTTCCCCCCTCCCCCCTC CTCTTTCCCCTCTTCTCCTTTTCTCCCTCTTCCTCCTCTCCCTCTCCCTC CCTCCCTTCTCCCTTTCCTCCTCTCCCCTCTTCCTTCTTCTCTTTCCCTC TTCCTTTCTTCTTCCCCTCCCTCCCTTTCTCTTCTTTCTCTCCTTCTTCT TCTTCCTCCTCCTTCTCTTCTCCTCCTCTTTCCTTCTTCTTCCTCCTTCC TTCTCCCTCCCTCTCCCCCTCTTCCCTCCCTCTCCTCTCCCCTCCTTCCC TTTCCTCTCCCTCTTCCCTCTTTCTCCCTTTCTCTTCTCTCCTCTTTCCT CTCTTCCTCTCTTTTTTTCCCTTCTTCTCTTTTCTTCTTCCTTTTCCCCC TCTTCTCTCTCCTTCCCTCTTTCCTCTTCTTCCTCTTTTTTCTTCCTTTC TCCTTCCTCTTTTCTTCTCTCTTTCCTCCTTCTTCCCTTCTTTCTCTCCC CTCTCCCCTTCCTTCCCTCTCCCCTCTCTTCTCTCTTCTTCTTTCTTTTC TTCTTCCTCTCTCTCTTCCCTTTTTCTTTCCCCCTCTCTCTCCTNTCTCC CCTTTTTTTTCCCTCTTCCTCNCTCTCCTCTTCTCCTCTTCTTATCTCCC CTCTCTTCTCTCCTTCCTCCCTTTTCCATTTCCNCTCCTCCTTTCTCCCT CCTCTCTTCTCCCTCTCTTCCTTCCTCTTCCTCTCTTTCTCTTTCTCTCT CCCTTTCTCCCCTCCTTCTTTCTTTCTCTCCCTCCTTTCTCTCCNCCTTC TCCTCTTCTCCTTCTCCTCTCTCTCTCCCTTCCCTCTCTCTTTTCCTTCT CCTCTTN
quality values	Open. Hide. 11 11 11 9 9 15 18 3 0 0 0 3 8 8 6 6 6 6 7 6 10 12 10 8 8 8 8 8 8 17 19 8 8 8 10 15 13 19 24 35 28 24 28 28 33 36 37 47 47 47 48 50 50 50 50 50 50 42 38 38 36 36 31 31 28 30 33 30 47 21 21 3 0 3 6 6 6 6 6 7 7 7 6 8 9 9 9 12 16 16 16 22 22 28 33 33 50 59 53 53 38 38 38 36 53 36 53 33 33 33 33 31 28 28 18 16 10 10 11 14 13 19 22 29 32 32 32 28 30 22 22 30 25 19 12 11 13 14 13 10 10 18 19 29 37 59 37 48 39 39 39 47 47 48 48 48 57 48 50 50 50 50 47 47 47 47 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 48 42 37 30 30 30 30 44 44 57 57 54 54 54 57 57 57 57 57 43 43 43 44 44 48 59 59 48 48 48 57 44 43 43 44 57 57 57 59 59 59 59 57 54 54 54 50 52 52 52 52 52 52 57 52 52 50 57 57 48 57 50 50 57 48 48 48 50 59 59 41 32 20 15 15 18 12 12 12 12 8 8 10 10 12 10 12 12 12 24 24 19 13 13 10 10 10 11 11 8 8 8 8 10 10 16 9 9 9 9 9 9 9 12 12 12 10 9 8 8 8 10 8 8 10 19 19 13 11 12 10 10 9 9 9 11 12 15 15 15 12 12 12 15 14 14 12 19 15 15 11 11 12 20 13 10 10 11 11 11 10 10 11 11 19 15 14 12 12 11 10 8 15 8 8 8 8 10 13 28 18 13 9 8 8 8 8 10 10 7 7 8 10 13 15 11 8 8 8 8 8 11 11 8 8 8 8 8 8 12 18 24 37 28 21 21 10 10 10 10 10 11 19 39 27 20 11 8 7 7 8 10 10 11 11 18 24 28 18 13 10 8 8 10 13 19 10 12 10 11 10 10 10 10 11 11 10 10 13 10 8 8 10 10 10 8 6 7 6 6 8 8 9 9 8 8 8 8 8 9 10 15 11 12 11 9 6 6 8 8 8 8 8 9 9 9 9 9 9 9 10 11 8 8 8 10 10 8 8 8 8 10 17 21 11 11 11 12 16 12 12 9 8 8 8 8 8 8 9 13 15 12 6 6 8 8 8 8 9 11 18 14 11 9 9 9 9 9 10 12 9 9 15 8 10 10 8 8 8 8 8 9 10 8 8 8 8 6 6 8 10 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 9 9 10 10 13 6 6 8 8 10 12 8 8 6 6 8 8 8 6 6 10 10 10 10 10 9 8 11 10 10 10 11 11 6 6 8 8 10 13 10 8 8 10 10 8 8 8 10 12 9 9 8 8 8 10 10 15 10 10 8 6 8 6 7 10 10 10 9 9 8 10 9 9 9 11 11 19 11 9 9 9 10 10 16 15 19 22 17 9 8 8 8 8 15 11 8 9 8 10 9 9 10 10 18 15 15 10 11 12 14 10 13 13 11 11 11 11 13 16 10 10 9 8 8 11 8 10 10 10 10 15 9 9 8 10 9 8 8 6 6 8 13 15 28 16 10 10 9 9 10 9 8 8 8 8 8 8 10 10 10 10 10 8 8 8 8 8 10 10 9 13 10 9 9 9 13 10 10 10 8 8 8 8 8 8 9 12 13 21 12 9 8 10 8 8 8 8 12 19 15 15 10 10 11 12 11 11 11 11 14 13 11 12 13 10 10 10 18 16 10 9 9 10 9 9 9 9 10 16 13 10 9 9 10 8 13 10 10 10 9 9 9 9 9 8 8 6 7 8 8 9 15 11 11 11 18 18 20 20 11 9 9 10 10 14 19 17 13 13 12 11 10 10 13 12 12 10 8 8 8 8 8 8 8 8 8 8 9 8 10 11 10 8 10 10 10 8 7 8 8 8 8 8 8 8 11 15 16 11 10 10 11 16 20 18 19 11 12 11 18 13 19 19 16 12 8 8 8 8 8 8 13 15 17 16 8 8 6 7 8 8 9 14 12 10 10 10 16 21 22 21 21 10 10 13 9 9 9 9 8 8 8 8 8 11 14 17 10 10 10 10 8 8 6 6 6 6 8 8 8 13 8 8 8 10 13 10 15 15 12 8 8 8 8 8 11 19 17 8 8 7 8 10 8 10 8 8 10 11 11 10 11 12 11 13 15 24 24 24 12 11 6 6 8 8 9 10 10 10 8 8 6 6 10 10 13 8 6 6 10 8 7 6 8 8 11 10 10 8 8 10 10 8 8 8 10 11 10 20 23 24 18 12 9 9 10 10 10 8 10 10 9 11 11 10 12 10 10 9 10 9 8 11 7 6 8 8 8 12 13 18 15 16 11 10 10 10 12 8 8 6 6 8 8 8 8 8 7 9 9 8 11 6 6 8 8 10 10 13 15 19 19 12 19 11 11 8 8 6 6 8 6 7 11 8 15 15 9 9 8 8 6 6 8 6 6 6 8 9 9 8 8 8 9 9 8 8 8 8 10 10 9 10 9 10 8 16 11 10 10 12 10 9 9 14 15 15 11 10 10 10 10 10 9 10 10 10 9 9 9 12 8 10 7 6 8 8 10 14 8 9 10 13 10 8 8 8 6 6 8 8 17 23 25 19 13 8 8 6 6 11 9 9 9 9 14 22 17 9 8 8 8 8 8 8 10 10 12 12 9 9 10 10 9 9 11 6 7 8 8 10 9 10 9 10 8 8 8 9 12 9 8 10 8 7 12 8 8 8 8 8 8 8 7 6 8 8 10 11 8 8 6 6 8 8 8 8 8 6 6 10 10 12 7 6 8 6 6 11 10 6 6 6 7 11 8 8 8 8 10 8 10 10 7 7 7 7	Open. Hide. 12 12 8 8 9 9 6 6 6 6 6 6 6 6 6 8 6 7 13 8 8 8 12 8 10 6 7 8 8 8 8 7 7 7 6 8 17 21 19 9 9 19 17 19 8 15 19 22 19 21 19 19 33 59 43 50 50 50 50 47 41 27 23 9 9 7 12 10 10 10 8 8 7 7 7 8 8 10 9 15 15 16 23 23 23 23 11 20 16 23 31 35 44 53 53 53 48 48 48 39 39 44 37 39 41 41 39 27 23 32 24 15 9 10 10 12 15 10 10 8 8 8 8 11 8 8 8 8 10 12 10 15 12 13 10 11 11 11 8 17 8 10 12 12 20 20 20 14 18 19 15 10 14 8 7 7 7 8 10 10 8 10 8 7 9 9 9 9 9 9 9 9 9 9 9 9 13 12 14 12 19 10 9 9 10 10 10 3 0 3 10 8 8 10 10 8 8 10 12 17 11 11 11 8 8 8 9 9 8 6 3 0 3 8 8 9 10 10 10 10 10 3 0 3 6 8 8 8 9 9 9 7 8 8 7 7 8 8 7 7 9 12 15 14 9 8 8 7 8 9 15 12 9 9 3 0 3 13 15 17 12 12 12 21 13 11 8 8 6 7 8 7 9 8 10 10 9 9 12 13 13 9 9 9 8 8 8 8 10 13 11 11 11 17 10 7 7 6 10 8 8 6 6 6 6 8 9 11 15 22 21 9 9 9 9 9 9 9 10 8 8 8 8 8 9 9 9 9 10 10 9 10 10 14 14 10 11 11 10 8 8 3 0 3 8 8 8 8 6 6 6 10 10 10 10 10 17 15 19 10 8 8 3 0 3 8 7 9 9 9 9 9 3 0 3 6 8 8 8 6 7 7 8 8 9 9 9 9 10 10 9 11 9 9 12 10 9 8 8 8 15 8 8 8 8 8 8 6 6 8 8 9 18 30 32 29 37 21 8 8 6 6 8 8 8 8 9 9 9 10 11 3 0 3 6 6 6 10 15 10 11 11 11 12 15 13 10 10 10 8 8 6 6 8 8 8 7 7 8 12 8 8 8 8 8 6 6 6 6 8 8 9 10 10 11 10 10 15 10 9 8 8 8 8 8 12 15 12 12 12 12 9 8 8 8 8 8 9 12 12 9 9 9 8 8 6 6 10 10 10 10 10 10 9 9 10 10 10 10 10 10 11 8 8 6 6 10 10 12 15 15 12 9 10 9 9 9 9 11 12 14 9 9 9 10 10 10 8 8 8 8 9 11 11 12 12 12 11 11 11 10 10 10 10 10 8 8 9 9 10 9 9 9 8 10 8 8 7 7 10 10 11 11 10 10 10 10 12 12 10 11 10 10 11 11 10 11 11 10 8 8 8 10 8 8 13 10 10 10 16 12 13 13 13 13 13 15 15 11 11 8 8 8 8 10 10 11 12 12 18 8 8 10 8 8 10 16 8 8 8 7 6 6 8 8 8 8 8 8 8 8 11 12 9 9 8 8 8 8 8 8 8 8 8 8 7 6 8 8 8 10 10 8 8 8 8 9 8 8 8 10 10 10 8 8 8 8 8 10 8 8 8 10 15 16 8 8 8 12 12 12 10 12 10 12 13 14 14 8 8 7 9 12 8 8 8 10 10 10 10 10 10 8 8 6 6 8 8 8 10 10 13 10 10 9 8 8 8 8 8 8 11 11 10 10 8 12 11 8 8 8 10 10 10 12 11 11 8 7 7 8 8 8 8 8 8 8 8 9 9 9 9 9 9 10 10 10 12 9 9 9 9 8 8 8 8 10 10 10 10 8 8 8 12 10 8 8 10 9 10 9 9 9 9 13 10 8 8 8 8 11 9 9 9 10 10 8 8 8 11 9 9 9 8 8 8 8 8 8 8 10 10 10 9 10 10 12 8 8 8 8 9 9 10 11 11 11 10 13 12 10 10 10 9 8 8 8 8 8 8 9 9 9 11 11 12 9 10 8 8 8 8 8 6 6 8 10 14 16 16 12 8 7 6 8 8 10 8 8 8 9 12 12 10 8 8 8 6 6 6 6 8 8 8 8 8 8 8 12 8 6 6 8 8 11 8 8 8 8 8 9 11 11 11 10 8 10 6 6 8 8 9 9 9 8 8 8 8 8 8 6 6 10 10 10 8 8 8 9 8 8 10 11 10 10 6 6 8 10 8 8 8 8 8 8 8 10 8 8 8 9 8 8 7 7 10 10 8 8 8 8 8 6 6 8 8 9 9 9 11 11 11 9 8 8 8 8 8 9 10 8 8 8 8 8 8 8 8 8 10 19 21 23 18 15 10 8 8 6 6 8 8 8 8 8 8 6 6 6 6 8 8 8 6 6 8 8 8 10 8 8 8 11 12 8 10 9 8 8 8 11 11 11 11 11 13 17 11 8 7 6 8 8 11 8 8 19 8 6 6 10 8 8 6 6 8 10 10 10 9 9 10 10 10 9 6 6 6 6 8 11 8 8 8 12 9 9 8 8 6 6 8 8 9 12 11 11 10 8 8 8 8 13 10 7 6 8 8 8 8 8 8 8 8 10 10 8 8 8 11 11 8 8 6 7 8 10 8 8 8 8 8 8 3 0 3 12 10 10 8 8 8 8 8 8 8 8 8 11 9 9 9 8 8 6 6 13 10 10 8 3 0 3 8 9 9 9 9 11 11 8 8 6 6 8 10 14 9 9 10 10 9 9 9 7 8 8 10 11 8 8 8 6 6 6 6 10 14 6 6 8 8 10 10 15 8 8 6 6 8 7 7 8 8 9 9 9 9 9 10 9 8 3 0 3 7 6 8 8 8 7 10 8 8 8 10 15 9 9 11 11 10 14 23 22 14 11 12 8 8 8 8 8 10 8 8 9 10 8 8 8 8 11 8 10 9 8 8 8 8 17 15 6 6 8 8 8 8 8 6 6 8 8 6 6 8 8 9 10 10 18 10 10 8 6 6 8 15 12 8 10 11 8 8 6 6 6 6 8 8 6 6 10 8 6 6 13 6 6 8 10 12 15 15 11 11 16 19 15 15 8 10 8 3 0 3 9 9 9 10 8 10 10 8 8 8 10 13 15 14 12 12 9 9 12 9 9 10 8 9 9 9 8 15 6 6 8 8 8 8 8 8 8 7 7 10 13 13 11 6 6 8 10 7 7 8 8 9 13 13 9 9 9 10 12 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no141_b08.b1 MSMg01no141_b08.b1 CHROMAT_FILE:
MSMg01no141_b08.b1 PHD_FILE: MSMg01no141_b08.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:59:05 2005
         (169 letters)



>mm_chr6_87806400_87806968
          Length = 569

 Score =  273 bits (141), Expect = 5e-78
 Identities = 161/173 (93%), Gaps = 10/173 (5%)
 Strand = Plus / Minus

                                                                       
Query: 1   gctccccaagttaattggtcaataa-----ccctttaaagcctgtgattgcccagtagag 55
           |||||||||||||||||||||||||          |||||||||||||||  ||||||||
Sbjct: 306 gctccccaagttaattggtcaataaaaggg-----taaagcctgtgattgggcagtagag 252

                                                                       
Query: 56  agagtcaggcaggactcttgaggattgtgtgagtgcatctccatagagaccagagaagga 115
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 agagtcaggcaggactcttgaggattgtgtgagtgcatctccatagagaccagagaagga 192

                                                                
Query: 116 gaagagaggagacaaagagagaaggaagggggagggatgaagaggggaggagg 168
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 191 gaagagaggagacaaagagagaaggaagggggagggatgaagaggggaggagg 139


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 7
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 169
Length of database: 569
Length adjustment: 8
Effective length of query: 161
Effective length of database: 561
Effective search space:    90321
Effective search space used:    90321
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information